ID: 1079154370

View in Genome Browser
Species Human (GRCh38)
Location 11:17930771-17930793
Sequence GGTGAAATGAGACCTGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079154370_1079154374 5 Left 1079154370 11:17930771-17930793 CCTTATTCAGGTCTCATTTCACC 0: 1
1: 0
2: 1
3: 13
4: 243
Right 1079154374 11:17930799-17930821 TAAATCGAAGGGATTAGACTAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1079154370_1079154376 19 Left 1079154370 11:17930771-17930793 CCTTATTCAGGTCTCATTTCACC 0: 1
1: 0
2: 1
3: 13
4: 243
Right 1079154376 11:17930813-17930835 TAGACTAGGATAGTGTCTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 73
1079154370_1079154371 -7 Left 1079154370 11:17930771-17930793 CCTTATTCAGGTCTCATTTCACC 0: 1
1: 0
2: 1
3: 13
4: 243
Right 1079154371 11:17930787-17930809 TTTCACCATCTGTAAATCGAAGG 0: 1
1: 1
2: 5
3: 117
4: 668
1079154370_1079154375 18 Left 1079154370 11:17930771-17930793 CCTTATTCAGGTCTCATTTCACC 0: 1
1: 0
2: 1
3: 13
4: 243
Right 1079154375 11:17930812-17930834 TTAGACTAGGATAGTGTCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 99
1079154370_1079154372 -6 Left 1079154370 11:17930771-17930793 CCTTATTCAGGTCTCATTTCACC 0: 1
1: 0
2: 1
3: 13
4: 243
Right 1079154372 11:17930788-17930810 TTCACCATCTGTAAATCGAAGGG 0: 1
1: 0
2: 3
3: 43
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079154370 Original CRISPR GGTGAAATGAGACCTGAATA AGG (reversed) Intronic
900850904 1:5142282-5142304 GGTTAAATCAGTCCTGAATTTGG + Intergenic
901244996 1:7723201-7723223 GGGGAAATGAGAGATGAATCTGG + Intronic
905320313 1:37111573-37111595 AGTGACATGTGAACTGAATAAGG + Intergenic
908802068 1:67890715-67890737 GGTGGAAAGAGAACTGGATAGGG - Intergenic
908930063 1:69307124-69307146 CGTGAAATGATACCTCATTATGG + Intergenic
909136803 1:71811411-71811433 GGTGACATTGGATCTGAATAAGG - Intronic
909697374 1:78483119-78483141 GGTGAAATGTGTCTTGATTAAGG + Intronic
911871255 1:103102480-103102502 GGGGAAATGTGACCTGAGTTGGG - Intronic
912409953 1:109474003-109474025 AGTGAAAGGAGACCTGAACTAGG - Intronic
913364632 1:118023408-118023430 GGACAAATAAGACCTGAATTGGG + Exonic
915423428 1:155803964-155803986 GGTGAAATGAAACCAGACTTTGG - Intronic
915612775 1:157008056-157008078 GGGCAACTGAGAACTGAATAGGG - Intronic
917620271 1:176788436-176788458 GGTGTAATGAGACTAGAAAATGG + Intronic
918455610 1:184709787-184709809 GATTAAAGGATACCTGAATATGG + Intronic
920952462 1:210585390-210585412 GGGGAAAAGAGACCTCAGTATGG + Intronic
1062792408 10:316897-316919 GGAGAAAAGAGACCTGTATGTGG - Intronic
1062828908 10:591989-592011 TGTGAAATGACACTTGAATATGG - Intronic
1063016495 10:2083278-2083300 CGTGAAATGAGTCCTGAAGCAGG + Intergenic
1064988842 10:21238096-21238118 GGTAAAATCAGACCAGAACAAGG - Intergenic
1066545275 10:36492924-36492946 GGTGAAGTGAGATGTGAATTTGG - Intergenic
