ID: 1079146619

View in Genome Browser
Species Human (GRCh38)
Location 11:17858024-17858046
Sequence TGTTCCCTGCAGCAGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079146619_1079146624 25 Left 1079146619 11:17858024-17858046 CCCTGTGCCTGCTGCAGGGAACA 0: 1
1: 0
2: 2
3: 38
4: 298
Right 1079146624 11:17858072-17858094 GGAAGACAATGAAAAGCCTCAGG 0: 1
1: 0
2: 1
3: 22
4: 335
1079146619_1079146623 4 Left 1079146619 11:17858024-17858046 CCCTGTGCCTGCTGCAGGGAACA 0: 1
1: 0
2: 2
3: 38
4: 298
Right 1079146623 11:17858051-17858073 GAAGGAAACAAATTTTGTCTTGG 0: 1
1: 0
2: 3
3: 36
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079146619 Original CRISPR TGTTCCCTGCAGCAGGCACA GGG (reversed) Intronic
900134002 1:1106397-1106419 TATTCTCAGCAGCATGCACAAGG - Intronic
900350944 1:2234262-2234284 TGCTCCCTGCAGAAGCCACCTGG - Intronic
900882765 1:5393806-5393828 TATGCCCTGGAGCAGGCACGTGG + Intergenic
901514026 1:9733234-9733256 TGTAACCTGCAGCAGGCCCCAGG + Intronic
901648742 1:10730516-10730538 TGTTCCCTGGAGCAGGCAGCTGG - Intronic
901837326 1:11932992-11933014 GGTTCCCTGCAGGGGGCAAAGGG - Intergenic
902573752 1:17363612-17363634 TGTTCCCTGCTGGAGCCACTGGG + Exonic
902715503 1:18269970-18269992 GGTTACCTCCAGAAGGCACATGG - Intronic
903226513 1:21896841-21896863 TGTTCCCTGCAGCCTGGAGACGG - Intronic
904430440 1:30460803-30460825 TGTTCCCTGCAGCATCAGCAGGG - Intergenic
905242250 1:36588731-36588753 TGTCCCCAGGAGCAGGGACAGGG - Intergenic
905409314 1:37757322-37757344 TGTTAGCTGCAGAAGGCACTTGG + Intronic
907241778 1:53085006-53085028 CGTTCCCTGGAGAAGACACAAGG + Exonic
907280464 1:53343941-53343963 TGTACCCTGCCCCAGGCACCCGG - Intergenic
907912974 1:58842910-58842932 TGTTCCCTACAGCATTCTCAGGG - Intergenic
914940215 1:152015989-152016011 TGCTCCCTGAAATAGGCACAGGG - Intergenic
914981565 1:152419122-152419144 TGATCTAGGCAGCAGGCACATGG + Intergenic
915956110 1:160221328-160221350 TGTTCACTGCAGATGACACAGGG + Intronic
916266895 1:162899010-162899032 TGTTCCCTACAGAAGTCAGATGG + Intergenic
918529355 1:185501230-185501252 TGATCAGTGCAGCAGGCAGATGG - Intergenic
922236217 1:223724562-223724584 TGTGCAGTGCAGCAGCCACAAGG - Intronic
922422768 1:225470814-225470836 TGTTCCCAGCCCCTGGCACATGG + Intergenic
922564055 1:226589753-226589775 GGTCCTCTGCAGCAGGGACAGGG - Intronic
923685067 1:236148004-236148026 TGTTCCCCAAAGCTGGCACAAGG - Intronic
1063114262 10:3063217-3063239 TATTCCCTGTTGCAGGCCCAGGG - Intergenic
1063492422 10:6477035-6477057 TGCTCCCTGCAGCAGGAAGCGGG + Intronic
1063710465 10:8472432-8472454 TGTTCACGGCAGAAGGCAAAGGG + Intergenic
1063710919 10:8477585-8477607 TATAGGCTGCAGCAGGCACATGG - Intergenic
1064406542 10:15069342-15069364 TCCTCCCTGCAGCAGCCACAGGG + Intronic
1066209592 10:33223893-33223915 TGTGCCCTGGTGCAGGCAGAGGG + Intronic
1066556252 10:36617448-36617470 TGATCCCAGCAGCAGGCTCATGG - Intergenic
1067663795 10:48256276-48256298 TGATCCCTGCAGCTGACACTCGG - Intronic
1069210443 10:65752009-65752031 TGTTCCCTGAACCAGGCATCAGG + Intergenic
1069656762 10:70095396-70095418 TCTTCCCTGGAACAGGAACAGGG - Intronic
