ID: 1079151669

View in Genome Browser
Species Human (GRCh38)
Location 11:17905481-17905503
Sequence AAGCCTGGTTCAGCCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079151669_1079151675 17 Left 1079151669 11:17905481-17905503 CCAGCACTGGCTGAACCAGGCTT 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1079151675 11:17905521-17905543 TGCAGTTATCTGGCAGAGATTGG 0: 1
1: 0
2: 5
3: 40
4: 481
1079151669_1079151676 28 Left 1079151669 11:17905481-17905503 CCAGCACTGGCTGAACCAGGCTT 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1079151676 11:17905532-17905554 GGCAGAGATTGGAGTGACCTTGG 0: 1
1: 0
2: 30
3: 587
4: 2558
1079151669_1079151673 -7 Left 1079151669 11:17905481-17905503 CCAGCACTGGCTGAACCAGGCTT 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1079151673 11:17905497-17905519 CAGGCTTAGTCTGAGGAGGAAGG 0: 1
1: 0
2: 1
3: 34
4: 319
1079151669_1079151674 7 Left 1079151669 11:17905481-17905503 CCAGCACTGGCTGAACCAGGCTT 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1079151674 11:17905511-17905533 GGAGGAAGGATGCAGTTATCTGG 0: 1
1: 0
2: 0
3: 13
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079151669 Original CRISPR AAGCCTGGTTCAGCCAGTGC TGG (reversed) Intronic
901719984 1:11189279-11189301 AAGCCTGGTGCAGCCATGGTAGG + Intronic
901822836 1:11841281-11841303 AAGCTTGGGACAGCTAGTGCAGG - Exonic
902922174 1:19672532-19672554 CAGCCTGGTGCAGCCAGGGCTGG + Intronic
904365720 1:30009947-30009969 AACCCCGGCTCAGCCAGAGCAGG - Intergenic
905310803 1:37047548-37047570 ATGCCTGATTCAGCCAGAGCAGG - Intergenic
906710640 1:47927264-47927286 AAGACTGACTCAGCCAGAGCAGG - Intronic
906952982 1:50349473-50349495 AAGCCTACTTCAGCCAGCACAGG - Intergenic
907047110 1:51306093-51306115 AGTCCTGTTTCAGCCACTGCTGG + Intronic
914254997 1:145954906-145954928 AATCCTGGTTCTGCCACTTCTGG - Intronic
915766594 1:158368667-158368689 AAGCCTGGTACAGGCTGTGTGGG + Intergenic
916562387 1:165944232-165944254 CAGCCTGTGTCAGCCAGTTCTGG - Intergenic
917673019 1:177291942-177291964 AAGCCTGATTCATTTAGTGCTGG - Intergenic
920258908 1:204675528-204675550 AAGGCTGGACCTGCCAGTGCTGG - Intronic
921852545 1:219946629-219946651 AAGCCTGGCTCAGCCCTTCCTGG + Intronic
922694437 1:227721386-227721408 AAGACTGGTTCTGGCAGTGATGG + Intergenic
1063192630 10:3711634-3711656 AAGCCTGGTTCACCCAGCTGAGG + Intergenic
1064133360 10:12729855-12729877 AAGGCTGGTGCAGCTAATGCTGG + Intronic
1064285759 10:13990057-13990079 AACCCTGGATCTGCCACTGCTGG + Intronic
1067700690 10:48569231-48569253 CAGCCTGGCACAGCCAGGGCAGG - Intronic
1067804728 10:49384809-49384831 AAGCCCCCTTCAGCCACTGCTGG + Intronic
1068279988 10:54855227-54855249 ATGCCTGGTTCTGCAGGTGCAGG + Intronic
1068916952 10:62443018-62443040 AAGCCCGGTTGAGCCCTTGCAGG - Intronic
1069245124 10:66194807-66194829 TAACCTGGTTCTTCCAGTGCTGG - Intronic
1075594381 10:123717537-123717559 CAGCCTGGTTCAGGCTGTTCTGG + Intronic
