ID: 1079135142

View in Genome Browser
Species Human (GRCh38)
Location 11:17772221-17772243
Sequence GTGCGTGTGCTCACTGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079135142_1079135151 14 Left 1079135142 11:17772221-17772243 CCAGCGCCAGTGAGCACACGCAC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1079135151 11:17772258-17772280 CATCGGCTTCTGGTGGGCCGTGG 0: 1
1: 0
2: 2
3: 6
4: 79
1079135142_1079135146 7 Left 1079135142 11:17772221-17772243 CCAGCGCCAGTGAGCACACGCAC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1079135146 11:17772251-17772273 ACATCCCCATCGGCTTCTGGTGG 0: 1
1: 2
2: 0
3: 9
4: 115
1079135142_1079135144 -3 Left 1079135142 11:17772221-17772243 CCAGCGCCAGTGAGCACACGCAC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1079135144 11:17772241-17772263 CACTTTAAGAACATCCCCATCGG 0: 1
1: 0
2: 4
3: 11
4: 140
1079135142_1079135147 8 Left 1079135142 11:17772221-17772243 CCAGCGCCAGTGAGCACACGCAC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1079135147 11:17772252-17772274 CATCCCCATCGGCTTCTGGTGGG 0: 1
1: 2
2: 1
3: 14
4: 145
1079135142_1079135145 4 Left 1079135142 11:17772221-17772243 CCAGCGCCAGTGAGCACACGCAC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1079135145 11:17772248-17772270 AGAACATCCCCATCGGCTTCTGG 0: 1
1: 2
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079135142 Original CRISPR GTGCGTGTGCTCACTGGCGC TGG (reversed) Exonic
900177432 1:1297149-1297171 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177444 1:1297195-1297217 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177471 1:1297283-1297305 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177510 1:1297421-1297443 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177537 1:1297509-1297531 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177576 1:1297647-1297669 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177603 1:1297733-1297755 GTGTGTGTGTGCACAGGCGCGGG + Intronic
901209497 1:7516440-7516462 GGGCGTGTGTGCACTGGCTCTGG - Intronic
902033600 1:13440224-13440246 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
902963817 1:19983852-19983874 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
903210451 1:21815081-21815103 ATGTGTGTGCGCACTGGGGCTGG - Intronic
906082971 1:43106496-43106518 GTTCGTGTTCTCGCTGGCTCAGG + Intergenic
914145637 1:144992163-144992185 GTTCGTGGTCTCACTGGCTCAGG - Intronic
918790142 1:188814355-188814377 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
920756845 1:208740748-208740770 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
921207269 1:212859073-212859095 GTGCTTGTGCTCGGTGGCCCAGG + Exonic
922306819 1:224351801-224351823 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
923574029 1:235141807-235141829 GTTCGTGGTCTCACTGGCTCAGG - Intronic
923929899 1:238683767-238683789 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
924524609 1:244835306-244835328 GTGCGTGTGAGCACGCGCGCCGG + Exonic
1065995694 10:31057157-31057179 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1067074608 10:43169084-43169106 GTGCATGTGGTCCCTGGAGCTGG + Intronic
1067173720 10:43927758-43927780 GTGCGTGTGTTCCCTTGAGCCGG - Intergenic
1074317325 10:112371408-112371430 GTTCGTGATCTCACTGGCTCAGG - Intergenic
1075369888 10:121927421-121927443 GTGGGTGTGCACACAGGTGCCGG - Intronic
1078795985 11:14592095-14592117 GTTCGTGGTCTCACTGGCTCAGG - Intronic
1079135142 11:17772221-17772243 GTGCGTGTGCTCACTGGCGCTGG - Exonic
1079756663 11:24273611-24273633 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1083448574 11:62727273-62727295 GTGCGTGCGCTCGCTCGCGCGGG - Exonic
1083678421 11:64340527-64340549 GTGCTTGGGCTCACTGGGGCAGG + Intronic
1084406017 11:68974021-68974043 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1084793768 11:71490977-71490999 GTGAGTGTGCTCACGGGCTGTGG + Intronic