1070791656 10:79193046-79193068 GGTAGCCTGCACCAGGCACACGG - Intronic
1071366966 10:84909323-84909345 TGTTCCATCCATCTGGCACAAGG - Intergenic
1072724310 10:97802136-97802158 AGGTCACTGCAGCAGGCAAAGGG + Intergenic
1072802217 10:98400156-98400178 TGTGCCCAGCAGAAGGCACCTGG + Exonic
1074135145 10:110619447-110619469 AGTTCCCAGCATCAGGCATAGGG - Intergenic
1075518066 10:123125282-123125304 TATTCCAGGCAGCAGGCAGAGGG - Intergenic
1076279379 10:129232759-129232781 TGTTCCCTTGGGAAGGCACATGG - Intergenic
1077284196 11:1758608-1758630 GGGTCCCTGCAGCAGGCCGAGGG - Intronic
1077351829 11:2096693-2096715 TGTGCCCTGGAGCAGGCCCTGGG - Intergenic
1077456356 11:2683627-2683649 TGTTCCTTGCAGCAGATGCAGGG - Intronic
1078332899 11:10440603-10440625 TAGTCCCAGCAGCAGGCAGATGG - Intronic
1078550021 11:12273789-12273811 TGTCCCCAGGAGCAGGGACAGGG + Intergenic
1078645732 11:13140217-13140239 TCTTCCTTGCACCAGGCACTAGG - Intergenic
1079146619 11:17858024-17858046 TGTTCCCTGCAGCAGGCACAGGG - Intronic
1079452446 11:20609009-20609031 TGTTGACTGGATCAGGCACATGG + Intronic
1083291050 11:61690350-61690372 TATTCCCAGCTCCAGGCACAAGG - Intronic
1083759452 11:64807721-64807743 CATTCCCTGAAGCAGGCACAGGG - Intronic
1083831831 11:65238462-65238484 TGTTCCCGGCAGCGGGAAGAAGG - Intergenic
1084020427 11:66414018-66414040 TGTTCCCAGCATCCAGCACAAGG - Intergenic
1084050854 11:66599053-66599075 TGTTCCCTGCTGCCAGCACTGGG + Intronic
1084934613 11:72580200-72580222 AGTTCCCTGCACTTGGCACAGGG - Intronic
1086196227 11:84143124-84143146 TATTCCCAGCACCTGGCACAAGG - Intronic
1088934298 11:114383564-114383586 TCTTCCCTGCTGCAAGCCCAAGG + Intergenic
1090456046 11:126850566-126850588 TGATCCCTGTGGAAGGCACAGGG - Intronic
1091208291 11:133835477-133835499 TGCTCCCTGCAGCAGCACCATGG + Intergenic
1091624545 12:2112113-2112135 GGGTTGCTGCAGCAGGCACAGGG - Intronic
1091829066 12:3536379-3536401 TGTGCCATGCAGGAGGCAAAAGG - Intronic
1092975434 12:13740334-13740356 TATTCCCGGCATCCGGCACAGGG + Intronic
1093538086 12:20247215-20247237 TTTCCCCAGCAGCAGGCATATGG + Intergenic
1094628412 12:32148333-32148355 TGTTCCCCGCAACAGGCACCCGG + Intronic
1100619904 12:96260961-96260983 TGTCCCCAGCATCTGGCACATGG + Intronic
1101839962 12:108320974-108320996 TATTCCCTGCAGCTGGCAGATGG - Intronic
1102059704 12:109923258-109923280 TGCTTCCAGCAGCAGGCACAGGG + Intronic
1103447277 12:121002349-121002371 GGTTCTCAGCAGCAGGCCCAGGG - Exonic
1103510110 12:121467803-121467825 GGTCCCTTGCAGCAGGCACACGG + Intronic
1103936138 12:124477944-124477966 TTTTTCCTGGAGCTGGCACAGGG - Intronic
1104491752 12:129200436-129200458 TCTTCCCTGCAGGTGACACAGGG + Intronic
1105913635 13:24893512-24893534 TAATCCCTGCGGCAGCCACACGG + Intronic
1106265919 13:28110124-28110146 TCTTCCCTTGAGCTGGCACATGG + Intergenic
1106442912 13:29794897-29794919 TTTTTCTTGCAGCAGGTACAGGG + Intronic
1106690656 13:32111885-32111907 TGTTGCCTGCAGCAAACTCAGGG + Intronic
1106821752 13:33472573-33472595 TGTTCCCTAGAGCAGGTAGAGGG + Intergenic
1107836764 13:44417962-44417984 TGTTCCCTGCAGGAGTCACCTGG + Intergenic