1067566882 10:47345978-47346000 GGTGACATGAGACCTTGATCAGG - Intergenic
1068437349 10:57009701-57009723 GGTGAAATGAGGGATGACTAGGG - Intergenic
1072208746 10:93227065-93227087 GGGGAAGGGAGACATGAATATGG + Intergenic
1072417642 10:95262507-95262529 GCAGAAATGAGACCTGCATGAGG + Intronic
1072519284 10:96215983-96216005 GGCGGACTGAAACCTGAATATGG + Intronic
1072847849 10:98852274-98852296 GGTGAAAGGAGGACTGGATAAGG - Intronic
1073544500 10:104337355-104337377 TGTGAAATGAGACCAGTATCTGG + Intronic
1075091929 10:119448600-119448622 GGTGAAATGAGAACTGAATGGGG + Intronic
1077632219 11:3818466-3818488 GGTAAAATGAGGCCAGAAGATGG + Intronic
1078133583 11:8634113-8634135 GGTGAACTGGGACCCGGATAGGG + Intronic
1079154370 11:17930771-17930793 GGTGAAATGAGACCTGAATAAGG - Intronic
1079317984 11:19426101-19426123 GGTGAAAGGAGACATGAGTTTGG + Intronic
1079535762 11:21513247-21513269 TGTGAAATAATACCTGAGTAAGG + Intronic
1079711575 11:23689920-23689942 GGAGATCTGAGACCTGAATGAGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081301237 11:41454654-41454676 AGTGAAATGACATCTGAAAAGGG + Intronic
1087676937 11:101174597-101174619 GGTAAGATGAGAACTGAAAAAGG + Intergenic
1090262587 11:125332119-125332141 GATGAAAAGAGACAGGAATAAGG - Intronic
1091151731 11:133335327-133335349 GTTGAAATGAGAACTGGATTTGG - Intronic
1092406329 12:8224294-8224316 TGTGAATTCAGAGCTGAATAAGG + Intronic
1092705166 12:11275283-11275305 GCTGAAATCAGACATGAAGAGGG - Intergenic
1092709563 12:11320911-11320933 GCTGAAATCAGACATGAAGAGGG - Intergenic
1092897691 12:13029174-13029196 GCTGAAATGGGACCTGGGTAGGG + Intergenic
1093405524 12:18799750-18799772 AGTGAAATGAGACTTGAACTAGG - Intergenic
1095361990 12:41353528-41353550 GTTGTAATGAGACATGAATTTGG + Intronic
1097936074 12:65252851-65252873 TGTGAGCTGAAACCTGAATAAGG - Intergenic
1098483109 12:70988605-70988627 CTGGAAATGAAACCTGAATAAGG + Intergenic
1099921292 12:88960342-88960364 GCTGAAATGAGAACTCAATGAGG + Intergenic
1100862112 12:98817305-98817327 GATGAAATGAGACCTGTCAAAGG + Intronic
1100971825 12:100079176-100079198 GCTGAAAAGATACCTGAATGTGG + Intronic
1104707824 12:130960892-130960914 TGTGAACTGAGACCTGAATCAGG + Intronic
1106181925 13:27376691-27376713 GGTGAACAGAGACCTGGAAATGG - Intergenic
1108054912 13:46475915-46475937 GGTGAAATGAGTCATGAAAGCGG - Intergenic
1108166595 13:47699658-47699680 GGTGAGATAAGAGCAGAATAGGG + Intergenic
1108182267 13:47852875-47852897 GCTGAGCTGAGACCTGAATCTGG + Intergenic
1110838623 13:80114575-80114597 GGTGAGATGATACCTCATTATGG + Intergenic
1111340669 13:86881815-86881837 GGTGAATTGTGACCTGACTAAGG + Intergenic
1111609395 13:90583769-90583791 AATGAAATGAGACATGCATAAGG + Intergenic
1112193620 13:97202990-97203012 GGTGGAAGGAGACCTGAAGGAGG - Intergenic
1114231637 14:20788298-20788320 GGTAAAATTGGACATGAATATGG - Intergenic
