ID: 1079152987

View in Genome Browser
Species Human (GRCh38)
Location 11:17918189-17918211
Sequence CACTTGTACCAGCAGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079152987 Original CRISPR CACTTGTACCAGCAGGCAGG TGG (reversed) Intronic
900089207 1:912305-912327 CACAGGTGCCAGCTGGCAGGTGG - Intergenic
905103028 1:35542101-35542123 CAGATGACCCAGCAGGCAGGAGG - Intronic
905532176 1:38688903-38688925 CACTTGTAATACCAGCCAGGTGG - Intergenic
906013579 1:42552757-42552779 CACTGATACCACAAGGCAGGTGG + Intronic
906782616 1:48585953-48585975 CACTTCTACCTCCAGGGAGGGGG + Intronic
907412989 1:54295368-54295390 CACTTGGACTAGGAAGCAGGGGG - Intronic
907704681 1:56822104-56822126 CACTGATCCCAGCAGGCAGTAGG - Intergenic
913971124 1:143419308-143419330 CACTTGAACCAGCAAGTTGGAGG - Intergenic
914065502 1:144244920-144244942 CACTTGAACCAGCAAGTTGGAGG - Intergenic
914113649 1:144721434-144721456 CACTTGAACCAGCAAGTTGGAGG + Intergenic
916502867 1:165401460-165401482 CACCTGCACCTGCTGGCAGGAGG + Intronic
921030273 1:211330103-211330125 TATTTGTACCTGGAGGCAGGTGG + Intronic
921325384 1:213982982-213983004 CACTTGGCCGCGCAGGCAGGAGG + Intergenic
921831762 1:219735021-219735043 CAATTCTACCAGCAGACAGGAGG - Intronic
924432406 1:244008229-244008251 CAGCTGTACCAGCACGTAGGCGG - Intergenic
1064769699 10:18711070-18711092 CACTTGGACCAGGAGGGCGGAGG - Intergenic
1066253912 10:33660584-33660606 CTCTTGGAACAGCAGCCAGGGGG - Intergenic
1067431785 10:46250163-46250185 CCCATGCACCTGCAGGCAGGTGG + Intergenic
1069114029 10:64482117-64482139 CACTTTTACCTACAGGCAGAAGG + Intergenic
1072880689 10:99224929-99224951 CACTTCTAGCAGTAGGCACGTGG + Intronic
1076564577 10:131389371-131389393 CACTTGAGCAAGGAGGCAGGAGG + Intergenic
1079152987 11:17918189-17918211 CACTTGTACCAGCAGGCAGGTGG - Intronic
1080347178 11:31337982-31338004 CATTTGTATCAGCAGGAAGCAGG + Intronic
1081571398 11:44293696-44293718 TACTTGTACCATGTGGCAGGTGG - Intronic
1083155795 11:60822083-60822105 TACTTGTACCCGCTGGCAGGAGG + Intergenic
1083286018 11:61659565-61659587 CACATATACCAGCAGGGAGTAGG - Intergenic
1084211890 11:67628243-67628265 CTCATCTACCTGCAGGCAGGAGG + Exonic
1084558489 11:69889425-69889447 CCCTTGTCCCTGCAGGCTGGGGG - Intergenic
1088083668 11:105951712-105951734 CACTTGTAATCCCAGGCAGGTGG + Intronic
1090773548 11:129943907-129943929 CGCTTGAACCTGGAGGCAGGGGG + Intronic
1093287000 12:17276050-17276072 CACTTGAACCGGGAGGCAGGAGG + Intergenic
1097205070 12:57314102-57314124 CACTTGAACCAGCAAGGTGGAGG + Intronic
1098316338 12:69197457-69197479 CACTTGCAGCAGAAGGCAAGGGG + Intergenic
