ID: 1079137162

View in Genome Browser
Species Human (GRCh38)
Location 11:17782043-17782065
Sequence CAGGGTAATCATACAGTTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079137162 Original CRISPR CAGGGTAATCATACAGTTGC AGG (reversed) Exonic
906559137 1:46742157-46742179 CTGGCCAATCATACAATTGCTGG - Intergenic
912462425 1:109844857-109844879 CATGGCAATCACACCGTTGCTGG + Intergenic
915762968 1:158333884-158333906 GAGGTTAAACAGACAGTTGCTGG + Intergenic
916451214 1:164922271-164922293 CATGGTAATAACAAAGTTGCTGG + Intergenic
923111840 1:230897179-230897201 CAGTGGAATAATACAGTTTCTGG - Intergenic
923282513 1:232457903-232457925 CAGGGCACCCAGACAGTTGCAGG + Intronic
1065864053 10:29898247-29898269 CAGGGTCATCATACAGCTTTGGG + Intergenic
1072311607 10:94161649-94161671 CAGGGTAATCAGACAGGAGAAGG - Intronic
1075783002 10:125029013-125029035 CATGGGAATCCTGCAGTTGCAGG - Intronic
1076352827 10:129830467-129830489 AAGGGTATTCTTACAGTTGTCGG - Intergenic
1077453096 11:2662633-2662655 CAGGGGAATCACACCGTGGCCGG - Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1080549292 11:33357330-33357352 CAGGGTCATCTTATGGTTGCAGG - Intergenic
1084741158 11:71140422-71140444 CAGGGTAATCTTCCCCTTGCAGG - Intronic
1087430948 11:98054379-98054401 GCAGGTAAGCATACAGTTGCAGG - Intergenic
1090516594 11:127434939-127434961 CAAGCTAATCATATAGTTGAGGG + Intergenic
1092936239 12:13366900-13366922 CAGGGTATCCATAGATTTGCTGG + Intergenic
1094291712 12:28858034-28858056 CAGGGCAATCCCACAGATGCTGG - Intergenic
1095903225 12:47350222-47350244 GAGGGTTATCATACACTAGCAGG - Intergenic
1098944058 12:76570963-76570985 CAGGGTAACCAAATAGTTCCAGG - Intergenic
1099973948 12:89526458-89526480 CAGGATATTGATATAGTTGCTGG + Intergenic
1101622435 12:106401959-106401981 CAGGGCAATCAGGCAGTTGAAGG + Intronic
1102080115 12:110091067-110091089 CAGGCTAGTCATTCAGTTCCAGG - Intergenic
1107966228 13:45600796-45600818 TATGATAAACATACAGTTGCAGG + Intronic
1113225505 13:108154929-108154951 CAGGGTGAGAATAAAGTTGCAGG + Intergenic
1114595797 14:23910677-23910699 CAGAGAAATCACACAGTTGCTGG + Intergenic
1122590985 14:102850979-102851001 CACGGCAATCATACACATGCTGG - Intronic
1122827604 14:104377916-104377938 CAGGGCAATCGTACATATGCAGG + Intergenic
1132909488 16:2301339-2301361 CAGTGTCATCTTACAGTTGATGG + Intronic
1137510796 16:49098351-49098373 CAGGATAAACATACAAATGCAGG - Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1141297797 16:82785945-82785967 CAGGGGAACCACACAGTAGCAGG - Intronic
1154332891 18:13444072-13444094 CAGGGTAATCAAATCGTTGATGG - Intronic
1167606655 19:50484864-50484886 CAGAGTGAGCATACAGTTTCTGG - Exonic
926870919 2:17416052-17416074 CAGGGTAACCAAAGAGTTACAGG + Intergenic
927436218 2:23068805-23068827 CAGGATAATAATACAGTTCTTGG - Intergenic
928912705 2:36439083-36439105 CAGGGGAAACATTCATTTGCAGG - Intronic
931077208 2:58729029-58729051 CAGGTTAAGCATACAGGTTCTGG - Intergenic
945586410 2:211669465-211669487 CTGGGAAATCAGACAGTTTCAGG - Intronic
948350999 2:237340785-237340807 CAGGGGAATGACACAGTTGCAGG - Exonic
