ID: 1079135142

View in Genome Browser
Species Human (GRCh38)
Location 11:17772221-17772243
Sequence GTGCGTGTGCTCACTGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079135142_1079135151 14 Left 1079135142 11:17772221-17772243 CCAGCGCCAGTGAGCACACGCAC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1079135151 11:17772258-17772280 CATCGGCTTCTGGTGGGCCGTGG 0: 1
1: 0
2: 2
3: 6
4: 79
1079135142_1079135147 8 Left 1079135142 11:17772221-17772243 CCAGCGCCAGTGAGCACACGCAC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1079135147 11:17772252-17772274 CATCCCCATCGGCTTCTGGTGGG 0: 1
1: 2
2: 1
3: 14
4: 145
1079135142_1079135146 7 Left 1079135142 11:17772221-17772243 CCAGCGCCAGTGAGCACACGCAC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1079135146 11:17772251-17772273 ACATCCCCATCGGCTTCTGGTGG 0: 1
1: 2
2: 0
3: 9
4: 115
1079135142_1079135145 4 Left 1079135142 11:17772221-17772243 CCAGCGCCAGTGAGCACACGCAC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1079135145 11:17772248-17772270 AGAACATCCCCATCGGCTTCTGG 0: 1
1: 2
2: 0
3: 7
4: 93
1079135142_1079135144 -3 Left 1079135142 11:17772221-17772243 CCAGCGCCAGTGAGCACACGCAC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1079135144 11:17772241-17772263 CACTTTAAGAACATCCCCATCGG 0: 1
1: 0
2: 4
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079135142 Original CRISPR GTGCGTGTGCTCACTGGCGC TGG (reversed) Exonic