ID: 1079136645

View in Genome Browser
Species Human (GRCh38)
Location 11:17779330-17779352
Sequence GTCCCTGAGGACGGAAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079136645_1079136651 12 Left 1079136645 11:17779330-17779352 CCCGCTTTTCCGTCCTCAGGGAC 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1079136651 11:17779365-17779387 CTCTGCCAATACCCCGCTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079136645 Original CRISPR GTCCCTGAGGACGGAAAAGC GGG (reversed) Intronic
900236943 1:1597490-1597512 GACCCTGAGGAAGCAAAAACAGG - Intergenic
900430055 1:2597120-2597142 GTCCCTGGGGACAGATGAGCAGG - Intronic
900832637 1:4976163-4976185 CTCCGAGATGACGGAAAAGCGGG - Intergenic
902216047 1:14935121-14935143 GTCCCTGCAGAGGGAAAACCAGG - Intronic
903335598 1:22622187-22622209 CTCCCTGAGGAGGAAAGAGCTGG + Intergenic
904567705 1:31437532-31437554 ATCACTGAGGCTGGAAAAGCCGG + Intergenic
905137079 1:35808211-35808233 GTCGCTGAGGCCGGAAGAGCCGG + Exonic
907355852 1:53873356-53873378 GTCCGTGAAGAGGGAATAGCAGG + Intronic
912724580 1:112047298-112047320 GTCCCTGAGGCAGGGAATGCAGG - Intergenic
912728055 1:112076544-112076566 GTCAATGAGGGCGGAAAGGCTGG - Intergenic
916574769 1:166057674-166057696 GTCCTGGAGGACAGAAGAGCAGG - Intronic
917846395 1:179024120-179024142 TTCTCTGAGGACAGAAAAGGAGG + Intergenic
920667026 1:207970503-207970525 GTCCCTGAGGACACAAAGACAGG + Intergenic
921773822 1:219073965-219073987 GTCCCACAGGACAGGAAAGCTGG + Intergenic
923115724 1:230935854-230935876 GTCTCTGAGGAGAGAAAAGAAGG + Intronic
923124751 1:231025305-231025327 GCCACAGAGGACGGCAAAGCTGG - Intronic
923475386 1:234326724-234326746 GTTCCTGCGGATGGAACAGCGGG + Intergenic
1066020918 10:31300635-31300657 GTGCCTGAGTACGTAGAAGCAGG + Intergenic
1066346375 10:34590939-34590961 GTGGCTGAGGAAGGAAAGGCGGG - Intronic
1067935218 10:50605445-50605467 GTACCTTAGGAGGGAAAATCTGG - Intronic
1069616174 10:69807583-69807605 GTCCTTTAGGACTGAAATGCTGG + Intronic
1072898612 10:99388192-99388214 GTACCTGAGGATGGAGGAGCTGG + Exonic
1073381222 10:103079353-103079375 GTTCCTGAGGCCAGAGAAGCTGG - Exonic
1073635354 10:105192565-105192587 GTCTCTGAGGACAGAAAAGAAGG + Intronic
1074219644 10:111423937-111423959 CTCCAGGAGGAGGGAAAAGCAGG - Intergenic
1074509718 10:114101227-114101249 GGCTCTGCGGAGGGAAAAGCCGG - Intergenic
1075953275 10:126500291-126500313 GTCACTGAGAAGGGAACAGCAGG + Intronic
1076178993 10:128391318-128391340 CTCCCTGAGGACAGTGAAGCAGG + Intergenic
1078352132 11:10603316-10603338 GTCCCTGAGGCCGAAAAGGTTGG - Intronic
1079136645 11:17779330-17779352 GTCCCTGAGGACGGAAAAGCGGG - Intronic
1079237495 11:18700647-18700669 GGCCCTGAGGAGGGAGAAGGAGG + Intronic
1080748740 11:35132823-35132845 CTCCATGAGGACAGAGAAGCAGG - Intergenic
1080793402 11:35541038-35541060 GTCCCTGAGGGCAGAAGAGTGGG + Intergenic