1170644253 20:18182656-18182678 CAGGGTGATCATGGAGCTGCAGG - Intronic
1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
955557326 3:60151883-60151905 CAGGGAAATTATATAGTTGCAGG - Intronic
955710336 3:61772178-61772200 CTGGGAAATTATACAGTTGAGGG + Intronic
955967125 3:64399940-64399962 CAAGGTAATCAAACAGATTCTGG + Intronic
956300510 3:67767411-67767433 CAGGGCAGTCATAGAGTTGGTGG + Intergenic
959441696 3:106384293-106384315 CCTGGTAATGATAAAGTTGCTGG - Intergenic
959765865 3:110027265-110027287 CAGTGTAATCTTGCAGTGGCAGG - Intergenic
961935333 3:130576850-130576872 CAAGGAAATCAGACAGTAGCTGG + Intronic
966323194 3:178723934-178723956 CATGGTAAACATACAAGTGCAGG + Intronic
969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG + Intronic
970174935 4:13330223-13330245 CAGGGTGACCAGCCAGTTGCGGG + Intergenic
977542568 4:98335307-98335329 CAGGTTGGTCATGCAGTTGCTGG + Intronic
979826287 4:125237085-125237107 CAGGATAGTCATACTGATGCAGG - Intergenic
980652260 4:135733364-135733386 CAGCGCACTCACACAGTTGCTGG + Intergenic
983673103 4:170260603-170260625 CAGAGAATTCATACAGTGGCAGG + Intergenic
984568363 4:181359094-181359116 CAGAGTTATCATACAGTGGTTGG + Intergenic
986423533 5:7608255-7608277 CAGGGAAATAACACAGTTGGAGG + Intronic
987288390 5:16483772-16483794 CAGGTTAATCATAGGGTTCCAGG + Intronic
993134199 5:83936663-83936685 CCAGGTCATCATACAGTGGCTGG + Intergenic
994447161 5:99891006-99891028 CAGGGTGAGCATGCTGTTGCAGG - Intergenic
996455486 5:123676555-123676577 CAGGGTAATCAGACAGGAGTAGG - Intergenic
997638884 5:135435567-135435589 CAGGGCACTCACACCGTTGCAGG + Intergenic
1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG + Intronic
1005148182 6:22716711-22716733 CAGGTTATTCTTCCAGTTGCAGG - Intergenic
1015035135 6:128644522-128644544 CAGGGAAATCATTCAGAGGCAGG + Intergenic
1015041446 6:128725170-128725192 CAGGGAAATCTTACATTTGAAGG - Intergenic
1020605895 7:10336402-10336424 CAGGTAAATTATACATTTGCAGG + Intergenic
1021886215 7:25142291-25142313 CATGGTAATCATCCAGTTCAAGG + Exonic
1024616932 7:51123692-51123714 CAGGGAAGTCATGCATTTGCTGG - Intronic
1026469614 7:70684021-70684043 TTGGGGAATCATACACTTGCTGG - Intronic
1027893914 7:84015835-84015857 CAGGGAAATTATACAGATTCTGG + Intronic
1029180006 7:98693552-98693574 CAGGGTAACCACACAGCTCCTGG + Intergenic
1029470433 7:100751111-100751133 CAGTGGAATCACAGAGTTGCTGG + Intronic
1031116655 7:117676183-117676205 CAGGGTGATAGTACAGTTACAGG + Intronic
1039930449 8:41982664-41982686 CTGGGTTATCAGACTGTTGCTGG + Intronic
1045678062 8:104630005-104630027 CAGTGTAATCTTACAGTTTATGG + Intronic
1055629916 9:78212875-78212897 TAGGGAACTCATACTGTTGCAGG + Intergenic
1189012314 X:37058935-37058957 CAGGGTAATCACATGGTTTCTGG + Intergenic
1189036398 X:37497317-37497339 CAGGGTAATCACATGGTTTCTGG - Intronic
1191677715 X:63809253-63809275 CAGGGTAGCCAGGCAGTTGCTGG - Intergenic
1195637634 X:107135493-107135515 CAGGGTAATCTCACAGTATCAGG - Intronic
1201626479 Y:16020425-16020447 CAGGGTAATCAGACAGGAGAAGG - Intergenic