1108323253 13:49306313-49306335 TGTCCCCTGCAGCTGGCACTGGG - Intergenic
1111876700 13:93906043-93906065 TGTTCACTTCAACAGGCAAAGGG + Intronic
1112254924 13:97820986-97821008 TCCTCCCAGCAGCTGGCACAGGG + Intergenic
1112926649 13:104683535-104683557 TGTTCCCTGCAGCAGCCAAAGGG + Intergenic
1116151381 14:41145826-41145848 TGCTCCATGCAGCAGGAGCAGGG - Intergenic
1116791030 14:49340223-49340245 TGTTTACTGCAGAAGGCACCTGG - Intergenic
1116862228 14:50003707-50003729 TGGTCTCTGCAGCAGTCAGAAGG + Intronic
1116967807 14:51032370-51032392 TATTCCCTGCAGCTGGGAGAAGG - Intronic
1119199803 14:72743890-72743912 TGTTCTCTGCAGCTTGCACTTGG - Intronic
1119633877 14:76258095-76258117 TGTTCCCTGGAGCAGCCCCGTGG - Intergenic
1120120993 14:80680151-80680173 TCTCCCCTGCAGCAGGCTTAGGG + Intronic
1122552418 14:102557148-102557170 TGTCCGCTGCAGCTGGGACATGG + Intergenic
1123876832 15:24631828-24631850 TGGTCCGTGCAGCTGGCAGATGG + Intergenic
1124829190 15:33131579-33131601 TATTTCCTGCAGCAAGCACTTGG - Intronic
1125334755 15:38616309-38616331 TGTTCCCAGTATCTGGCACATGG - Intergenic
1125456823 15:39868502-39868524 TCTTCCCTGGAACTGGCACATGG + Intronic
1129176920 15:73846994-73847016 TGTTCCCTGCAGGAGGCTCCAGG - Intergenic
1129227876 15:74180363-74180385 TGTCCCCTGCAGGCAGCACATGG + Intronic
1131887519 15:96933485-96933507 TAAACCCTGCAGCAGGCACTGGG + Intergenic
1132038417 15:98505196-98505218 TGGTCCCTGAAGCAGGCTCCGGG + Intronic
1132106955 15:99069795-99069817 TTTCCCCTCCAGCAGGTACACGG - Intergenic
1133040349 16:3057256-3057278 TGTCCTCTGCAGCAGGGCCAGGG + Intronic
1133110553 16:3545642-3545664 TTTTCCCTGCAGCCTGCACTTGG - Intronic
1133267612 16:4594334-4594356 TGTTCCCTGCAGCAGGGCAGTGG - Exonic
1133800182 16:9079089-9079111 TGTTCCCGGCAGCGGGAAGAAGG + Intergenic
1135779955 16:25291812-25291834 TGGACCCTGCAGCAGGCAGCAGG + Intergenic
1136169789 16:28482099-28482121 TGGTACCTGCAGCAGGGCCAGGG + Exonic
1137249625 16:46732323-46732345 TTTGCCCTGCTGCAGGCCCAGGG + Exonic
1138814384 16:60187452-60187474 TGTTCCCTGCAGAAGACAGTTGG - Intergenic
1139654144 16:68377193-68377215 TGTTCCCTGCAGTGGGGACTGGG + Intronic
1139835272 16:69833431-69833453 TGTTTCCATCAGGAGGCACATGG + Intronic
1140422331 16:74830854-74830876 TGTTGCCAGAAGCAGGCACATGG + Intergenic
1141763274 16:86043070-86043092 TGTCACCCGCAGCAGGTACAGGG - Intergenic
1142016771 16:87753031-87753053 CCTTCCCTGGAGCAGGGACAAGG + Intronic
1142249112 16:88983059-88983081 TGTTCCCGGCACAAGGCGCAGGG + Intergenic
1142312061 16:89319939-89319961 TGTTCCCTCCACCAGGCTCAGGG + Intronic
1203142928 16_KI270728v1_random:1780656-1780678 TGTTTCCTCCAGCAGGTCCAGGG + Intergenic
1143572681 17:7770237-7770259 TGTTCCTGGCTGCAGGCACTGGG + Exonic
1144804240 17:17953595-17953617 TGTGCCCCACAGCATGCACATGG + Intronic
1146401784 17:32505288-32505310 TGCTTCCAGCAGCAGGGACAGGG + Intronic
1146446048 17:32933835-32933857 TGTACAGTGCAGTAGGCACATGG + Intronic
1147243913 17:39108442-39108464 TGTGCCCTGCTGAAGGGACAGGG - Intronic
1148080513 17:44965594-44965616 TTTTCCCTCCAGCAGGGGCAGGG - Intronic