1082782774 11:57300268-57300290 GTCCCTGAGCACAGGGAAGCAGG + Intronic
1082807471 11:57460147-57460169 GTCCCAGGGGACAGAAATGCTGG + Intergenic
1083725993 11:64628530-64628552 GTCCCTGAGGAGAGGAGAGCAGG + Intronic
1086177011 11:83902784-83902806 GCCCCTGAGGATAAAAAAGCAGG + Intronic
1089535454 11:119158307-119158329 GTCCCTGAGGATGGACAGGAAGG - Exonic
1090247487 11:125226856-125226878 GTTCCTGAGGATGGGACAGCTGG - Intronic
1090905464 11:131070742-131070764 ATCCCTTAGGAAGGAAAAGACGG - Intergenic
1090967443 11:131611168-131611190 GCACCTGAGGAGGGAAAAGGTGG + Intronic
1091821471 12:3478751-3478773 TTCCCTGAGGATTGATAAGCTGG - Intronic
1091900644 12:4141352-4141374 GTCCCTGGAGAAGGAAAACCGGG + Intergenic
1091992794 12:4970173-4970195 GGCATGGAGGACGGAAAAGCAGG - Intergenic
1093957295 12:25235782-25235804 GTCCCTGATGCCGGAAAAGTTGG - Intronic
1099247321 12:80208682-80208704 GTCACAGAGGATGGAAAAACAGG + Intergenic
1099862113 12:88233960-88233982 GTTCCTGAGGACTGAAAATGAGG - Intergenic
1100458105 12:94772312-94772334 CTCCCTGAGGGCTGACAAGCTGG - Intergenic
1102086018 12:110140598-110140620 GAACCTGAGGATGGAAAAGCTGG + Intronic
1103079583 12:118012917-118012939 GTGCTTGAGGACTGAGAAGCAGG + Intergenic
1103586951 12:121963178-121963200 GGCCCTGAGGGCAGAAAAGAGGG + Intronic
1103637893 12:122323496-122323518 GGCCCTGAGGAAGGCAGAGCTGG - Intronic
1104685761 12:130783001-130783023 GGCGCTGATGACGGAAAATCAGG - Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1113619168 13:111701339-111701361 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1113624697 13:111786600-111786622 GTCCCTGAGGACGGAAGGCAGGG + Intergenic
1113901463 13:113800593-113800615 GTCCCAGAGGCCGGATAATCGGG - Intronic
1115751878 14:36502104-36502126 GTTCTTGAGGACGTAAAATCTGG - Intronic
1116452819 14:45083932-45083954 GTCCCTATGGAGGGAAAGGCAGG + Intergenic
1117251800 14:53946704-53946726 GTCCCCGAGGGCGGATGAGCGGG + Intergenic
1117318367 14:54596710-54596732 GACCCTGAGGAGAGAAAGGCTGG - Intronic
1127053009 15:55104279-55104301 TTCCCTGTGGAGGGAAAATCTGG + Intergenic
1129272952 15:74428978-74429000 TTCCCTGAGGACAGGACAGCTGG + Intronic
1132504168 16:298393-298415 GTCCCTGAGGATGGAGAGGCAGG + Intronic
1134131676 16:11654559-11654581 CTCCCTCAGGACAGAAAAGAAGG - Intergenic
1134145399 16:11756871-11756893 GTCCCAGAGGGCGGATATGCTGG + Intronic
1134561587 16:15214915-15214937 GTGCGTGAGGACGGGAAAGGGGG - Intergenic
1134922124 16:18126541-18126563 GTGCGTGAGGACGGGAAAGGGGG - Intergenic
1137005589 16:35272190-35272212 GTTCCTGGGGAAGGCAAAGCAGG + Intergenic
1137725133 16:50651759-50651781 ATTCCAGAGGACGGTAAAGCTGG + Intergenic
1138583813 16:57957946-57957968 GTTCTTGAGGAAGGAAAAGAAGG + Intronic
1139432257 16:66917569-66917591 GTGCCAGAGGAAGGAGAAGCAGG + Intronic
1140750394 16:78018241-78018263 TTCCCTGAAGAGGGATAAGCTGG + Intergenic