1087966377 11:104421457-104421479 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1092137595 12:6160519-6160541 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1095776874 12:46019146-46019168 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1098516073 12:71377469-71377491 GTTCGTGGTCTCACTGGCTCAGG - Intronic
1099191547 12:79565970-79565992 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1102387086 12:112519210-112519232 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1103145978 12:118596367-118596389 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1104749438 12:131229140-131229162 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1105987589 13:25583580-25583602 CTGCGTGTGCTCCCAGGGGCCGG - Intronic
1109110874 13:58317978-58318000 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1110746623 13:79061257-79061279 GTGCGTGTTCACACATGCGCAGG - Intergenic
1111951272 13:94711378-94711400 GTGCGTGTGCCCCCCGGCGGCGG + Exonic
1113103432 13:106746326-106746348 GTGCGTGTGCCTCTTGGCGCTGG + Intergenic
1113506803 13:110822350-110822372 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1113737656 13:112689964-112689986 GGGCGCATGCTCACTTGCGCCGG + Intergenic
1117297724 14:54394479-54394501 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1119027931 14:71168518-71168540 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1122493276 14:102134574-102134596 GTTCGTGGTCTCACTGGCTCAGG + Intronic
1122918285 14:104868749-104868771 GTGTGTGTGCTCACAGGCTCGGG + Intronic
1125565598 15:40676247-40676269 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1126069049 15:44849762-44849784 GTGAGTGAGCACACTGGGGCAGG - Intergenic
1126089767 15:45041011-45041033 GTGAGTGAGCACACTGGGGCAGG + Intronic
1127984944 15:64061943-64061965 GTTCGTGGTCTCACTGGCTCAGG - Intronic
1128160851 15:65422169-65422191 GTGGGTGTGGTCCCTGGGGCCGG - Intronic
1129905149 15:79182086-79182108 GTGCGTGTGTGCACGTGCGCTGG - Intergenic
1129987040 15:79927058-79927080 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1130994081 15:88894648-88894670 GTGCCTGTGCTCCCTGGAGTAGG - Intronic
1131845942 15:96491117-96491139 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1132204304 15:99976022-99976044 GTGAGTGTCTTCACTGGCCCCGG - Intronic
1132235075 15:100213802-100213824 GTGCGTGTGCTCCCAGGTGCAGG - Intronic
1132603938 16:785864-785886 GAGCGTCTGCTCACTGGCTCTGG - Exonic
1132976990 16:2715902-2715924 GTGGGGGCGCTCACTGGGGCTGG + Intronic
1137585467 16:49661713-49661735 CTGGGTGTGCTCACTGCCCCAGG - Intronic
1139465422 16:67151415-67151437 GTGCGTGTGTTTACTGGGGGTGG - Intergenic
1140029935 16:71327558-71327580 GTACGTGTGCTCACAGGTCCTGG + Intergenic
1141556308 16:84838830-84838852 GTGCGTGTGATGGCTGGCTCAGG + Intronic
1142229303 16:88892252-88892274 GCGCGTGCGCACACTGGTGCTGG - Exonic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1150291544 17:63985201-63985223 GTGTGTGTGTACACTGGCGAGGG - Intergenic
1151239958 17:72749943-72749965 GTGCGTGTGCTCTCAGCTGCAGG - Intronic
1151564861 17:74892412-74892434 GTGCATGTGCCCACGGGGGCAGG - Intronic
1152705417 17:81841132-81841154 GTGCCTGTGCTCCCTGGCCGTGG - Intergenic
1153070522 18:1099146-1099168 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1154346733 18:13548790-13548812 GGCCGTGTGCTCCCTGGAGCAGG - Intronic
1155611552 18:27673102-27673124 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1155852431 18:30789537-30789559 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1161645829 19:5452807-5452829 GTGAGTGAGCTCACTGTCCCTGG - Intergenic
1161839585 19:6671265-6671287 GTGTGTGTGCGCACTTGCACGGG + Intergenic
1162479538 19:10920574-10920596 GTGCGACTGCTCCCTGGGGCTGG + Intronic
1163778512 19:19232422-19232444 GTGCGTGTGCACACACGTGCAGG + Intronic
1166369217 19:42292101-42292123 CTGGGTGTGCTCACAGGCACCGG - Exonic
1166996363 19:46721466-46721488 GTGTGTGTGCACAGAGGCGCAGG - Intronic
1167019133 19:46861214-46861236 GTGCGCGAGCTCACGGGCCCCGG + Intergenic
926685693 2:15696031-15696053 GTTCGTGGTCTCACTGGCTCAGG + Intronic
931674112 2:64676695-64676717 GTGCTGGTGGTCACTGGCGCTGG + Intronic