1116235280 14:42271987-42272009 GCTGAAAAGATACCTGAAAATGG + Intergenic
1119507461 14:75185370-75185392 GGTGAAAGGAGAGCAGAAGAAGG - Intergenic
1121432271 14:93896045-93896067 GGTTACATGTGACCTGAACAGGG + Intergenic
1121861452 14:97322626-97322648 GGTGAAAAGAGACTTGCTTAGGG - Intergenic
1123714511 15:23016622-23016644 GGTGAAATGATACCTCATTGTGG - Intronic
1126156137 15:45567275-45567297 GGGGAAATGAGAGTTGATTATGG - Intergenic
1126861982 15:52893926-52893948 GTTGAAATGATACCTGACTTGGG + Intergenic
1127864732 15:63023061-63023083 TGTGAAATGAGAGATGAAGAAGG - Intergenic
1127979037 15:64020872-64020894 GCAGAAGTGAGACCTGAATGTGG - Intronic
1129639585 15:77361513-77361535 GGTGAGATGATACCTCAATGTGG - Intronic
1130360874 15:83184769-83184791 GATGAAATGAGATGTCAATATGG + Intronic
1131621890 15:94077366-94077388 CGTCAAAGGACACCTGAATAAGG - Intergenic
1132286849 15:100669598-100669620 GGTAAAGTGAGCCCTGAATGAGG + Intergenic
1132925534 16:2427442-2427464 GGAGGAATGAGAGCTGGATATGG - Intergenic
1135874197 16:26182415-26182437 AGTGAGCTGAGTCCTGAATAAGG + Intergenic
1136577585 16:31133551-31133573 GCTGCCATGAGACCTGAATTAGG - Intronic
1137650679 16:50117548-50117570 GGTGAAATGATGCCTCATTACGG - Intergenic
1141428103 16:83956640-83956662 TGTGAAATGGGACATTAATATGG + Intronic
1143090035 17:4444714-4444736 GGTGAGATGGGAACTGAATGCGG - Intronic
1144305830 17:13968629-13968651 AAAGAAATGAGACCAGAATATGG - Intergenic
1147817767 17:43222488-43222510 GGTGGCATGAGGACTGAATATGG - Intergenic
1148256309 17:46135604-46135626 GCTGAAATGAGCCATGATTATGG - Intronic
1150414109 17:64973584-64973606 GGAGAAATCAGAGCTGTATATGG - Intergenic
1150607922 17:66710188-66710210 GGTCAAATGAGACCTGCACCTGG + Intronic
1152026284 17:77811541-77811563 GGTGAAGTGAGCCCCGAATTTGG - Intergenic
1156549190 18:37997453-37997475 GGTTATAAGACACCTGAATAAGG + Intergenic
1158275594 18:55763877-55763899 GGTTAAATGAAACATGAAAAAGG + Intergenic
1158880450 18:61774285-61774307 GGTGAAAAGAGAACTGGATTGGG - Intergenic
1160082348 18:75740583-75740605 GAGGAAATGAGACCTGGACATGG - Intergenic
1160409620 18:78666974-78666996 GGAGAAATGAGAACTGGGTAGGG + Intergenic
1161318333 19:3629371-3629393 GCTGAACTGGGACCTGAAGAAGG + Intergenic
1165130007 19:33626007-33626029 AGTCAGATGAGCCCTGAATATGG - Intronic
1165197554 19:34116774-34116796 GGGGAAATGAGACTTGAGCAAGG - Intergenic
1166900070 19:46053820-46053842 GGTGAGATGATACCTCATTATGG + Intronic
1167385741 19:49162178-49162200 AGTCAGATGAAACCTGAATAAGG + Intronic
925373436 2:3363952-3363974 GGTGAAATGAAATCTCATTATGG - Intronic
926431297 2:12788242-12788264 AGTGGAATGAGACCTGGATATGG + Intergenic
927225377 2:20759940-20759962 GGTCAGATGAGATTTGAATATGG + Intronic
928248012 2:29648439-29648461 GGTGAAAAGAGTTCTGAAGATGG - Intronic
929898660 2:45983252-45983274 GGTGAAATGAGAGCTGGAAAGGG - Intronic
