ID: 1079156096

View in Genome Browser
Species Human (GRCh38)
Location 11:17949354-17949376
Sequence GGTCAGTGTAAACAACAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079156090_1079156096 11 Left 1079156090 11:17949320-17949342 CCCAATGGAGCCTGGCAAAGAGA 0: 1
1: 0
2: 2
3: 15
4: 171
Right 1079156096 11:17949354-17949376 GGTCAGTGTAAACAACAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1079156088_1079156096 24 Left 1079156088 11:17949307-17949329 CCAATATAAAGTACCCAATGGAG 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1079156096 11:17949354-17949376 GGTCAGTGTAAACAACAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1079156091_1079156096 10 Left 1079156091 11:17949321-17949343 CCAATGGAGCCTGGCAAAGAGAG 0: 1
1: 0
2: 0
3: 24
4: 212
Right 1079156096 11:17949354-17949376 GGTCAGTGTAAACAACAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1079156093_1079156096 1 Left 1079156093 11:17949330-17949352 CCTGGCAAAGAGAGGCTTAATTC 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1079156096 11:17949354-17949376 GGTCAGTGTAAACAACAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079156096 Original CRISPR GGTCAGTGTAAACAACAAGG AGG Intronic
906749836 1:48248954-48248976 GGTCAATGAAAACAAAAATGTGG - Intergenic
907090096 1:51715646-51715668 TGTCAGTCTAACCAACAATGGGG - Intronic
907249677 1:53129837-53129859 GGTCAGTGTGAAAGACAAGGGGG + Intronic
907550621 1:55301768-55301790 GGCCAGTGTACTCAACAATGAGG + Intergenic
907673103 1:56493865-56493887 GGTCTGTGTAATCAGCAAGGAGG + Intergenic
910365109 1:86456781-86456803 GATCAGTATAAACTGCAAGGAGG - Intergenic
912654163 1:111470576-111470598 GGTCAGGCTACACAATAAGGAGG - Intergenic
913101866 1:115574763-115574785 GGTCAATTTAAAGAAGAAGGAGG - Intergenic
916304950 1:163319895-163319917 GGTCAGTGTAAGGTAGAAGGTGG - Intronic
917973046 1:180220567-180220589 GGTCAGGGTCAACTGCAAGGGGG + Intergenic
918149030 1:181782400-181782422 GGTCAGTCTAAATAGCAAAGGGG - Intronic
919516973 1:198537776-198537798 TATCAGTGTAAACATCAAAGTGG + Intronic
919586832 1:199449356-199449378 GGTCAGAGTGAATAACGAGGAGG + Intergenic
920127883 1:203708176-203708198 AGGCAGTGTAAACAATAAGGGGG - Intronic
1065673019 10:28142844-28142866 GGTCTGTCTTAACAACAAGCTGG + Intronic
1066050465 10:31630929-31630951 GGTCATTGTAAAACATAAGGAGG - Intergenic
1070701157 10:78602602-78602624 GGGTTGTGGAAACAACAAGGAGG - Intergenic
1072617200 10:97057869-97057891 GGACAGTGAAAACATCCAGGAGG + Intronic
1074685205 10:115955586-115955608 GGTCAGTGTGGGCAGCAAGGGGG - Intergenic
1074837632 10:117313394-117313416 GGACACTGTAAAAAACAAGCAGG - Intronic
1075193942 10:120338326-120338348 AGTCGGTGTAAACAGCAAAGAGG - Intergenic
1075645816 10:124095324-124095346 GGTCTGTGGAAACAGCAAGGAGG + Intergenic
1078371963 11:10755151-10755173 GGCCATTGTATACAACAAGGTGG - Exonic
1079156096 11:17949354-17949376 GGTCAGTGTAAACAACAAGGAGG + Intronic
1080519693 11:33057089-33057111 GGGCAGTGAAAAAAAAAAGGAGG - Intronic
1084308086 11:68299492-68299514 GCTCAGTGTAGACAGCAGGGTGG + Intergenic