1075649567 10:124118847-124118869 GAGCCTGGCCCAGGCAGTGCAGG - Intergenic
1076079067 10:127561635-127561657 AAGCCTGCAGCAGCCAGTTCAGG + Intergenic
1077443341 11:2578791-2578813 GAGGCTGCTTCAGCCATTGCAGG - Intronic
1077902949 11:6504752-6504774 GAGGCTGATTCAGACAGTGCTGG - Intronic
1079151669 11:17905481-17905503 AAGCCTGGTTCAGCCAGTGCTGG - Intronic
1079279382 11:19073702-19073724 AACCCTGGTTCAGACACTCCAGG + Intergenic
1081489040 11:43553247-43553269 ATCCCTGGTTCAGCCAATGGGGG - Intergenic
1083935399 11:65867306-65867328 TAGCCTGGGTCAGACAGAGCAGG - Intronic
1084493654 11:69491566-69491588 AGGGCTGGTTCAGGCAGAGCAGG - Intergenic
1084714200 11:70863365-70863387 CATCCTGGTTCATCCAGTGCTGG + Intronic
1085206468 11:74736093-74736115 AAGCTGAGTTCAGCCAGTGGTGG + Intergenic
1086290344 11:85301651-85301673 AGTCCTGGTTCAGCCACTACTGG - Intronic
1088092654 11:106061175-106061197 AAGCTTGGTTCTCCCAGAGCGGG + Intronic
1090049585 11:123365919-123365941 AACACTGGTTCAGCTGGTGCAGG - Intergenic
1090621470 11:128564573-128564595 CAGCCTGTTTCAGCGAGTGTTGG - Intronic
1090930758 11:131296066-131296088 AAGCCCGTTTCAGCCCTTGCTGG - Intergenic
1091166453 11:133480349-133480371 AAGCCTGGTTCTACCACTCCAGG - Intronic
1092020771 12:5200655-5200677 AAGCCTTGTTCAGCAAGAGGAGG + Intergenic
1096504356 12:52083145-52083167 ATGCCTGGTGCAGCAGGTGCTGG + Intergenic
1097225142 12:57472603-57472625 AACCCTGTTTCGGCCAGAGCAGG - Exonic
1101306213 12:103530416-103530438 AAGCCTGGGTCAGCTCCTGCTGG - Intergenic
1101946171 12:109139234-109139256 AAGCCTGTTTCAGGCAGAGCAGG + Intronic
1103828102 12:123756479-123756501 AGGCCTGGTTCTGCCACTGAGGG - Intronic
1104480450 12:129103327-129103349 GAGCCTGGTTCTGCAAGTGCTGG - Intronic
1105304637 13:19160032-19160054 AAGCATGGTGCTGCCAGGGCAGG - Intergenic
1105627193 13:22124214-22124236 AAGCCTGGGTAAACCAGTGAAGG + Intergenic
1106320022 13:28628768-28628790 AACCCTGGTTCAGCCACTCATGG - Intergenic
1106931816 13:34674594-34674616 AAAGCTGATTCATCCAGTGCAGG - Intergenic
1107242991 13:38259987-38260009 AAGACTGGATCAGCCATTGCTGG - Intergenic
1107750169 13:43557003-43557025 AAGCCTGGGCAAGCCAGTGCAGG + Intronic
1108759552 13:53545956-53545978 AAGACTGGATCTGCAAGTGCTGG + Intergenic
1113389478 13:109881735-109881757 AAGCCTGGTTTAACCAGAACGGG - Intergenic
1118381962 14:65224784-65224806 GAGGCTGGTTCTGTCAGTGCTGG + Intergenic
1118769943 14:68935995-68936017 ACGCCTGGCTGAGCCAGGGCAGG - Intronic
1119181770 14:72610266-72610288 AGGCCTGGTGGAGCCTGTGCAGG + Intergenic
1120186828 14:81402196-81402218 AAGCCTTCCTCAGACAGTGCTGG + Intronic
1122211895 14:100178819-100178841 AGGCTTGGCTCAGCCAGTGATGG - Intergenic
1123032254 14:105457464-105457486 AAGCCTGGCACAGCCAGAGCCGG - Intronic
1124017497 15:25889719-25889741 TAGCTTGGTCCACCCAGTGCAGG - Intergenic
1124205268 15:27713144-27713166 TAGCCTGGAGCAGCCAGTGTTGG + Intergenic