1101151286 12:101885015-101885037 CGCTTGAACCAGGTGGCAGGAGG - Intronic
1101198447 12:102409565-102409587 CACTTGTATGAGATGGCAGGGGG - Intronic
1101516586 12:105441352-105441374 CACTTGGATCACAAGGCAGGTGG - Intergenic
1103451332 12:121031434-121031456 CACTGGTACCAGCAGGTGAGGGG - Exonic
1105031315 12:132886225-132886247 CACTTGAACCGGGAGGCAGAGGG + Intronic
1106584766 13:31047366-31047388 CACTTGCCCCAGCAGTCGGGAGG + Intergenic
1107520887 13:41179902-41179924 CACTCCTACCAGCAGGTATGAGG + Intergenic
1109624642 13:64958781-64958803 CATTAGTATCACCAGGCAGGTGG + Intergenic
1113337422 13:109390601-109390623 CATTTGCTCCAGCAGGGAGGAGG - Intergenic
1117412333 14:55461677-55461699 CACTTGAACCTGCAAGGAGGAGG - Intergenic
1120999900 14:90444029-90444051 CACTGGTTCCAGCACCCAGGAGG + Intergenic
1123799126 15:23802999-23803021 CACTTGGAGCAGCCGGCCGGCGG + Intergenic
1123876968 15:24633283-24633305 CAGTTATACCAGTAGGAAGGTGG + Intergenic
1124286120 15:28401636-28401658 CACTTGAACCTGGAGGCAGAGGG + Intergenic
1124296583 15:28510024-28510046 CACTTGAACCTGGAGGCAGAGGG - Intergenic
1126842108 15:52727422-52727444 CATTTGTATCTGCACGCAGGAGG + Intergenic
1127895606 15:63296165-63296187 CACTTGTGCCAGCTGACTGGGGG + Intronic
1129775190 15:78232076-78232098 CACTCTTAGCAGCAGGCTGGAGG - Intronic
1130300404 15:82676213-82676235 CTCTTGTACTAGCAGACTGGAGG + Intronic
1132338684 15:101064745-101064767 CACTTGGAGCAGGAGCCAGGTGG + Intronic
1133950535 16:10387984-10388006 CACTTGAACCCGGAGGGAGGAGG - Intronic
1135303111 16:21347543-21347565 CAGTCCTGCCAGCAGGCAGGCGG + Intergenic
1135682681 16:24471816-24471838 CACTTGTACAAGCTTTCAGGCGG + Intergenic
1135962925 16:27012764-27012786 CACTTGAGCCTGCGGGCAGGAGG - Intergenic
1136299851 16:29326735-29326757 CAGTCCTGCCAGCAGGCAGGCGG + Intergenic
1138041805 16:53679482-53679504 CACTTGAACCAGGAGGCAGAGGG - Intronic
1138538980 16:57676933-57676955 CATTTCTTCCAGAAGGCAGGAGG - Intronic
1138539322 16:57679000-57679022 CACTGGGAGCAGCAGGGAGGAGG + Intronic
1139154570 16:64424920-64424942 CAATTGTACCAGAAGGAAGAGGG - Intergenic
1139563057 16:67755982-67756004 CATTTGAACCAGCAGGCAGGAGG + Intronic
1140425237 16:74855575-74855597 CACTTGTACCCGGAAGGAGGAGG + Intergenic
1142061584 16:88033497-88033519 CAGTCCTGCCAGCAGGCAGGCGG + Intronic
1142374159 16:89698156-89698178 CACCTGCACCAGCTGGCAGGCGG + Exonic
1142777815 17:2155134-2155156 CACTTGAACCAGCAAGGTGGAGG - Intronic
1142833638 17:2568137-2568159 CACTTGAACCCGCAGGGCGGAGG - Intergenic
1143472609 17:7185372-7185394 CACCTGAACAAACAGGCAGGAGG + Intergenic