1085473296 11:76771837-76771859 GGTGAGTGCTTACAACAAGGTGG - Intergenic
1087093654 11:94300068-94300090 GGTCACTATAAACTAAAAGGAGG + Intergenic
1088347278 11:108841276-108841298 GGTCAGTGTCAACAGGAAGTAGG - Intronic
1091543224 12:1481843-1481865 GGAGGGTGTAAACAAGAAGGGGG - Intronic
1091961520 12:4699131-4699153 GGTCACTGAAAACACCAAGTAGG - Intronic
1096028099 12:48385875-48385897 GGTCAATGCAACCAACAAGATGG - Intergenic
1096089868 12:48891692-48891714 GGTTATTGTAAAAACCAAGGAGG + Intergenic
1098594467 12:72255770-72255792 GGTAACTGTAAACAAGAAAGGGG + Intronic
1102636054 12:114325053-114325075 GGGCAGTGAAAACTCCAAGGGGG + Intergenic
1103855283 12:123964266-123964288 TGTCTGTATTAACAACAAGGAGG + Intronic
1104287400 12:127436988-127437010 TGCCAGTGTAAACAAGAAGGAGG - Intergenic
1104447817 12:128847072-128847094 GGTCAGTGTGGAGAAGAAGGAGG + Intergenic
1105330869 13:19414022-19414044 AGACAGTGTAGACAGCAAGGAGG + Intergenic
1108491979 13:50991228-50991250 GGTGATTGTAAAGAACAAGCAGG + Intergenic
1112287305 13:98115731-98115753 GGTCCGAGCAAACAACAAGCCGG + Intergenic
1114636830 14:24192268-24192290 GGTCAGGGCATACAACAAGATGG + Exonic
1116464485 14:45215213-45215235 AATCAGTGTAAGCAAAAAGGGGG + Intronic
1126451335 15:48811947-48811969 GGTCAGTGTAGGCATCATGGGGG - Intergenic
1128308948 15:66618543-66618565 GTTCAGAGAAAATAACAAGGAGG - Intronic
1130309745 15:82742928-82742950 GGTCAGTGTAAACAGAGAGATGG + Intergenic
1133081097 16:3320847-3320869 GATCAGTGTAGACAGTAAGGTGG + Intergenic
1134795601 16:17033194-17033216 GTTCATTTTAAACAACATGGTGG + Intergenic
1138775098 16:59711878-59711900 GGTTTGAGTAAAAAACAAGGTGG - Intronic
1139554918 16:67701601-67701623 GCTAAGTGTAGACAACAAAGGGG + Intronic
1153105474 18:1521446-1521468 GGTCAGTGTGAATAACAGGCAGG - Intergenic
1154143470 18:11846173-11846195 GTTCAGTGTAAAGAAGGAGGAGG + Intronic
1159714275 18:71802268-71802290 AGTCATAGTACACAACAAGGTGG - Intergenic
1160345444 18:78128351-78128373 GGTCAGTGGAACAACCAAGGGGG - Intergenic
1161320727 19:3639728-3639750 GCTCAGTGAAAAGAACAAAGAGG - Intronic
927329394 2:21844149-21844171 GTTTAGTGTAAACACCATGGGGG + Intergenic
929418115 2:41764555-41764577 GGTGAGTATAAACAGCAAAGAGG + Intergenic
932213318 2:69949133-69949155 GGTCCGTGTGAACATCAAGCAGG - Intergenic
932527526 2:72487317-72487339 TGTCAGTGTAATCAAAAAGAAGG - Intronic
933450106 2:82438252-82438274 GGTCAAAGAAAACAACATGGGGG + Intergenic
935689792 2:105720456-105720478 GGTAAATAAAAACAACAAGGTGG + Intergenic
938616317 2:133002741-133002763 GGATAGCATAAACAACAAGGAGG - Intronic
940016760 2:149114561-149114583 GTTCAGTGTTAACATGAAGGGGG + Intronic
942455292 2:176134125-176134147 AGTCAGTGTAAGAAAGAAGGTGG - Intergenic
943311259 2:186327977-186327999 TTGCAGTGTAAACACCAAGGAGG + Intergenic
945029247 2:205648478-205648500 GGTAAGAGGAAAAAACAAGGAGG - Intergenic
946902402 2:224384833-224384855 GGTCAGGGTCACCAAGAAGGCGG - Intronic
1172241876 20:33418472-33418494 AGACAGTGTATACAAGAAGGTGG + Intronic