929951862 2:46417345-46417367 TGTGGAATGAGACCTCAACAAGG + Intergenic
930756009 2:54973855-54973877 AGTGAAATGAGAGCTGAAAAGGG + Exonic
931788970 2:65646501-65646523 GGTGAAATGACACCTGTTGATGG + Intergenic
933593773 2:84261928-84261950 GGTGAAATGATACCTCATTGTGG - Intergenic
933943044 2:87260957-87260979 GGTGAAGGGAGACCTGACCATGG + Intergenic
934487056 2:94725361-94725383 GGAGAGAAGAGACCTGGATATGG - Intergenic
935265640 2:101391581-101391603 TCTGAAAAGAGACCTGAAGAAGG - Intergenic
936337169 2:111600605-111600627 GGTGAAGGGAGACCTGACCATGG - Intergenic
936348118 2:111690681-111690703 GGAGAACTGAGACTTGAATCTGG - Intergenic
936764166 2:115825292-115825314 GAGGAAACGACACCTGAATAGGG - Intronic
940232037 2:151465731-151465753 GTTGAAATGAGCACTGAAGAAGG + Exonic
941117237 2:161486344-161486366 GGTGAAATGATACCTAACTGTGG - Intronic
941421671 2:165290670-165290692 TGTAAAGTAAGACCTGAATATGG + Intronic
941700194 2:168596286-168596308 TGTGGAATGGGACCTCAATAGGG + Intronic
942360858 2:175169998-175170020 CATGGAATCAGACCTGAATATGG - Intergenic
943674197 2:190700959-190700981 AGGGAAATGAGACCTGAACTAGG - Intergenic
947537625 2:230950764-230950786 GGTGAAAGGAGAGCTGGAGAAGG - Intronic
948124686 2:235556108-235556130 GGGGCACTGAGACCTGAAGAAGG + Intronic
948890756 2:240905952-240905974 GGTGGACTGAGACCTGGAGAGGG - Intergenic
1170036073 20:11991460-11991482 TGTGAAGTGAGACCTGGAGAAGG + Intergenic
1170376915 20:15710143-15710165 GGTGAAATGATACCTCATTGTGG - Intronic
1175537879 20:59727927-59727949 CGTGGAATGAGACATGAAAAGGG + Intronic
1177615810 21:23517578-23517600 GGGTAAATGAATCCTGAATATGG - Intergenic
1179470391 21:41606228-41606250 GGTGAGGTCAGACCTGAGTAGGG + Intergenic
1180634459 22:17253366-17253388 GGTAAAATGAGAAATGAACACGG + Intergenic
1180907876 22:19428174-19428196 AGTGAAATGAGCCTTGAATGTGG - Intronic
1181770315 22:25120362-25120384 GGTGAAAGGAGACCTGAAATTGG - Intronic
1181923168 22:26336396-26336418 GGGGAAATGAGACAAGAAGAAGG - Intronic
1183054127 22:35291486-35291508 AGTGAAAAGAGACCAGAATTGGG + Intronic
1183811809 22:40264027-40264049 GATGAAATGACACTTGAATTGGG + Intronic
949380640 3:3441606-3441628 GATGAAAAGAGTCCTGAAGATGG + Intergenic
951369558 3:21828920-21828942 AGTGAAAGGAGACATGAAGATGG - Intronic
951691282 3:25399039-25399061 AGTGAAAAGAGCCCTGAATTTGG - Intronic
951982272 3:28578258-28578280 GGTGAAAAGAGAACTGAAAGCGG + Intergenic
952615067 3:35261044-35261066 GAGGAGATGAGGCCTGAATAGGG + Intergenic
953610878 3:44446284-44446306 TGTGGAAGGAGACCTGAATAGGG + Exonic
956568876 3:70671892-70671914 TGTCAAATGAGAACTGAATATGG + Intergenic
957034576 3:75281928-75281950 GATGAAATGATACCTCATTACGG - Intergenic
958457445 3:94349211-94349233 GAGGAAGTGAGACCTAAATATGG - Intergenic
958938618 3:100285765-100285787 TGTGAAATGATACCTCATTATGG + Intronic