1148551530 17:48553282-48553304 TGGTACCTGCAGCAGGGCCATGG - Exonic
1149213376 17:54328336-54328358 TGTTCCCTTCTTTAGGCACATGG - Intergenic
1152077964 17:78170205-78170227 TGATTCCTGCAGCAGGCCGATGG + Intronic
1152598336 17:81249150-81249172 TCTTCCCAGCACCAGGCCCAGGG - Intronic
1152812273 17:82387539-82387561 TTTTCACTGCTGCAGGCACAGGG + Intergenic
1152863761 17:82710342-82710364 TTCTCCCCACAGCAGGCACATGG - Intergenic
1153415656 18:4843257-4843279 TGTTCTCTCCACAAGGCACAGGG + Intergenic
1153762732 18:8347589-8347611 TGTTCCTTCCATCAGGCACCTGG + Intronic
1153961791 18:10146497-10146519 AGTTCCCTGAAGGAGGCACTAGG + Intergenic
1158278005 18:55789918-55789940 TGGTCCCTGTGGCAGCCACATGG - Intergenic
1159220656 18:65459682-65459704 AGTTTACAGCAGCAGGCACAGGG + Intergenic
1161273138 19:3401294-3401316 TCCTCCCTGCAGCAGGCAGAGGG - Intronic
1161513285 19:4683314-4683336 TTCTCCCTGCAGCAGCCCCACGG - Intronic
1161605618 19:5213233-5213255 TCCTCCCTGCAGCAGCCAGAGGG + Intronic
1161901604 19:7123501-7123523 TGTTCCCTGCCACATCCACAGGG + Intronic
1162085623 19:8247275-8247297 TGCTCACTGCACCAGCCACACGG + Intronic
1163113387 19:15175101-15175123 TGGGCACTGCTGCAGGCACAAGG + Intronic
1163416129 19:17187493-17187515 TGTTCTCTGTGGCAGGCACTGGG - Intronic
1163794490 19:19329209-19329231 TGCTCCCTGCAGATGGGACACGG - Intronic
1163882934 19:19943436-19943458 TCTTACCTTCAGCAGGCACCTGG - Intergenic
1165091879 19:33392029-33392051 TGCTCCCTGCAGCAGCTCCAGGG - Intronic
1165146790 19:33735987-33736009 TGCTCCCTGCTGCAGGGCCAGGG + Intronic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1166196101 19:41206911-41206933 TGTTCCCTGTGCCAGGCACCAGG - Exonic
1166860972 19:45810916-45810938 TGTCCCCAGCACCAGGCACAGGG - Intronic
1166959576 19:46489501-46489523 TGTTTCCTGCACCAAGAACAGGG + Intronic
1168200815 19:54814196-54814218 TTTTCTCTGCAGCAGGCAGTGGG - Exonic
1168564042 19:57408114-57408136 TGTTCAAGGCAGCAGGGACATGG + Intronic
925125746 2:1454592-1454614 TGCTCCCAGCAGCAGGGACAAGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
927875518 2:26652931-26652953 TCTTCACTGCTGCAGGGACAGGG + Intergenic
930175020 2:48292877-48292899 TGGTCCCTGCTGGAGGCAGAGGG + Intergenic
931874409 2:66496319-66496341 TCTCCCCTGCAGGAGGCATACGG - Intronic
932349536 2:71021212-71021234 TGTTAGCTGCAGCAATCACAGGG + Intergenic
932709723 2:74053615-74053637 TCTTCCCTGAAGAAGCCACAGGG + Intronic
934149615 2:89133642-89133664 TGTTCACTGCAGCAAAGACATGG + Intergenic
934217680 2:90048386-90048408 TGTTCACTGCAGCAAAGACATGG - Intergenic
935826494 2:106956579-106956601 TGTTCTCTCCAGCAGGAACTAGG - Intergenic
937903392 2:127039760-127039782 TGCTCACTGCAGAAGCCACAGGG - Intergenic
938766640 2:134464270-134464292 TGGCCCCTGGGGCAGGCACAGGG + Intronic
939026913 2:137025025-137025047 TTGTCCATGCAGCAGCCACAAGG + Intronic
939669835 2:144996927-144996949 TTTTCCATGCAGCGGGCAGATGG - Intergenic
941531052 2:166671914-166671936 TGTTCTCAGCATCTGGCACATGG - Intergenic
942632213 2:177963056-177963078 TTTTTCCTACAGAAGGCACAGGG - Intronic