1131042295 15:89281279-89281301 AAGGCTGCTTAAGGCAGTGCAGG + Exonic
1132236334 15:100224728-100224750 ATGCCTGGTGCGGTCAGTGCAGG - Intronic
1135256567 16:20946075-20946097 AAGCCTGGTTCAGGCCATGACGG + Intronic
1139299641 16:65934171-65934193 AAGCCTGTCTCCGCCAGTGTGGG + Intergenic
1140621587 16:76740656-76740678 AACCTTGGTTCCCCCAGTGCAGG + Intergenic
1140647452 16:77048540-77048562 AAGCCTGATTCATAAAGTGCGGG + Intergenic
1141106103 16:81235064-81235086 AGGCCAGGGTGAGCCAGTGCAGG + Intergenic
1141123957 16:81387009-81387031 TAGCCAGGTTCAGACAGTGTTGG + Exonic
1142363877 16:89639663-89639685 GAGAGTGGTTCTGCCAGTGCAGG - Intergenic
1142626470 17:1195465-1195487 GAGCCTGGGTCAGGCAGGGCTGG - Intronic
1143055348 17:4158135-4158157 AAGCCCGGGTCTGCCAGTGAGGG - Intronic
1146761854 17:35486300-35486322 AGGCCTGATACAGACAGTGCAGG - Intronic
1147651998 17:42068072-42068094 AAGGCTGGGTCAGGCAGGGCAGG - Intergenic
1148119243 17:45197937-45197959 CAGCCAGGTTCTGCCAGAGCTGG + Intergenic
1149327936 17:55551394-55551416 AACCCTCCTTCAGCCTGTGCAGG - Intergenic
1149678972 17:58491086-58491108 AAGACTGGCTCAGCAAGTGGAGG - Exonic
1151538245 17:74750506-74750528 AAGCCCTGTCCAGCCAGAGCTGG + Intronic
1152927017 17:83092051-83092073 AAGCCTGGTTTGGCCGGTACGGG + Intronic
1153557451 18:6330454-6330476 AAGACTTGATCAGCCATTGCTGG - Intronic
1158069261 18:53451388-53451410 TAGTCTGTGTCAGCCAGTGCTGG + Intronic
1161823241 19:6544299-6544321 AGCCCTGGTTCTGCCAGTGCTGG + Intergenic
1165636446 19:37344293-37344315 AAGCCTTGTTCAAACATTGCTGG + Intronic
1166107611 19:40605151-40605173 AGGCCTGGTACAGCCGGGGCCGG - Exonic
1166654877 19:44603753-44603775 AAGACTGGTTCAGCCCATGACGG + Intergenic
1168303522 19:55420635-55420657 ATGCCTGATTCAGCCAAGGCCGG + Intergenic
925208014 2:2023595-2023617 AAGCCTTGTGCCGCCAGGGCAGG - Intronic
925442570 2:3900991-3901013 AAGCCTGGATAAGCTGGTGCTGG + Intergenic
925601967 2:5617329-5617351 AAACTTGGTGCAGCCAGTTCGGG + Intergenic
926056283 2:9775969-9775991 AGGGCTGGTTCAGCCAGGCCTGG - Intergenic
928403938 2:30999834-30999856 GAGCCTGGCACAGTCAGTGCAGG + Intronic
928803653 2:35125335-35125357 CAGGCTGGCGCAGCCAGTGCTGG - Intergenic
929868944 2:45741732-45741754 AAGGCTAGTACAGCCTGTGCTGG + Intronic
932408977 2:71534095-71534117 ATTCCTGGTCCACCCAGTGCTGG - Intronic
932704196 2:74010434-74010456 AAGCATGGTCCTGCCTGTGCCGG - Intronic
933636684 2:84715865-84715887 CAGCCTGGTTCAAACAGTGGGGG - Intronic
934518883 2:95007010-95007032 CAGCCTGCTGCAGCCAGGGCGGG + Intergenic
937393216 2:121510995-121511017 AAGCCTGTTTCAGCCTGAACTGG - Intronic
939393966 2:141604980-141605002 AAGCCAGGTACAGCCAAGGCAGG + Intronic
943400971 2:187410581-187410603 AAGCCTGTTTTAGACAGTGGAGG + Intronic
944484877 2:200195080-200195102 AGCCCTGGTTCCTCCAGTGCTGG - Intergenic
1169346997 20:4836492-4836514 AAACCTGGGTCAGCCAGGGCAGG + Intergenic