1180611371 22:17100372-17100394 GGTCAGGGTCAACCACAAAGTGG - Exonic
1181851692 22:25754322-25754344 GGTCAGTGTAATTGACAGGGAGG + Intronic
951975734 3:28506160-28506182 GTTGAGTGTAAAAAACAATGTGG - Intronic
953128523 3:40114735-40114757 GTTCAGTGTTAACAGGAAGGGGG + Intronic
954342732 3:49968572-49968594 GGTCTGTTTAAAGAAGAAGGCGG + Exonic
959333555 3:105036593-105036615 GGTCTGTGAAAGGAACAAGGAGG + Intergenic
959743045 3:109743233-109743255 TGTTAGTGTAAAGAATAAGGTGG - Intergenic
961309683 3:125988028-125988050 GGACAAGGAAAACAACAAGGGGG + Intergenic
962326767 3:134440871-134440893 GGTCACTGGAAAGACCAAGGCGG - Intergenic
965479856 3:169204939-169204961 GTTCAGTGTAGACAACAGTGTGG + Intronic
966702890 3:182875837-182875859 GGACAGTGTCAACAACATTGTGG + Intronic
969158457 4:5233786-5233808 GGTCCATGGAAACAACATGGAGG + Intronic
984050227 4:174856674-174856696 GGTCAATGTGAACAAAGAGGTGG - Intronic
985128004 4:186714332-186714354 GCTCAGCGTAGAGAACAAGGGGG + Intronic
985768729 5:1795858-1795880 GCTCAGGGGACACAACAAGGTGG + Intergenic
985979374 5:3449478-3449500 AGTCAGTATGAAGAACAAGGCGG + Intergenic
987093746 5:14530101-14530123 GGTCAATGTAAAAATCAATGTGG + Intronic
988197486 5:28024246-28024268 AGTCATTGTAAAAAACAATGAGG + Intergenic
994815359 5:104579894-104579916 GGTCAGTGTGAAAAAAAAAGAGG - Intergenic
1005864066 6:29925583-29925605 GGTAAATGTAAAAAACAAGCGGG + Intergenic
1007538362 6:42617224-42617246 GGTAATTCTAAACAACAAGGGGG - Exonic
1011047825 6:83106397-83106419 GTACATTGTAAATAACAAGGAGG + Intronic
1012448848 6:99333919-99333941 AGTCAATATAAACCACAAGGAGG + Intronic
1016656682 6:146526222-146526244 GGTCAGTGGGAAGATCAAGGGGG - Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1027376660 7:77557285-77557307 GCTCAGTGTGAACAACTATGAGG - Intronic
1035549226 8:507386-507408 GGTCAGAGTAAATATCAAGCAGG + Intronic
1038009139 8:23460057-23460079 AGTCAGTGGAAACAGCAAAGAGG + Intergenic
1038669665 8:29572487-29572509 GCTCAGTGGAAAGAACAAAGAGG - Intergenic
1042914051 8:73857225-73857247 GGTCAGAGTCATCAACAAGTAGG + Intronic
1046721164 8:117620620-117620642 GGCCAGTGTAGGCAACATGGCGG - Intergenic
1050286088 9:4103864-4103886 GGCCATTGAAAGCAACAAGGTGG - Intronic
1051535804 9:18156182-18156204 CCTCAGTGCAAACAACGAGGTGG + Intergenic
1057200602 9:93137763-93137785 GGTCAGTGTACAGAGCAGGGAGG + Intergenic
1058143904 9:101388710-101388732 GGTAAATTTAACCAACAAGGAGG - Exonic
1058162585 9:101585762-101585784 GGTTAGGGAAAACAACTAGGAGG - Intronic
1060028056 9:120189874-120189896 GGTCTGGGTAGAGAACAAGGAGG + Intergenic
1060898832 9:127239312-127239334 GGACAGTGAAAAAAACAAAGAGG + Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1190439154 X:50459906-50459928 GCTAAGTGTAAACAATAAAGAGG - Intronic
1194812322 X:98401499-98401521 GGTCAGTGTAAGAAACATAGTGG - Intergenic
1195345181 X:103943134-103943156 TGTCAGTGAAAACATCAAGTAGG - Intronic
1198691255 X:139287361-139287383 TTTCAGTGTACACAAAAAGGTGG - Intergenic
1200549085 Y:4555671-4555693 GGTCATTGTGAACAAAAATGAGG + Intergenic