944080928 2:195787763-195787785 TGTCCCCTGCAGCTGGGGCAGGG + Intronic
946115559 2:217458927-217458949 TGGACACTGCAGCAGGCTCAGGG - Intronic
946148631 2:217749308-217749330 TGTGCCCTGCAGCCTCCACAGGG + Intronic
946381095 2:219349574-219349596 GGTTACCTGCAGCAAGCACGTGG - Intergenic
946401237 2:219469407-219469429 TGTCCCCTGCAGCACCCACTTGG + Intronic
948304369 2:236935734-236935756 TCTTCCCCACAGCAGCCACAAGG + Intergenic
948311926 2:236993899-236993921 TCTTTCATGCAGCAGGCACAGGG - Intergenic
948570691 2:238915423-238915445 TGTTTGGTGCAGCAGCCACAAGG + Intergenic
1169258541 20:4118343-4118365 TGAGCGCTGCAGGAGGCACAAGG + Intergenic
1169381726 20:5113174-5113196 TGTCACCTGCAGGAGGCACCGGG + Intergenic
1170381093 20:15760447-15760469 TGTTTCCTGCAGCAGCCACTGGG - Intronic
1170554346 20:17503694-17503716 TGTTGCCTGCAGCAGGGAGGAGG - Intronic
1171048902 20:21837544-21837566 TGGTCTCTGTAGCAGGCTCAGGG + Intergenic
1171182301 20:23099695-23099717 TGCTCCCTATAGCAGGCACTAGG - Intergenic
1171248812 20:23633789-23633811 TGTCTCCTGGTGCAGGCACATGG + Intronic
1171284779 20:23928211-23928233 ACTTGCCTGCAGGAGGCACAAGG - Intergenic
1171350734 20:24501313-24501335 TATCCTCTGCAGCATGCACAGGG + Intronic
1171947008 20:31387728-31387750 AGCTCCTTGAAGCAGGCACAAGG + Intronic
1172254871 20:33508733-33508755 TGTCCTTTGCAGCAGGGACATGG - Intronic
1172510555 20:35497971-35497993 TCTGCCCTGCAGCAGGCCCTGGG + Exonic
1172628329 20:36361519-36361541 TCTTCTCTGCAGCAGCCAGAAGG - Intronic
1173200325 20:40949974-40949996 CTTTTCATGCAGCAGGCACAGGG - Intergenic
1173497661 20:43530934-43530956 AGTTCACTGCAGCTGGCCCAGGG + Intronic
1173681566 20:44885865-44885887 TGTTCCCTGCAGCCCTCCCACGG + Exonic
1173794361 20:45848670-45848692 GGTCCCCTGCAGTGGGCACAAGG + Exonic
1173921221 20:46746902-46746924 TCTTCCATGCAGCAGCCATAAGG + Intergenic
1173965166 20:47107133-47107155 TGTTCCCTGCCGCATCCCCAGGG - Intronic
1175065720 20:56285929-56285951 AGTTCCCACCACCAGGCACAGGG + Intergenic
1176424637 21:6540655-6540677 TGTTCCTTGCGGCAGCCACAGGG - Intergenic
1176869830 21:14075678-14075700 TGCTCCCTGCTGCGGGCACACGG - Intergenic
1178827645 21:36030071-36030093 TCTGCCCTGCAGCAGGGCCAGGG + Intergenic
1179700126 21:43148964-43148986 TGTTCCTTGCGGCAGCCACAGGG - Intergenic
1180158971 21:45990587-45990609 TGATCCCGGCAGGAGGGACAGGG + Intronic
1180159569 21:45992983-45993005 AGGTCCCAGCATCAGGCACATGG - Intronic
1180220377 21:46354748-46354770 TGTGGCCTCCAGCAGGCCCAGGG - Intronic
1180235108 21:46454124-46454146 TGACCCCTGCAGAAGTCACAAGG - Intergenic
1180725869 22:17946139-17946161 TGTTCCCTGAGACAGCCACAGGG - Intronic
1182105806 22:27688251-27688273 TGTTCCATTCAGCAGGCAGGTGG - Intergenic
1182412882 22:30202160-30202182 TGCTCCAGGCAGCAGGCACCAGG + Intergenic
1183080319 22:35451900-35451922 AGTCCCCTGCAGAAGCCACAGGG - Intergenic
1183776426 22:39969144-39969166 TGTTTCCAGTAGCAGACACAAGG - Intronic
1183896186 22:40971080-40971102 TCTGCCCTACAGCAGGCTCAAGG + Intronic
1184413930 22:44341262-44341284 TGTGCCCTGCACGAGTCACATGG + Intergenic
1184901425 22:47448764-47448786 GGTGCCCTGCAGCAGCCACAGGG - Intergenic