1143162736 17:4881881-4881903 GTCCCTGAGGATGGAGCAGCAGG + Intronic
1144502959 17:15805520-15805542 TTCCCTGATGAAGGAAAACCTGG - Intergenic
1145049416 17:19648220-19648242 GTCCCTGAGGGCGGGAAGCCGGG - Intronic
1145165143 17:20608222-20608244 TTCCCTGATGAAGGAAAACCTGG - Intergenic
1150721399 17:67617150-67617172 GTCCCTGTAGCCAGAAAAGCTGG - Intronic
1153715793 18:7846732-7846754 GTGCCTTAGGACAGGAAAGCAGG - Intronic
1156436648 18:37137847-37137869 GGACCTCAGGAGGGAAAAGCTGG - Intronic
1157140244 18:45098552-45098574 GTCCATGAGGTAGGGAAAGCTGG - Intergenic
1160374694 18:78402491-78402513 ATCCCTCAGGAAGGGAAAGCTGG - Intergenic
1160927591 19:1554397-1554419 GTCCCTGAGGAAGGACAGCCTGG + Intergenic
1164555546 19:29248275-29248297 GTCCCTGGGGAAAGAAGAGCAGG + Intergenic
1164816946 19:31211572-31211594 GACACAGAGGAAGGAAAAGCAGG + Intergenic
1164939604 19:32242684-32242706 GTCCTTGAGGATGGCAAGGCTGG - Intergenic
1165022333 19:32935111-32935133 GGCCCTGAGGGCAGAAAGGCAGG + Intronic
1165714614 19:38036372-38036394 GTCCCTGGGGACGGGGAAGGAGG - Intronic
1166052028 19:40266083-40266105 GTCCCTGAGGACAGAAGTGAAGG - Intronic
925161551 2:1687480-1687502 GTGCATGATGACGGAAAAACAGG - Intronic
925835823 2:7946033-7946055 TTCCCAGAGGAAGGAACAGCAGG + Intergenic
927025070 2:19059246-19059268 GTACCTGAGCCAGGAAAAGCAGG + Intergenic
928857995 2:35823272-35823294 GTTTCTCAGAACGGAAAAGCAGG + Intergenic
929732610 2:44511741-44511763 GTCCAGGAGGAGGGAACAGCTGG - Intronic
930320292 2:49845638-49845660 GTTCCTGGAGACAGAAAAGCGGG + Intergenic
933721359 2:85399386-85399408 GTCCCTGAGGCAGGACAACCAGG + Intronic
941923738 2:170875710-170875732 GACCCTGAGGAGGGTAAAGGAGG - Intergenic
944612575 2:201426552-201426574 GTCCCTGATGGCAGAAAGGCTGG + Intronic
949032273 2:241802719-241802741 GTTTCTGAGGATGGAGAAGCAGG + Intronic
1168955890 20:1834126-1834148 GTCCCTCAGGACAGAAAACGAGG - Intergenic
1170714959 20:18823621-18823643 GACCCTGAGGCCTGCAAAGCAGG + Intronic
1175074334 20:56360276-56360298 TTCCCGGAGGAAGGAACAGCTGG - Intronic
1175202786 20:57289735-57289757 GTCCCACAGGAAAGAAAAGCTGG + Intergenic
1183270892 22:36862123-36862145 GGCCCTGAGGACGCAAAGCCTGG + Intronic
1184491880 22:44814653-44814675 GTACCTGAGGAGGGAAACGGGGG - Exonic
950648271 3:14391428-14391450 GTCCATCAGTAAGGAAAAGCGGG + Intergenic
951164439 3:19467907-19467929 CTCCCTAAGGAAGGGAAAGCAGG - Intronic
952806393 3:37358017-37358039 TTGCCTAAGGACTGAAAAGCTGG + Intronic
954147412 3:48641166-48641188 GTCCCTGAGGACCGTGAAGCAGG + Intronic
955320699 3:57972279-57972301 GTCCCTGAGGAAGGGAAATGAGG - Intergenic
956852674 3:73245218-73245240 GTCCCTGAAGACAGAAACACTGG - Intergenic
961903940 3:130242892-130242914 GTCCCTGAGATAGGAAAGGCTGG - Intergenic
961911366 3:130319936-130319958 GTCTCTGAGAAAGTAAAAGCAGG - Intergenic
962665550 3:137650522-137650544 GTCACTGAGGAAGGGCAAGCAGG - Intergenic