1169880602 20:10342279-10342301 ATGCCTAGTTCAGCCACAGCAGG + Intergenic
1170381664 20:15766867-15766889 AAGCCTGGGCCAGCCAGTTGAGG - Intronic
1170567813 20:17616629-17616651 GAGGCTGGAGCAGCCAGTGCGGG + Intronic
1170823347 20:19772640-19772662 AGGTCTGGCTCAGGCAGTGCCGG - Intergenic
1171383710 20:24752893-24752915 AAGCCTGGTCAAGCCTCTGCAGG + Intergenic
1172752137 20:37258409-37258431 AAGGTGGGTTCTGCCAGTGCTGG - Intronic
1174203922 20:48826206-48826228 AATCCTGGTTCAGGAAGGGCTGG - Intronic
1174296810 20:49551235-49551257 AAGACTGGTTCAGGCCGTGGTGG + Intronic
1174890520 20:54387065-54387087 GTGCCTGGATCAGCCTGTGCTGG - Intergenic
1179622221 21:42624600-42624622 AAGCCTGGTTCAGGCCATGAAGG + Intergenic
1180057269 21:45365399-45365421 AAGCCTTGGTCTGCCAGAGCCGG + Intergenic
1180203870 21:46244852-46244874 CAGCCTGCTTCAGCCAGGCCAGG + Exonic
1180259620 21:46660209-46660231 AAGCCTAGTGCAGCCAGTGATGG + Intronic
1180588871 22:16918706-16918728 AACCCTGTTTCTTCCAGTGCCGG - Intergenic
1181628838 22:24139873-24139895 TCTCCTGGATCAGCCAGTGCTGG + Intronic
1182501396 22:30750522-30750544 AAGACTGGTTCAGGCAATGATGG + Intronic
1183275502 22:36894639-36894661 AAAACTGGTTCTGCCAGGGCTGG - Intergenic
1184107001 22:42373579-42373601 CAGCCTGGTGAAGTCAGTGCTGG + Intergenic
1184471360 22:44698074-44698096 AAGCCTGGCTCAGCCCCGGCTGG - Intronic
1185275933 22:49950263-49950285 AAGCCCGGCACAGCCACTGCAGG + Intergenic
950422123 3:12905440-12905462 ATGCCTGGCTCAGGCAGCGCCGG - Intronic
951171012 3:19541574-19541596 AACCCTACTTCAGCCAATGCTGG - Intergenic
952861327 3:37815021-37815043 AAGGCTGTTTCAGCCAGGGGTGG + Intronic
952959403 3:38580181-38580203 CAGCCAGGCCCAGCCAGTGCAGG + Intronic
954369783 3:50164097-50164119 CAGCCTGGGTCAGCCAGGCCAGG + Intronic
954590671 3:51778890-51778912 GAGCCTGGGTCATCCAGTGCTGG - Exonic
956236016 3:67071786-67071808 AAGGCTGGTTCAGAAAGTGGAGG + Intergenic
960115773 3:113890496-113890518 AAGCCTCCTTCACCCACTGCAGG + Intronic
960964574 3:123095948-123095970 TAGCCTGGTTCAGAAAATGCTGG + Intronic
966491503 3:180532194-180532216 ATCCCTGGCTCAGCCAGAGCAGG + Intergenic
967475433 3:189911179-189911201 AAGCCTGGTTGTGTCAGGGCAGG - Intergenic
968747095 4:2365664-2365686 AACCCAGGCCCAGCCAGTGCTGG - Intronic
969225174 4:5791851-5791873 AGGCTTGGCTCAGCCAGGGCGGG - Intronic
969720582 4:8891276-8891298 AAGCCTGGAACTGGCAGTGCAGG - Intergenic
969998886 4:11343862-11343884 AGGCCTGGTCCAGCCTGGGCGGG + Intergenic
970924882 4:21439839-21439861 AGGCCTGTTTAAGGCAGTGCTGG + Intronic
972303223 4:37805954-37805976 AAGACTGGTTCAGGCCGTGATGG + Intergenic
974754660 4:66187402-66187424 AAGCCTGGGTCTGCAGGTGCTGG + Intergenic
975097913 4:70478703-70478725 AATCCTGCTTCAGTCAGAGCAGG + Intronic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
982115753 4:152097053-152097075 AAGGCTGGTTCTGTAAGTGCTGG + Intergenic