1185046788 22:48532611-48532633 TCTGCCCTGCTGCAGGCATAGGG + Intronic
949511833 3:4773035-4773057 GGTGCCCAGCAGCTGGCACAGGG - Intronic
949965555 3:9353063-9353085 TGGTCACTGCAGCAGCAACACGG - Intronic
950448641 3:13053409-13053431 TGTTCCTTCCAGAAAGCACAGGG - Intronic
952434259 3:33256609-33256631 TGTTCCCAGTACCTGGCACAAGG - Intergenic
953025762 3:39144004-39144026 CCCTCCCTGCAGCAGCCACAGGG + Exonic
953605540 3:44411015-44411037 TCCTGCCTGCAGCAGGCAGAAGG - Intergenic
954225444 3:49178026-49178048 GATTCCCTGCAGCAGGCAATAGG + Exonic
954375376 3:50191704-50191726 TGGTCCCAGCAGCAGGCGAAGGG - Exonic
954962750 3:54580641-54580663 TATTTTCTGCAGCAAGCACAGGG - Intronic
956426778 3:69144469-69144491 TTTACTATGCAGCAGGCACAAGG + Intergenic
956936118 3:74103682-74103704 TGTTTCCTGCCTTAGGCACAAGG - Intergenic
960615533 3:119592504-119592526 TTTTCCTTGTTGCAGGCACATGG + Intergenic
961271881 3:125695666-125695688 TGTTAGCTGCAGCAATCACAGGG + Intergenic
961611930 3:128146366-128146388 TGCTCACAGCAGCAGGCAAATGG - Intronic
963005178 3:140720423-140720445 TGTTCTCTGGAGCTGGCAGATGG - Intergenic
964323188 3:155519205-155519227 TGGTCCCTGCTGCAGGTGCATGG - Intronic
966705872 3:182912768-182912790 TGTTGCCTGCACCCAGCACATGG + Intronic
968789243 4:2648048-2648070 TGTTCTCTACTGCAGCCACAGGG + Intronic
969326900 4:6449315-6449337 TGTTCTCTGCAGCTGCCGCAGGG - Intronic
969413626 4:7044785-7044807 TGTTCCGAGAAGCAGGCACCTGG - Intronic
969450648 4:7271168-7271190 TGTGCCCAGCAGCAGCCAGAAGG + Intronic
969882928 4:10190328-10190350 AGTTCCCAGCAGCAACCACAGGG + Intergenic
970878509 4:20900414-20900436 TGTCCCCAGCATCACGCACAAGG + Intronic
972943111 4:44221304-44221326 TGGACCCTGCAGCAGAAACAAGG - Intronic
973171757 4:47153858-47153880 TGTTCCCTGAAGCACACACTAGG + Intronic
974419860 4:61659450-61659472 TGTTCCCAGCAGTGGACACATGG + Intronic
975612475 4:76215719-76215741 TGTTCTCTGCAGCAGTCTCCGGG - Intronic
977296090 4:95211093-95211115 TGTTTCCTAGAGCAGGCTCAAGG + Intronic
979469484 4:121077698-121077720 TGTTCCCAGCAGCGAGCAGAGGG - Intergenic
979945714 4:126829485-126829507 TTTCCCCAGCAGCAGCCACATGG + Intergenic
980556325 4:134410293-134410315 TTTTCTCTGCTCCAGGCACATGG + Intergenic
980658666 4:135826769-135826791 AGTTCACTGTAGCAGGCAAAAGG - Intergenic
980802909 4:137776015-137776037 TGTTCCCTGGAGCAGGAAGGTGG + Intergenic
981095631 4:140776698-140776720 TGTTTCCTGCACCCAGCACAAGG - Intergenic
982115692 4:152096697-152096719 TGGTCCCTGCTGAATGCACATGG - Intergenic
982351200 4:154416987-154417009 TGATCCCTGCAGCTGGGAGAGGG - Intronic
983958741 4:173727400-173727422 TGTCCCCAGCAGGAGGCACAGGG + Intergenic
984144452 4:176044231-176044253 TGCCCACTGCAGCAGTCACAGGG + Intergenic
984226374 4:177040075-177040097 TGTTCCCTGCAGCACTGACCAGG - Intergenic
986113635 5:4747923-4747945 TGCCCACTGCAGCAGGAACAGGG + Intergenic
986431385 5:7684309-7684331 TGCTCCCTGGAATAGGCACAGGG - Intronic
987357559 5:17078062-17078084 TGTTCCCTGCAGCAGGAGAGAGG + Intronic
987546553 5:19317583-19317605 TGTCCTTTGCAGCAGGGACATGG - Intergenic