962282963 3:134066088-134066110 GGTGAAAAGAGACCTGTTCAGGG - Intronic
964400909 3:156297332-156297354 GGTGAAAAGAGATTGGAATATGG + Intronic
964529431 3:157651383-157651405 GGTGAACTGAGGCCTGAGGAAGG + Intronic
964561118 3:157997674-157997696 AGTGAAATGAGTACTGAACAAGG - Intergenic
965486710 3:169286868-169286890 GAGGAAATGAGATCAGAATAAGG - Intronic
965926203 3:173983717-173983739 CTTGAACTGAGACCTGAATGAGG - Intronic
967349616 3:188498288-188498310 GATGAAATGAGTTCTGAAGATGG - Intronic
967424221 3:189307634-189307656 GGTGAAAAGACCCCTGAATGAGG + Intronic
969404689 4:6982681-6982703 GGTGAAATGACAGTTGTATAAGG + Intronic
969759799 4:9173689-9173711 TGTGAATTCAGAGCTGAATAAGG - Intronic
970044447 4:11835133-11835155 GGTAAACTGAGACCTAAATCAGG + Intergenic
970293348 4:14601198-14601220 TATGAAATGACACCTGTATAGGG - Intergenic
971636683 4:29069287-29069309 GGTGAGATGATATCTCAATAAGG + Intergenic
972699587 4:41481353-41481375 GGTGAAAGGAGAACTGAGTCTGG + Intronic
974604293 4:64130480-64130502 GGTGAAATAAGTCATTAATAAGG + Intergenic
974856897 4:67471668-67471690 GGTTAAATAAGACCTGAAAAGGG + Intergenic
975357943 4:73430340-73430362 GGTGAACTAAGACATCAATACGG - Intergenic
975442397 4:74426592-74426614 GGAGAAATGATACCTGGAAAGGG - Intergenic
975795281 4:78000483-78000505 GCTTAGATGGGACCTGAATAGGG - Intergenic
977730420 4:100344518-100344540 GGTGAAAAGAGTCCTGGAGATGG + Intergenic
977891727 4:102319700-102319722 GGGGAAAAGAGACCTCAGTATGG - Intronic
980272189 4:130599077-130599099 GGTCAAATGATACCTGCATCAGG + Intergenic
980745657 4:137010910-137010932 GGTGAAATGGGAGCTGAAGTGGG - Intergenic
983714258 4:170757466-170757488 AGTGAAATGATATCTTAATATGG + Intergenic
984193079 4:176627397-176627419 GTTAAAGTGAGACCTGAATATGG - Intergenic
986227138 5:5826435-5826457 GGAGGAATGAGACCAGAAAAGGG + Intergenic
988851597 5:35186521-35186543 GGTAAACTGAGGCCTCAATAAGG - Intronic
990489325 5:56288602-56288624 CGAGAAGTGAGACCTGAAGATGG + Intergenic
991478515 5:67050277-67050299 GGTGAAATGAGGACTGAAAGAGG - Intronic
991932904 5:71772171-71772193 GGTGACAAGACACTTGAATATGG - Intergenic
991976685 5:72190082-72190104 GGTCAAATGACTCCTGAATAGGG - Intronic
992666485 5:79014542-79014564 GAAGAAATGAGGCCTCAATAGGG + Intronic
992878037 5:81076986-81077008 GGTGAAGTGAGAAAAGAATAAGG + Intronic
994721819 5:103389446-103389468 TGTGAAATGACACCAGAATCTGG - Intergenic
996105522 5:119497417-119497439 GGTAGAATGAGAACTGTATATGG - Intronic
996975880 5:129434099-129434121 GGTGATATGAGGCCAGAATGAGG - Intergenic
1003811490 6:9787874-9787896 GGAGGAATGGAACCTGAATATGG - Intronic
1004015687 6:11729768-11729790 TTTGAAATGAGACCTAGATATGG + Intronic
1005247228 6:23901291-23901313 TGTGAAATGAAACCAGAGTAAGG - Intergenic
1005659282 6:27978036-27978058 GGTGAAAGGAGCACTGAAGAAGG + Intergenic