1149291957 17:55225948-55225970 CACATTAACCTGCAGGCAGGGGG + Intergenic
1151578693 17:74965363-74965385 GACTTGTCCCAGCAGGCAGTGGG - Intronic
1151834831 17:76575659-76575681 CATTTGTTCCAGCAGCCACGGGG + Intronic
1151926174 17:77199086-77199108 CACTTGAACCTGGAGGCAGAGGG - Intronic
1152876096 17:82786976-82786998 CACCTGTCCCAGCAGCTAGGAGG - Intronic
1155087255 18:22470718-22470740 CACTTTTACCAGCAGGGAGAAGG - Intergenic
1156784815 18:40897940-40897962 CACTTGTAACAGAAAGCAGTAGG + Intergenic
1157474852 18:48016836-48016858 CCCTTGTAGCAGCTGGAAGGTGG - Intergenic
1161004876 19:1930106-1930128 GACTTGCACCAGGGGGCAGGGGG + Intergenic
1162243783 19:9381638-9381660 CACGTGTACCCTCAGGCAAGAGG - Exonic
1163718424 19:18885986-18886008 CAGGTGCACCAGGAGGCAGGAGG - Intronic
1167172159 19:47840337-47840359 CCCTTGAACAAGCAGGTAGGGGG + Exonic
925099287 2:1231717-1231739 CAGTCCTACCAGCAGGCAGCAGG + Intronic
926702945 2:15816141-15816163 CACATGTATCAGTTGGCAGGGGG - Intergenic
926749810 2:16189804-16189826 CACCTGAACCACCAGACAGGAGG - Intergenic
927887706 2:26728718-26728740 TGCTTGCACCAGCCGGCAGGAGG + Exonic
928246564 2:29634179-29634201 CACTTGAACCGGGAGGCAGAGGG - Intronic
928962187 2:36939067-36939089 CACTTGAACCAGCAAGTTGGAGG - Intronic
929054145 2:37861775-37861797 CACTTGTCCCAGAAGGCAGTGGG - Intergenic
932614327 2:73222506-73222528 CACTTGTACCAGCAAGGCTGAGG - Intronic
933726009 2:85427669-85427691 CATTTGAACCATAAGGCAGGCGG - Intronic
933877398 2:86632829-86632851 CACCAGTAACAGCAGGCAGTAGG + Intronic
940033854 2:149292554-149292576 CACTGGTCCCAGCAGGCTGATGG + Intergenic
947732286 2:232438001-232438023 CACTTGGGCCACCAGGGAGGTGG + Intergenic
948752560 2:240141012-240141034 CACTTAAACCAGCAGGCAGGAGG + Intronic
1169199838 20:3703561-3703583 CCCCTGTAGCAGCAGGCGGGTGG - Intronic
1172445507 20:34991136-34991158 CACCTGGAGCAGCAGGCAGGGGG - Intronic
1172447578 20:35001231-35001253 CTCCCGTACCTGCAGGCAGGGGG - Exonic
1174194971 20:48766579-48766601 GACTTGAAGCAGCTGGCAGGAGG - Intronic
1175811668 20:61861742-61861764 CACGTACACCATCAGGCAGGAGG + Intronic
1175948610 20:62570354-62570376 CACTTGTCCCAGCGTGCTGGGGG + Intronic
1178538728 21:33431652-33431674 CACTTGGACCAGGAGGCAGAGGG - Intronic
1179501647 21:41813000-41813022 CACTTGCACCAGGAGGAAGCTGG - Intronic
1179721364 21:43317933-43317955 CACTTGAGCCAGCAGGAAAGAGG + Intergenic
1179842769 21:44087975-44087997 CGCCTTTCCCAGCAGGCAGGCGG - Intronic
1180708497 22:17824114-17824136 AACTTGCACCAGCAGGAAGAGGG + Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182509987 22:30812247-30812269 CACTTGAACCTGGAAGCAGGAGG - Intronic