989056641 5:37371882-37371904 TAGTCCCAGCACCAGGCACAAGG - Intergenic
995252205 5:110006449-110006471 TCTCCCCTTCAGGAGGCACAGGG + Intergenic
995688556 5:114798146-114798168 AGTGCCCAGCAGCAGGCAGATGG + Intergenic
996220030 5:120919889-120919911 CCTCTCCTGCAGCAGGCACATGG - Intergenic
997103507 5:130994066-130994088 TGCTCCCTGCTGTAGGGACAGGG - Intergenic
997206967 5:132055886-132055908 TATTCCCTGCTGCAGGGTCATGG - Intergenic
998147778 5:139740086-139740108 AGTTGCCTGGAGTAGGCACAGGG + Intergenic
998507997 5:142687333-142687355 TCATCCCTTCAGAAGGCACATGG - Intronic
998559703 5:143159836-143159858 TTTTCCCTGAAGGAGGCAGATGG + Intronic
998923639 5:147098588-147098610 TTTTCCCTGCAGCTGGGCCAGGG - Intergenic
1000837042 5:166167865-166167887 TGTTCACTGCAGAAGGCCCCAGG + Intergenic
1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG + Intronic
1001749894 5:174120844-174120866 TGTTCCCTGCAGCAGCTGCAGGG + Intronic
1002100000 5:176852856-176852878 CGGTCCCAGCACCAGGCACAGGG - Intronic
1002157065 5:177291108-177291130 TGTTCCCTGCAGCCCACACTTGG - Intronic
1002578852 5:180195047-180195069 TGTTCTCTGCAGCAGGCACTGGG - Intronic
1002689697 5:181042196-181042218 TGCTCCCTCCGGAAGGCACAGGG - Intronic
1003614347 6:7641744-7641766 GGTCCCCTGCAGCTGGCACATGG + Intergenic
1004178140 6:13358684-13358706 TGTCCCCTGCAGCCACCACAAGG - Exonic
1006910018 6:37557645-37557667 TGTTCCCTGCAGCCCGCTCCAGG + Intergenic
1009458822 6:63888325-63888347 TCTCCCCTTCAGGAGGCACAGGG - Intronic
1015376155 6:132512875-132512897 TGCGCTCTGCAGCAGGCACTCGG - Intronic
1017886029 6:158600020-158600042 TGTGGCCTGCAGGAGGCACGCGG - Intronic
1018461093 6:163998948-163998970 TGTCCCCTGCAGCGAGCAGAAGG - Intergenic
1018847221 6:167563965-167563987 TGTGGCCTGGAGCAGTCACATGG - Intergenic
1019326770 7:442339-442361 TGTTGCCTGCCACAGGCTCAAGG + Intergenic
1019463906 7:1175952-1175974 TCTTCCCCGGAGCAGGCACACGG - Intergenic
1019604761 7:1903159-1903181 TGTTCCAGGCAGCAAGCACACGG + Intronic
1021154790 7:17196532-17196554 TGTTCCCTGCTTCAGCCAGAGGG + Intergenic
1021175006 7:17440206-17440228 GGTTTCCTGCACCAGGCCCATGG - Intergenic
1021502242 7:21344737-21344759 TGTCCCCATCAGGAGGCACAGGG + Intergenic
1022506343 7:30910511-30910533 CGTTCCATGCAGCAGGCAAGAGG + Intergenic
1023081714 7:36532727-36532749 TGCTCCCTGCATGGGGCACAGGG + Intronic
1023123861 7:36935934-36935956 TATGCACTGCAGCAGGCCCAGGG - Intronic
1023968225 7:44974471-44974493 AGTTCCCTGCAGCACAGACATGG - Intronic
1024022591 7:45385653-45385675 TGTTCCCTGGGGCAGGCAGAGGG + Intergenic
1025798750 7:64764072-64764094 GGCTCCCTTCAGCAGGTACATGG + Intergenic
1026953960 7:74365260-74365282 TGGTGACTGCAGCTGGCACAGGG - Intronic
1028720865 7:94029644-94029666 TGTTCTCTACAGAAGGCAAATGG - Intergenic
1029513461 7:101011181-101011203 TCTTCCCTGCTGCAAGGACACGG - Intronic
1032494165 7:132348562-132348584 TGTTCCCAGCTGCAAGCACATGG + Intronic
1034550956 7:151820400-151820422 TGTGCCCTGCAGAAGCCACAGGG - Intronic
1034550968 7:151820454-151820476 TGTGCCCTGCAGAAGCCACAGGG - Intronic