1006425929 6:33962992-33963014 GGAGAAATGAGGCCTGAGGAGGG - Intergenic
1007180350 6:39925253-39925275 TGTGAACAGAGACCTGAATGAGG + Intronic
1007960735 6:45956765-45956787 GGAAAAGTGAGAACTGAATAGGG - Intronic
1008458393 6:51738861-51738883 TTTCAAATGAGACCTGAATGGGG - Intronic
1010636198 6:78261540-78261562 GCTGAAAAGATACCTGAAAATGG - Intergenic
1011951690 6:92974762-92974784 GGTGATATGATACCTCATTATGG - Intergenic
1015455084 6:133417427-133417449 AGTGAAAGAGGACCTGAATAGGG + Intronic
1015625490 6:135177560-135177582 GGTGAAAACAGACCAGATTAGGG - Intergenic
1022240235 7:28504251-28504273 GCTGAAATTAGACCTGAAGATGG + Intronic
1022487370 7:30790119-30790141 GATGAAATGAGACCTGTGCAAGG - Intronic
1023483783 7:40662648-40662670 TATGAAATGAGACCTGAAAGAGG - Intronic
1027958414 7:84912692-84912714 AGTGAAATAAAATCTGAATATGG - Intergenic
1031451964 7:121932472-121932494 GGTGAAACTAGAACTGAATGTGG - Intronic
1031942484 7:127803666-127803688 GGTAAAATTAGGCCTGAATGGGG + Intronic
1032761937 7:134951580-134951602 GGTGAAATGTGACTTGGAAAGGG + Intronic
1034231770 7:149535141-149535163 GGGGAAATGAGAGCAGAAAAAGG + Intergenic
1034959332 7:155355297-155355319 AGTGAAATGGGACCTGAAGCAGG - Intergenic
1035531304 8:353603-353625 TTTGTAATGAGACATGAATACGG - Intergenic
1036263394 8:7257420-7257442 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036264697 8:7265042-7265064 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036265996 8:7272664-7272686 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036267298 8:7280286-7280308 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036268601 8:7287908-7287930 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036269905 8:7295530-7295552 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036297989 8:7551524-7551546 TGTGAATTCAGAGCTGAATAAGG + Intergenic
1036299294 8:7559173-7559195 TGTGAATTCAGAGCTGAATAAGG + Intergenic
1036300599 8:7566822-7566844 TGTGAATTCAGAGCTGAATAAGG + Intergenic
1036301903 8:7574467-7574489 TGTGAATTCAGAGCTGAATAAGG + Intergenic
1036303200 8:7582116-7582138 TGTGAATTCAGAGCTGAATAAGG + Intergenic
1036315438 8:7715959-7715981 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036316746 8:7723607-7723629 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036318053 8:7731255-7731277 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036319360 8:7738903-7738925 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036320669 8:7746550-7746572 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036321979 8:7754198-7754220 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036323288 8:7761846-7761868 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036324583 8:7769493-7769515 TGTGAATTCAGAGCTGAATAAGG - Intergenic
1036351451 8:8014814-8014836 TGTGAATTCAGAGCTGAATAAGG + Intergenic
