ID: 1079153001

View in Genome Browser
Species Human (GRCh38)
Location 11:17918382-17918404
Sequence CCAGATGTATTGACCCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079153001 Original CRISPR CCAGATGTATTGACCCTGCA GGG (reversed) Intronic
907773273 1:57487325-57487347 CAAGCTGTCTTGATCCTGCAGGG - Intronic
1070292788 10:75131111-75131133 CCACATGAAATCACCCTGCAGGG + Intronic
1072049906 10:91693160-91693182 ACAGGTGTATTGAACCTTCAGGG - Intergenic
1072351636 10:94563145-94563167 GCAGATATAGTGACACTGCAAGG - Intronic
1072661635 10:97366961-97366983 CCAGATGTAGTGTCCCTGGTAGG + Intronic
1077777831 11:5291321-5291343 CCAGATGTCCTGTCCCTGTAAGG + Intronic
1079153001 11:17918382-17918404 CCAGATGTATTGACCCTGCAGGG - Intronic
1081130613 11:39374542-39374564 CCAGTTATATTAACCCTGCCTGG + Intergenic
1086173869 11:83866801-83866823 CCAGTAGTATTGACCTTGTAGGG - Intronic
1087181603 11:95147653-95147675 ACAGATGCATTTCCCCTGCATGG - Intergenic
1100800082 12:98221753-98221775 CCACATGTATTGACCTTGGTAGG + Intergenic
1101127381 12:101650994-101651016 CCAGCTGAAATGACCCAGCAAGG - Intronic
1106487620 13:30186233-30186255 CCAAATGTATTCACCCAACATGG - Intergenic
1108527603 13:51299394-51299416 CCAGATGCTTTGTCCCTGAAAGG + Intergenic
1118097059 14:62548467-62548489 CCAGATGTATTGAAGCTCCTTGG - Intergenic
1122215966 14:100204693-100204715 GCATATGTACTGACCTTGCATGG + Intergenic
1126790315 15:52215457-52215479 ACAGCTGCAGTGACCCTGCATGG - Intronic
1144262424 17:13535272-13535294 ACATATGTATTTTCCCTGCAAGG + Intronic
1150583929 17:66500487-66500509 CCAGAAGTATTGAGCCAGAAGGG + Intronic
1150688505 17:67341601-67341623 CCAGCAGTATTGAGCTTGCAAGG - Intronic
1159353060 18:67299888-67299910 CCACATGGATTGTCCCTACATGG - Intergenic
1162663993 19:12194698-12194720 CCAGATGTAGTGACCCTTTAAGG - Intergenic
1164947637 19:32309847-32309869 CTAGTTGTATTGAACCTGCTAGG - Intergenic
1165045231 19:33099500-33099522 ACAGATGCTGTGACCCTGCAGGG - Intronic
1166173915 19:41052140-41052162 ACAGATGTATTTCCCCTGCTTGG - Intergenic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1168609617 19:57788621-57788643 CCAGATATATTCTCCCTTCATGG - Intronic
1168706613 19:58473959-58473981 CCATGTGTGATGACCCTGCAAGG + Intergenic
934156175 2:89203168-89203190 GCAGAAGGGTTGACCCTGCATGG + Intergenic
934211142 2:89979595-89979617 GCAGAAGGGTTGACCCTGCATGG - Intergenic
939237303 2:139513227-139513249 CTAGATGTATTCATCCTACATGG + Intergenic
939752708 2:146067287-146067309 TCAGATGTATTTACCTTCCAGGG + Intergenic
941630297 2:167876896-167876918 CCAGATGAATTCACACTGCTGGG + Intergenic
1170455725 20:16530989-16531011 CAATATGTATTGACCAGGCATGG - Intronic
1180595022 22:16967467-16967489 TCAGATGTCTTGGCCCTGGAAGG + Intronic
1181773343 22:25142579-25142601 CCAGATGGATGGACCGGGCATGG + Intronic
1182073823 22:27481203-27481225 CCACATATATTGGCCCTGCTTGG - Intergenic
1183232280 22:36590501-36590523 CCTGATGGATGGAGCCTGCAGGG - Intronic
953954364 3:47219518-47219540 CCAGATGTTTTGACTCTGTTTGG + Intergenic
957241305 3:77664420-77664442 GCAGATCTTTTGACCATGCAGGG - Intergenic
964140776 3:153396723-153396745 CCAGCTGTGGTGACCTTGCAGGG - Intergenic
965852095 3:173040330-173040352 GCCTATGTATTTACCCTGCAAGG + Intronic
967767969 3:193303103-193303125 CCAGATGTGGAGACCTTGCAGGG - Intronic
968452510 4:681997-682019 CCAGGTTTATTGACCCGGCTGGG - Exonic
973981672 4:56313376-56313398 CCAGGTGTGTAGAGCCTGCACGG + Exonic
977565685 4:98578243-98578265 ACAGATGTGTTGGCTCTGCAGGG - Intronic
979959692 4:127002375-127002397 CCAGATGTCTTCACCATGTAGGG + Intergenic
981753621 4:148117956-148117978 CCAGATGTTAAGAGCCTGCAAGG - Intronic
984979038 4:185259915-185259937 CCAGCTGTATTGCCCCTTCCTGG + Intronic
985031312 4:185793629-185793651 CCAGAGGTATTGACCAAACAAGG - Intronic
988666841 5:33338304-33338326 CCAGAAGTATATACACTGCAAGG - Intergenic
991037266 5:62140384-62140406 CTATATGTATTAACCCTGCCTGG - Intergenic
992262763 5:74987415-74987437 CCAGCTGTATTTACCTTGGATGG + Intergenic
993893708 5:93505604-93505626 CCAGTGGTATTGAGCCTGCAAGG - Intergenic
994482770 5:100357074-100357096 CCAGATGTAATGGCTCTGCTAGG + Intergenic
1004050514 6:12073600-12073622 CTAGATGTGTTGACCCTTAAAGG - Intronic
1004264337 6:14135812-14135834 CCAGATGAAAAGACCCTGCTGGG - Exonic
1008716641 6:54296479-54296501 CCAGATGCATTTACCCTAAAAGG - Intergenic
1023239159 7:38124051-38124073 CCAGGTGCATTGGCCCTGCATGG - Intergenic
1030627595 7:111860688-111860710 CAAGAAATGTTGACCCTGCAGGG - Intronic
1033236271 7:139640346-139640368 CCAGATCATATGACCCTGCAGGG + Intronic
1037316154 8:17601322-17601344 CCAGAGGCACTGAGCCTGCAGGG + Intronic
1049256597 8:141617391-141617413 CCACATGTGTTGAGCCTGCTTGG - Intergenic
1050317282 9:4415311-4415333 CCTGATGTATTTACCCTGCCAGG - Intergenic
1051518162 9:17953932-17953954 CCAGACATATGGACCCTTCAAGG - Intergenic
1055335430 9:75228988-75229010 TCAGGTGCATTTACCCTGCAGGG - Intergenic
1186821019 X:13288054-13288076 CCATATATATTGACCTTGTATGG + Intergenic
1196253182 X:113485940-113485962 CCAGATGTATTGGAGCTGCTTGG + Intergenic
1196795924 X:119501853-119501875 CCTGAAGTAGTGACCGTGCATGG + Intergenic
1199871468 X:151902277-151902299 CCAGTGGCACTGACCCTGCAGGG + Intergenic