1183264010 22:36814681-36814703 CACTAGTACCAGAGGGCTGGGGG + Intronic
1183908366 22:41060121-41060143 CACTAGTGACAGCAGGCAGCTGG - Intergenic
1184333108 22:43838324-43838346 CACTTGTGCCCGCAGGGAGGAGG - Intronic
1184333127 22:43838394-43838416 CACTTGTGCCCGCTGGGAGGAGG - Intronic
949953822 3:9251273-9251295 GCCTTGTACCCGGAGGCAGGAGG + Intronic
950449677 3:13058643-13058665 CCCTTGTACCCACAGGCTGGGGG - Intronic
952738762 3:36715803-36715825 CACGTGTGGCAGCAGGGAGGGGG + Intronic
954412209 3:50375729-50375751 TACTTGGGCTAGCAGGCAGGGGG + Intronic
954860846 3:53689229-53689251 CACTGGTTCCGACAGGCAGGAGG - Intronic
955210656 3:56937636-56937658 TACTTGTTCTAGCAGGGAGGAGG - Intronic
959882329 3:111458428-111458450 CACTTATGCCAGTAGGAAGGTGG - Intronic
960940225 3:122928513-122928535 CATGTGCACCAGCAGACAGGTGG - Exonic
963295139 3:143537790-143537812 CAAGCATACCAGCAGGCAGGTGG + Intronic
965507397 3:169531595-169531617 CACTTGTACCAGGAGTTAGGAGG - Intronic
965985695 3:174750515-174750537 CACTTGAACCCCCTGGCAGGTGG - Intronic
966657948 3:182380941-182380963 CACTTGTACCAGTAGATATGTGG + Intergenic
968464488 4:743740-743762 CACTGGTACCAGGAGTGAGGAGG - Intronic
971714693 4:30160371-30160393 AACTTGGACAAGCAGGCTGGAGG + Intergenic
974872689 4:67662545-67662567 CGCTTGAACCAGGAGGCAGAGGG - Intronic
976193781 4:82514002-82514024 AATTTGCACCAGCAGGCAGTGGG + Intronic
976903757 4:90210197-90210219 GACCTGTATCAGCAGGCAAGTGG + Intronic
980583045 4:134777821-134777843 CAAATGAACCAACAGGCAGGGGG - Intergenic
983398469 4:167233800-167233822 CCCTTGAACCAGCTGGGAGGGGG + Intronic
987459456 5:18190755-18190777 CACTTGTGGCAGAAGGCAAGAGG + Intergenic
998446534 5:142203192-142203214 CACTTGTACCAACAAGTTGGAGG - Intergenic
998474567 5:142409417-142409439 CAGTTTGCCCAGCAGGCAGGAGG - Intergenic
999250377 5:150178965-150178987 CACGTGTACAAGCAGGGAGCTGG - Intronic
999397412 5:151238717-151238739 CATCTGGACCAGAAGGCAGGGGG + Intronic
1001067554 5:168549831-168549853 CACTTGAACCGGGAGGCAGAGGG - Exonic
1001847849 5:174937574-174937596 CACTGGGTCCTGCAGGCAGGGGG - Intergenic
1002375301 5:178784615-178784637 CATTCTTACCAGCAGGAAGGAGG - Intergenic
1003493173 6:6641669-6641691 CAAACGTACCAGCAGCCAGGTGG + Intronic
1003702920 6:8490453-8490475 CACCTGTACCAGCAGTCTTGTGG - Intergenic
1004120804 6:12820262-12820284 CACTTGAACCTGGAGGCAGGGGG - Intronic
1006303270 6:33205094-33205116 CACTTGTTCCAGCAGGCACCTGG - Exonic
1006628942 6:35417613-35417635 CACTTGAACCCGGGGGCAGGGGG - Intronic
1007343696 6:41210185-41210207 CGCTGGCACCAGCAGACAGGAGG - Intergenic