994213402 5:97110186-97110208 GAGCCTGGCTTAGCCAGTGGAGG - Intronic
995039658 5:107573144-107573166 AAGCCAAGTTCAGCCTGAGCTGG - Intronic
996099717 5:119433956-119433978 AAGCCTCTCTCAGCCATTGCTGG - Intergenic
997441139 5:133909285-133909307 AAGCCAGGGGGAGCCAGTGCTGG + Intergenic
1001448914 5:171809135-171809157 CACCCTGATTCATCCAGTGCTGG + Intergenic
1007337927 6:41168039-41168061 AAGCCTGGTGCAGACATCGCAGG + Intergenic
1007783905 6:44269690-44269712 AAGCCAGGCTGAGCCACTGCAGG - Intergenic
1009298016 6:61979026-61979048 AAACCTGGTTAATTCAGTGCAGG + Intronic
1013057961 6:106603524-106603546 GAGCCTGGATCAGTCAGGGCAGG + Intronic
1013236031 6:108198641-108198663 AAGCTGGGTTCAGCCAGAGCAGG - Intergenic
1017065501 6:150525516-150525538 GAGCTTGTTTCAGCCAGTTCAGG + Intergenic
1017159248 6:151349953-151349975 AAGCTTTTTTAAGCCAGTGCTGG - Exonic
1017999600 6:159567412-159567434 AAGCCTGGTACAGCCAGGCATGG - Intergenic
1019030526 6:169006501-169006523 AAGACTGGTTCAGCCCATGAAGG - Intergenic
1019597912 7:1866867-1866889 GAGCCTGGCCCAGCCAGCGCTGG - Intronic
1023264681 7:38392785-38392807 AAGCATGGTTCAGGCACTGGGGG - Intronic
1023873442 7:44274777-44274799 AGACCTGGTTCTGCCAGTGTGGG - Intronic
1025047099 7:55701182-55701204 CAGCATGCTTCAGCCAGAGCAGG + Intergenic
1025158194 7:56629422-56629444 CAGGCTGGTTCAGGCAGTGGAGG + Intergenic
1026534526 7:71228983-71229005 ATGCCTGGATCATCCAGGGCTGG + Intronic
1029175221 7:98659772-98659794 AGGCCTTGCTCAGCCAGTGGCGG - Intergenic
1032002318 7:128273409-128273431 GAGCCTGAATCAGTCAGTGCAGG - Intergenic
1032608821 7:133389150-133389172 AAGGCAGGTTCAATCAGTGCAGG + Intronic
1033308117 7:140239588-140239610 ATGCCTGGATCAGCCTCTGCGGG + Intergenic
1033358946 7:140624201-140624223 AAGGCTGGGTCAGCCAGCACAGG - Intronic
1034053000 7:148003051-148003073 AAGCCTTGTGCTGACAGTGCAGG + Intronic
1035372544 7:158388546-158388568 GAGCCTGGTGCACCCAGGGCAGG - Intronic
1048463652 8:134643700-134643722 AGGGCTGATGCAGCCAGTGCCGG - Intronic
1048481124 8:134794590-134794612 AAGCCTGCCTCAGGCAGTTCAGG - Intergenic
1049004037 8:139843657-139843679 AAGGCTGGACCAGCCACTGCTGG + Intronic
1049044376 8:140137609-140137631 AAACCTGATTCAGCAGGTGCGGG - Intronic
1052196052 9:25716290-25716312 AAAGCTGGTTCTGCAAGTGCTGG + Intergenic
1052862524 9:33445776-33445798 AACCCTGATTCTGCCACTGCAGG + Intronic
1056938253 9:90934359-90934381 AAGCTTGCTTCAGGCACTGCTGG - Intergenic
1057267834 9:93630655-93630677 AGGCTTGGTTCACCCTGTGCAGG + Intronic
1057799415 9:98181058-98181080 TATCCAGGTTCACCCAGTGCTGG - Intronic
1059860797 9:118459195-118459217 AAGACTTGTTGAGCCACTGCTGG + Intergenic
1061614796 9:131772739-131772761 AGACCTGGTCCAGCCAGTGCTGG - Intergenic
1187770135 X:22686417-22686439 AGGCTTGCGTCAGCCAGTGCAGG - Intergenic
1200051255 X:153433059-153433081 AAGCCTGTTCCTGCCTGTGCTGG - Intergenic
1200899328 Y:8412198-8412220 CAGGCTGGTTCAGGCAGTGGAGG + Intergenic