932983360 2:76697653-76697675 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
936241806 2:110794266-110794288 CTGTGTGTGCTCTCTGGCCCAGG + Intronic
937201625 2:120207643-120207665 CTCTGTGTGCTCACTGGCCCTGG + Intergenic
937254591 2:120546279-120546301 GTGCGTGTCCTCGTTGGCGGCGG + Intergenic
937318410 2:120946702-120946724 AATCGTCTGCTCACTGGCGCTGG + Intronic
939281909 2:140074753-140074775 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
940215267 2:151297206-151297228 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1170150178 20:13220602-13220624 GTTCGTCTGGTCACGGGCGCAGG - Intergenic
1170230738 20:14044167-14044189 GTTCGTGGTCTCACTGGCTCAGG + Intronic
1170727936 20:18946725-18946747 GTGGGTGGGCTCACTGGGGTGGG - Intergenic
1171488648 20:25501284-25501306 ATGAGTGTGCTGACTGGGGCTGG - Intronic
1171973251 20:31577738-31577760 GTTCGTGATCTCACTGGCTCAGG + Intronic
1173831687 20:46093066-46093088 GTTCGTGGGCTCGCTGGCTCAGG - Intergenic
1177182238 21:17756877-17756899 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG + Exonic
950168143 3:10816688-10816710 GTGCGCGTGCGCACTGGCACAGG - Intronic
951146470 3:19233882-19233904 GTTCGTGGTCTCACTGGCTCAGG + Intronic
951332775 3:21386273-21386295 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
952057916 3:29472603-29472625 GTTCGTGGTCTCACTGGCTCAGG + Intronic
953714788 3:45307905-45307927 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
955534379 3:59907609-59907631 GTGCATGTGTGCACTGGGGCAGG + Intronic
957009003 3:74984190-74984212 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
958810591 3:98857102-98857124 GTTCGTGGTCTCACTGGCTCAGG + Intronic
958970890 3:100609214-100609236 GTGAGTGTGCATACTGGCACAGG - Intergenic
962671531 3:137713834-137713856 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
963125875 3:141815725-141815747 GTGTGTGTGATCACTGGCCTTGG + Intronic
965109264 3:164401264-164401286 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
966725158 3:183101934-183101956 GTTCGTGGTCTCACTGGCTCAGG - Intronic
968757836 4:2426069-2426091 GTGCCTGTGCTCTCTGCCGTGGG + Intronic
968804294 4:2762506-2762528 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
969795342 4:9523734-9523756 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
973146487 4:46832247-46832269 GTTCGTGGTCTCACTGGCTCAGG - Intronic
973308225 4:48676316-48676338 GTTCGTGGTCTCACTGGCTCAGG - Intronic
974174160 4:58304591-58304613 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
975596203 4:76049942-76049964 GTTCGTGGTCTCACTGGCTCAGG + Intronic
976690449 4:87862914-87862936 GTTCGTGGTCTCGCTGGCGCAGG + Intergenic
977382507 4:96294160-96294182 GTGCTTGTGCACACTGACTCTGG - Intergenic
977470529 4:97437224-97437246 GTTCGTGTCCTCGCTGGCTCAGG + Intronic
979756016 4:124339985-124340007 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
980470035 4:133239469-133239491 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
982692931 4:158568121-158568143 GTTCGTGGTCTCACTGGCTCAGG - Intronic
983135113 4:164069578-164069600 GTTCGTGGTCTCACTGGCCCAGG - Intronic
983230502 4:165125226-165125248 GTTCGTGGTCTCACTGGCTCAGG + Intronic
984238654 4:177192482-177192504 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
984775948 4:183481974-183481996 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
984784130 4:183552624-183552646 CTGCCTGTTCTCACTGCCGCGGG + Intergenic
984805196 4:183745718-183745740 GTCCGTGGTCTCACTGGCTCAGG + Intergenic
984901890 4:184592799-184592821 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
985087237 4:186325473-186325495 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
988154877 5:27438617-27438639 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
990490248 5:56296577-56296599 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
992482546 5:77166392-77166414 CTGTGTGTACTCACTGGGGCAGG - Intergenic
994669868 5:102753040-102753062 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