966238617 3:177730049-177730071 GTCCCTGAGGACGCTGAATCCGG + Intergenic
968392720 4:205926-205948 CTCCCTGACGTGGGAAAAGCAGG - Intergenic
972723047 4:41720082-41720104 TTCACTGAGGACAGAAAAACTGG + Intergenic
975241758 4:72067361-72067383 GGCCTTGAGAACAGAAAAGCTGG - Intronic
976188240 4:82464377-82464399 GGCACTGAGGAAGGAAAACCAGG + Intergenic
980869219 4:138592245-138592267 ATCACTGAGGACGGGAAACCAGG + Intergenic
984348205 4:178558569-178558591 TTCCCTGATCACGGATAAGCTGG - Intergenic
985509277 5:303052-303074 CTCCCTGAGGAAGGAAAGGAAGG + Intronic
985738996 5:1603840-1603862 CTCCCTGAGGAAGGAAAGGAAGG - Intergenic
990174428 5:53091390-53091412 GTGCCAGAGGAAGGAAAAGGAGG + Exonic
999080159 5:148835893-148835915 TTCCCAGAGGACGGTAAAGCGGG + Intergenic
999113629 5:149142472-149142494 GTCCCAGAGGTGGGAAGAGCAGG + Intronic
1003025911 6:2555863-2555885 GGCCCTAAGAACAGAAAAGCAGG - Intergenic
1003041720 6:2694232-2694254 GTCCCTGCAGAGGGAAAAGTAGG - Intronic
1004156200 6:13170546-13170568 GTAGCTGATGAAGGAAAAGCTGG + Intronic
1006587042 6:35122057-35122079 GCCCCTGAGCCCGGAAAAGCTGG - Intronic
1007987223 6:46218864-46218886 CTCCCTGAGGACAGAGAAGAAGG - Intergenic
1012691307 6:102315474-102315496 GTCTATGAAGACAGAAAAGCTGG + Intergenic
1016842047 6:148534384-148534406 GATCCTGAGGACTTAAAAGCTGG + Intronic
1029123389 7:98282332-98282354 ATCCCTGTGGGCGGGAAAGCAGG - Exonic
1029574546 7:101394781-101394803 GTCTCTGAGGATGAGAAAGCAGG + Intronic
1031869828 7:127079681-127079703 GTCCCTGAGGAAGAAAAAAGGGG - Intronic
1032824261 7:135553889-135553911 GTCCAGGAGGACAGAATAGCAGG + Intergenic
1033416466 7:141166062-141166084 GTTCCTGAGGAAGAAAAAGCAGG + Intronic
1033436669 7:141339193-141339215 GTCCCTGAGGAGTGGAAAGATGG + Intronic
1034544006 7:151777795-151777817 GTCCCTGAGCAAGGAACAGTTGG - Intronic
1037992340 8:23329925-23329947 GTCCCTGAGGTCTGTAAATCTGG - Intronic
1039343869 8:36682456-36682478 GTCCCTGAGGCCTGCAAAGGGGG - Intergenic
1040434556 8:47377644-47377666 GTCCCTCAGGAGGAAACAGCAGG + Intronic
1043872118 8:85444770-85444792 GTACCTGAGCACAGAACAGCAGG + Intronic
1047946486 8:129886047-129886069 GTCCTTGAGGAGACAAAAGCAGG - Intronic
1049197944 8:141325698-141325720 GTCTCTGCAGACGGAAAAGATGG + Intergenic
1056104516 9:83333673-83333695 GTGCCTGAGGATGGAGAACCAGG - Intronic
1056791659 9:89629434-89629456 GTTCCTGGGGACGGAATAGACGG + Intergenic
1061392745 9:130326987-130327009 GTCCCTGGGGAAGGGACAGCAGG + Intronic
1061518594 9:131104064-131104086 GTCCCCGGGGACTGAAAAGTGGG + Intronic
1062290128 9:135790655-135790677 GTCCCTGAGAAGGGAAAAGTCGG - Intronic
1185763102 X:2703287-2703309 GTCCCTAAGTACAGGAAAGCTGG + Intronic
1188414294 X:29913843-29913865 GACCCTGATGACGCAAGAGCAGG - Intronic
1192229431 X:69254998-69255020 GGCCCTGAGGACAGCAAAGAGGG + Intergenic
1197725120 X:129771103-129771125 GTCCCAGGGGAGGGAAGAGCTGG - Intergenic