1036352757 8:8022460-8022482 TGTGAATTCAGAGCTGAATAAGG + Intergenic
1036354048 8:8030108-8030130 TGTGAATTCAGAGCTGAATAAGG + Intergenic
1036846708 8:12175233-12175255 TGTGAATTCAGAGCTGAATAAGG + Intergenic
1036868074 8:12417552-12417574 TGTGAATTCAGAGCTGAATAAGG + Intergenic
1037766904 8:21777752-21777774 AGTGAAAAGGGACCTGGATAAGG + Intronic
1037904522 8:22707801-22707823 GGAGAAATGAGAGTTGAAAATGG - Intergenic
1038130875 8:24730001-24730023 AGTGGAATGAGAGCTGAATGCGG - Intergenic
1038298449 8:26318952-26318974 GATGAAAAGAGTCCTGGATATGG - Intronic
1038492137 8:27979023-27979045 GGTGGAATTAGACCTGACCAGGG - Intronic
1040429680 8:47327147-47327169 TGTGAAATGATACCTTATTAAGG + Intronic
1040725240 8:50374972-50374994 GGTGTAATGTGTCCTGGATAAGG + Intronic
1041324404 8:56649705-56649727 GGGTAAATGGGTCCTGAATATGG - Intergenic
1043305428 8:78787684-78787706 GGGGAAATGACCCCTAAATATGG - Intronic
1044392378 8:91666536-91666558 ATTGGAATGATACCTGAATAAGG - Intergenic
1046301656 8:112301447-112301469 GGTGAAAAGAGAATTGACTATGG + Intronic
1046777565 8:118180116-118180138 GCTGAAATGACACCTGCACAGGG + Intergenic
1051470221 9:17431253-17431275 GGTGAGATGATACCTCAATGTGG + Intronic
1052827716 9:33189070-33189092 GGTGACGTTAGACCTGAATCTGG + Intergenic
1053604551 9:39643856-39643878 AGTGAAATAAGATTTGAATATGG + Intergenic
1054248992 9:62698558-62698580 AGTGAAATAAGATTTGAATATGG - Intergenic
1054563102 9:66733091-66733113 AGTGAAATAAGATTTGAATATGG - Intergenic
1054931958 9:70644407-70644429 CCTGAAATGAGGGCTGAATATGG + Intronic
1055815447 9:80199676-80199698 TTTGAACTGAGACCTGAATGAGG - Intergenic
1056331480 9:85524614-85524636 AGAGCAATGAGAACTGAATATGG - Intergenic
1058348222 9:103990303-103990325 GGTGAAATTGGCCCTTAATATGG + Intergenic
1059753078 9:117267268-117267290 GGAGACATGAGAGCTAAATATGG + Intronic
1059934097 9:119290595-119290617 GGAGAGATGAAAACTGAATATGG + Intronic
1186017886 X:5218449-5218471 GGATAAATGAGAGATGAATATGG - Intergenic
1186884173 X:13896277-13896299 AGAGAAATGAGACCTCCATATGG + Intronic
1187208515 X:17206156-17206178 GGTGAAATCAGACTTGAGTCTGG - Intergenic
1188527139 X:31098962-31098984 TGTCAAATGAGACTTGAAGAAGG - Intronic
1189101636 X:38196715-38196737 GGGGAAATGAGAAAGGAATAGGG + Intronic
1190599864 X:52079696-52079718 GATCAAATGAGGCCTAAATAAGG + Intergenic
1192163515 X:68807816-68807838 ATTGAACTGAGACCTGAATGAGG + Intergenic
1193072942 X:77325765-77325787 GGTGAGATGATATCTCAATATGG - Intergenic
1195377491 X:104241927-104241949 GGTAAAACGAGTCATGAATATGG - Intergenic
1196553159 X:117054720-117054742 GAGGAAATGAGACCTGAACTTGG - Intergenic
1196579289 X:117360730-117360752 GCTGAAAAGATACCTGAAAATGG + Intergenic
1197770804 X:130088008-130088030 TGTGGAATGAGAACTTAATATGG + Intronic
1199409264 X:147501404-147501426 GGTGAAATGATATCTTAATGTGG - Intergenic