ID: 1079137679

View in Genome Browser
Species Human (GRCh38)
Location 11:17785143-17785165
Sequence CAGGGGCCAGGCCAACGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079137675_1079137679 -7 Left 1079137675 11:17785127-17785149 CCTTCAACCATCACTCCAGGGGC No data
Right 1079137679 11:17785143-17785165 CAGGGGCCAGGCCAACGACCAGG No data
1079137669_1079137679 19 Left 1079137669 11:17785101-17785123 CCCACCAACATCTGGTCTGTGCT No data
Right 1079137679 11:17785143-17785165 CAGGGGCCAGGCCAACGACCAGG No data
1079137670_1079137679 18 Left 1079137670 11:17785102-17785124 CCACCAACATCTGGTCTGTGCTT No data
Right 1079137679 11:17785143-17785165 CAGGGGCCAGGCCAACGACCAGG No data
1079137671_1079137679 15 Left 1079137671 11:17785105-17785127 CCAACATCTGGTCTGTGCTTGAC No data
Right 1079137679 11:17785143-17785165 CAGGGGCCAGGCCAACGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079137679 Original CRISPR CAGGGGCCAGGCCAACGACC AGG Intergenic