1034550980 7:151820508-151820530 TGTGCCCTGCAGAAGCCACAGGG - Intronic
1034550992 7:151820562-151820584 TGTGCCCTGCAGAAGCCACAGGG - Intronic
1034551004 7:151820616-151820638 TGTGCCCTGCAGTAGCCAGAGGG - Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035827384 8:2659529-2659551 TGTTTTCTGCAGCGGGTACAGGG + Intergenic
1039489924 8:37939829-37939851 TGTTCCCTGCTGCAGGGGGAGGG - Intronic
1039754774 8:40511891-40511913 TCTTCCCGTCAGGAGGCACAGGG + Intergenic
1040328850 8:46375778-46375800 GGTTCACTGAAGCAGGCAGAAGG + Intergenic
1042974012 8:74444257-74444279 TTTTCCCTGCTGCTGACACATGG + Intronic
1046159061 8:110335107-110335129 TGGTTCCTGTAGCAGGCACTGGG + Intergenic
1046706073 8:117452893-117452915 TGTCCCCTACTGCTGGCACATGG - Intergenic
1047370182 8:124249746-124249768 TGGGCCTTGCAGCAGGGACAGGG + Intergenic
1048369317 8:133763895-133763917 TGCTCCATGCAGCAGCCCCAGGG - Intergenic
1048892060 8:138956959-138956981 TGTAACCTGCATCTGGCACATGG + Intergenic
1048906892 8:139097110-139097132 AGCTCCCTGCAGCAGCCTCAGGG - Intergenic
1049244015 8:141551850-141551872 TGGTGCCTGCAGGAGGGACATGG - Intergenic
1050879560 9:10681842-10681864 TGATCCTTGGAGCAGGGACAAGG + Intergenic
1054990200 9:71316676-71316698 TGTTCCCTTCTGCAGGCTCTGGG - Intronic
1055341618 9:75290549-75290571 TGTGCCCTGAAGCAGCAACAGGG - Intergenic
1055729833 9:79268996-79269018 TGTTCCCTGCAAGAGGCACTAGG + Intergenic
1056798930 9:89677995-89678017 TGTTCTCTGGAGCAGGCAGCAGG + Intergenic
1057962441 9:99469613-99469635 TGTTCCCTCCAGCAGGGAAAGGG + Intergenic
1058444995 9:105046959-105046981 AATGCCCTGCAGCAGCCACAAGG + Intergenic
1058952576 9:109917244-109917266 TGTTCCCTTCTGCAGGCTCTAGG - Intronic
1059298908 9:113297458-113297480 TGTTCCCAGAAGCAAACACATGG + Exonic
1059485907 9:114626657-114626679 AGTACCTTGCAGCAGACACAGGG - Intronic
1061443574 9:130624300-130624322 TGTTCCCAGCAGCAGACTCAGGG + Intronic
1062004334 9:134231771-134231793 TGCTCCCTGAAGCAGGGCCAGGG + Intergenic
1062164911 9:135102811-135102833 AGTGCCCTGAAGCAGGCAGATGG - Intronic
1062432878 9:136533739-136533761 TTTTCCCTGCTGTAGGCCCATGG - Intronic
1185549676 X:973075-973097 TGTTTCCTCCAGCAGGCCCGGGG - Intergenic
1186440215 X:9579651-9579673 TGTTCACTACAGTAGACACAAGG - Intronic
1186780897 X:12911073-12911095 TGTTCATTGCAGCAAGCTCAAGG + Intronic
1188418732 X:29971101-29971123 TGTTCCCAGCACCTGGAACAAGG - Intergenic
1190234628 X:48606149-48606171 TGTCCCCTTCAGCAGCCAGAGGG - Exonic
1192598620 X:72438029-72438051 TCTTCCATTCAGGAGGCACAGGG - Intronic
1193697875 X:84730866-84730888 TGTTCCATAGAGCAGCCACAAGG + Intergenic
1194400162 X:93432061-93432083 TGTTAGCTGCAGCAATCACAGGG + Intergenic
1194543563 X:95204731-95204753 AGTTATCTGCAGCAGGAACATGG - Intergenic
1195314606 X:103665615-103665637 CTCTGCCTGCAGCAGGCACAGGG + Intergenic
1199241593 X:145553960-145553982 TGTTCCCTGCAGGGGCCAGAGGG - Intergenic
1201239005 Y:11940155-11940177 TCTTCCCTTCAGCAACCACATGG + Intergenic
1201765191 Y:17568674-17568696 TGCTCCCGGCTGCGGGCACAGGG - Intergenic
1201836361 Y:18337315-18337337 TGCTCCCGGCTGCGGGCACAGGG + Intergenic