995975976 5:118034887-118034909 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
996234395 5:121108363-121108385 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
996742837 5:126817383-126817405 CTGAGTGTGCTCACTGGTACTGG + Intronic
999211729 5:149895284-149895306 GTGCATGTGTTCACAGGCCCTGG - Exonic
1000889149 5:166783691-166783713 GTGCGTGGTCTCCCTGGCTCAGG + Intergenic
1000903404 5:166935510-166935532 GTGCGTGGTCTCGCTGGCTCAGG + Intergenic
1005042124 6:21609275-21609297 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1005059440 6:21762173-21762195 GTTCGTGTTCTCACTGGCTCAGG - Intergenic
1005059454 6:21762274-21762296 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1005759982 6:28959192-28959214 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1006696166 6:35932347-35932369 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1006917596 6:37604914-37604936 GTGTGTGTGCTCACTTACCCAGG + Intergenic
1008567989 6:52787677-52787699 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1009470425 6:64024771-64024793 GTTCGTGATCTCGCTGGCGCAGG - Intronic
1010890858 6:81308730-81308752 GTCCTTGTGCTAACTGGAGCAGG + Intergenic
1011619942 6:89233766-89233788 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1011879775 6:92010893-92010915 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1013143399 6:107363408-107363430 GTTCGTGGTCTCACTGGCTCAGG + Intronic
1014788646 6:125645525-125645547 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1014982328 6:127959388-127959410 GTGCCTGTGCTTCCTGGCCCTGG + Intergenic
1019410318 7:903928-903950 GGGAGTGTGGGCACTGGCGCCGG - Intronic
1020108728 7:5435725-5435747 GTGCCTCTGCTCACAGGAGCTGG + Intronic
1020116633 7:5479925-5479947 GCGCCTCTGCTCACTGGCACAGG - Intronic
1020271306 7:6598036-6598058 GTGCGTGTGCACACTTGTGCAGG - Intronic
1024111386 7:46150298-46150320 GTGCCTGTGCTTGCTGGTGCTGG + Intergenic
1026512523 7:71038790-71038812 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1028852374 7:95551916-95551938 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1030215568 7:107041654-107041676 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1034155188 7:148950275-148950297 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1034749484 7:153555435-153555457 GGGAGTGTCCTCACTGGAGCTGG - Intergenic
1035994219 8:4527927-4527949 GAGGGTGTGCTGACTGGCCCAGG + Intronic
1037957390 8:23070088-23070110 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1040954770 8:52969219-52969241 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1041919094 8:63163141-63163163 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1043570474 8:81597014-81597036 GTGTGTATGCTCACTTGTGCTGG - Intergenic
1044880511 8:96718372-96718394 GTTCGTGGTCTCACTGGCTCAGG + Intronic
1045862720 8:106831287-106831309 GTGTGTGTGTTCACGGGGGCGGG + Intergenic
1046792175 8:118333940-118333962 GTGTGTGTGCACATTGGCGGGGG + Intronic
1049602121 8:143512854-143512876 CTGAGAGTGCTCAGTGGCGCGGG + Intronic
1049858095 8:144876427-144876449 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1051449240 9:17177599-17177621 GTTCGTGGTCTCACTGGCTCAGG + Intronic
1053027132 9:34739623-34739645 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1060305204 9:122405384-122405406 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1188074560 X:25759274-25759296 GTGCATGTGGTCATTGGCGTAGG + Intergenic
1188166804 X:26872992-26873014 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1188242827 X:27810273-27810295 GTTCGTGGTCTCACTGGCTCAGG - Intronic
1192870411 X:75178604-75178626 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1194071448 X:89330198-89330220 GTTCGTGGTCTCACTGGCTCAGG + Intergenic
1195896165 X:109748146-109748168 GTTCGTGTTCTCGCTGGCTCAGG + Intergenic
1196616316 X:117770212-117770234 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1196771678 X:119300980-119301002 GTTCGTGGTCTCACTGGCTCAGG - Intergenic
1201468489 Y:14310466-14310488 GTTCGTGTTCTCACTGGCTCAGG - Intergenic