1008695265 6:54028701-54028723 AAGATGGACCAGCAGGCAGGAGG - Intronic
1009902259 6:69821640-69821662 CACTTGAACCTGAAGGGAGGAGG + Intergenic
1015867174 6:137739363-137739385 CTCTTGGACCAGCAGGCAACAGG - Intergenic
1016775981 6:147905263-147905285 CACTTGAACCTGGAGGGAGGCGG - Intergenic
1017890811 6:158637591-158637613 CAATTGTACCAGCAGCCAAATGG + Intronic
1019005004 6:168789519-168789541 CACTTGTCACACCAGGCAGAAGG - Intergenic
1019347875 7:539468-539490 CCCCTGTTCCAGCTGGCAGGTGG - Intergenic
1019567407 7:1691253-1691275 CACTGATCCCAGCAGACAGGAGG + Intronic
1019614548 7:1953190-1953212 CGTCTGCACCAGCAGGCAGGTGG - Intronic
1026624856 7:71982860-71982882 CAGTTGTACCAGTAGGAAAGGGG + Intronic
1026866597 7:73828006-73828028 CACTTGGAGAAGCAGGCATGGGG - Intronic
1028471633 7:91212579-91212601 CACTGGTAGCAGCAGGCTGCTGG - Intergenic
1029174455 7:98654209-98654231 AACTGGTACAAGCAGGAAGGAGG + Intergenic
1029223981 7:99011856-99011878 CACTTGGAGCAGCAGCCAGAAGG - Intronic
1032529701 7:132609997-132610019 CACTAGTTCAAGCAGGCAGATGG - Intronic
1035336638 7:158133613-158133635 GGCTTGTCCCAGCAGGCTGGAGG - Intronic
1038653587 8:29428100-29428122 CAGTTGTATCACCAGGGAGGAGG + Intergenic
1038691263 8:29765523-29765545 CACTTGAAGCAGAAGGCAGAAGG - Intergenic
1039049422 8:33479326-33479348 CACTTGAACCAGGAGGGAGGTGG + Intronic
1043769555 8:84182302-84182324 GACGTGTACCAGCAGTGAGGCGG - Intergenic
1044548900 8:93489899-93489921 CACCAGTACCAGCAGCCAGTTGG - Intergenic
1051576524 9:18622316-18622338 CCCTCGGACCAGCCGGCAGGTGG - Exonic
1053278502 9:36801118-36801140 CACTTGTCCCTGTAGTCAGGAGG + Intergenic
1056548146 9:87629895-87629917 CAAGTGTCCCAGCACGCAGGTGG - Intronic
1056579555 9:87880874-87880896 CCCTCGTTGCAGCAGGCAGGTGG + Intergenic
1058667670 9:107335597-107335619 CACTTGGACCCTGAGGCAGGTGG + Intergenic
1061473538 9:130846637-130846659 CACAAGTGCCAGCAGGAAGGTGG + Intronic
1187912749 X:24125990-24126012 TTCTTATACCAGCAGTCAGGAGG - Intergenic
1194070072 X:89312092-89312114 CTCTTGTAGCATCATGCAGGAGG - Intergenic
1196606100 X:117658721-117658743 CACTTGAACCAGGAAGTAGGAGG + Intergenic
1198401239 X:136270274-136270296 CACTAATACCAGGAGGCAGGAGG + Intergenic
1199074320 X:143511829-143511851 CACCTGTACCTGAAGACAGGTGG + Intronic
1199093321 X:143715096-143715118 CACCTGTACCTGAAGACAGGTGG + Intronic
1200352633 X:155514753-155514775 AACTTGTAGCAGCAAGAAGGTGG - Intronic
1200724308 Y:6647717-6647739 CTCTTGTAGCAACATGCAGGAGG - Intergenic
1200844961 Y:7822643-7822665 CTCTTGTACCTGGAGCCAGGAGG - Intergenic
1201684224 Y:16683102-16683124 CACTTGAACTGGGAGGCAGGAGG + Intergenic