ID: 1079158127

View in Genome Browser
Species Human (GRCh38)
Location 11:17967832-17967854
Sequence GGCTGACCAGCATTGTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079158127_1079158132 29 Left 1079158127 11:17967832-17967854 CCAGCTCACAATGCTGGTCAGCC 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1079158132 11:17967884-17967906 CAGCCTGTCTGTCCCACTTATGG 0: 1
1: 1
2: 1
3: 9
4: 180
1079158127_1079158129 5 Left 1079158127 11:17967832-17967854 CCAGCTCACAATGCTGGTCAGCC 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1079158129 11:17967860-17967882 CACCTGTCAGCCTGCAATGCTGG 0: 1
1: 0
2: 1
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079158127 Original CRISPR GGCTGACCAGCATTGTGAGC TGG (reversed) Intronic
900230038 1:1552050-1552072 GGCTGACCAGCGTTCCGACCCGG + Intronic
901068334 1:6505231-6505253 GGCTGACCGGCACTGTGGGCTGG - Intronic
903340827 1:22653251-22653273 GGCTGAGCAGCAGTGGGACCAGG - Exonic
903719033 1:25390740-25390762 GGAAGATCAGCATGGTGAGCAGG - Exonic
904009249 1:27380574-27380596 GGCTGAAAGGAATTGTGAGCAGG - Intronic
905664557 1:39755107-39755129 GGCTGACCAGCATCTGGAGGGGG - Intronic
906491280 1:46270764-46270786 AGCTCACCAGCATTGTGAATAGG + Exonic
912471045 1:109907119-109907141 GGCTGACCAGGTTTGGGAGCAGG - Intergenic
915259184 1:154663872-154663894 GGCTGAATAGCATATTGAGCTGG - Intergenic
915626607 1:157117802-157117824 GGCTGACCTGCATTCTGGGAAGG + Intergenic
923868351 1:237963985-237964007 GGCAGATCAGCAGTGTGAGAAGG + Intergenic
924530995 1:244893827-244893849 GGAAGAAAAGCATTGTGAGCTGG - Intergenic
1064133493 10:12730620-12730642 GGCTGACCAACATTAAGAGCTGG + Intronic
1065102232 10:22341560-22341582 GGCTGACCGGCATCTGGAGCAGG + Intergenic
1071320235 10:84448039-84448061 GGCTGACAAGCAGTCAGAGCTGG - Intronic
1072637868 10:97188803-97188825 GGCTGAGGAGCATTGTGGGATGG + Intronic
1074977644 10:118594521-118594543 GGATGACCAGCAGAGGGAGCAGG + Exonic
1076692484 10:132230848-132230870 AGCTGAGCTGCATCGTGAGCAGG - Intronic
1077906502 11:6538749-6538771 GGCTGCCCAGCTTAGTGAGCAGG - Exonic
1079158127 11:17967832-17967854 GGCTGACCAGCATTGTGAGCTGG - Intronic
1079175665 11:18137856-18137878 GGAAGACCAGCACTGTGAGGAGG - Exonic
1079179223 11:18173910-18173932 GGAAGACCAGCACTGTGAGCAGG - Exonic
1079181420 11:18197033-18197055 GGAAGAGCAGCACTGTGAGCAGG - Intronic
1079259391 11:18863828-18863850 GGAAGACCAGCACTCTGAGCAGG + Intergenic
1079261542 11:18887220-18887242 GGAAGACCAGCCCTGTGAGCAGG + Intergenic
1079266035 11:18934109-18934131 GGAAGACCAGTACTGTGAGCAGG + Exonic
1079269622 11:18972025-18972047 GGAAGACTAGCACTGTGAGCAGG + Intergenic
1079277497 11:19055706-19055728 GGAACACCAGCACTGTGAGCAGG + Exonic
1081384971 11:42460890-42460912 GTCTGACCAGCTTTCTGGGCTGG + Intergenic
1083756525 11:64794682-64794704 GGCGGAGCAGCCTGGTGAGCTGG - Intronic
1084961382 11:72718511-72718533 GGCTGAGCTGCATTTTGAGGTGG - Intronic
1085658595 11:78340891-78340913 GGCTGATCACCATTGTGATGAGG - Intronic
1086067130 11:82757344-82757366 GGCTGACAGGCATTATGGGCTGG + Intergenic
1089177103 11:116556997-116557019 CGCTTGCCAGCTTTGTGAGCTGG - Intergenic
1089710467 11:120310934-120310956 AGCTAACCAGCCTTGGGAGCTGG + Intronic
1093603171 12:21055765-21055787 GGCTGACCATGACTGTGATCAGG - Intronic
1095396551 12:41768662-41768684 GGCTGCCCAGCATTGTTGCCAGG - Intergenic
1095433696 12:42164348-42164370 GGCTGACCTTCTGTGTGAGCAGG + Intronic
1096177423 12:49531981-49532003 TGGCTACCAGCATTGTGAGCCGG - Intergenic
1098264701 12:68706640-68706662 TGCTGAGCAGCATGGGGAGCTGG + Intronic
1103715734 12:122944501-122944523 GGACCACCAGCAGTGTGAGCTGG + Exonic
1105304937 13:19161637-19161659 GCCTGACCACCATGGTGACCTGG - Intergenic
1108532586 13:51341482-51341504 GCCTGAGCAGCAGGGTGAGCTGG - Intronic
1109803920 13:67412640-67412662 GGATATCCAGAATTGTGAGCAGG + Intergenic
1116776423 14:49187311-49187333 TACTGCCCAGCATTGTGAGAGGG - Intergenic
1116862260 14:50003940-50003962 GGCGCACCAGCAGTGTGACCTGG - Intronic
1118723622 14:68611033-68611055 TGCTGACCAGCATTCTGACCTGG - Intronic
1119514948 14:75240679-75240701 GGCTGATCACCATGGTGAGATGG - Intronic
1119975951 14:79023896-79023918 GGGTGCCCAGCATTGTAAGAAGG + Intronic
1120119692 14:80664098-80664120 GGCTGAACCGCAATGTGAGGTGG - Intronic
1127950655 15:63802493-63802515 GGTTGATCAGGATTGTGAACTGG - Intronic
1131426861 15:92352753-92352775 GGCTAACATGCATTGTGAACTGG - Intergenic
1133046694 16:3092130-3092152 GGCTGCCCAGCCTGCTGAGCCGG - Exonic
1136577299 16:31132267-31132289 ACCTGACGGGCATTGTGAGCTGG - Exonic
1138937515 16:61747338-61747360 GGCTTACAAGCATCTTGAGCAGG - Intronic
1139596503 16:67961450-67961472 GGGTGCCAAGCATAGTGAGCAGG - Intronic
1141016679 16:80457391-80457413 GGCTGAGCTGAATTGGGAGCAGG + Intergenic
1141441675 16:84033374-84033396 GGATGACCAGCACGGAGAGCAGG + Exonic
1142737768 17:1912383-1912405 GGGTGAACAGCATTGCAAGCAGG + Intergenic
1142979184 17:3661811-3661833 GGCACACCAGCACTGGGAGCGGG + Intergenic
1144090593 17:11852509-11852531 GCCTGACCATCACTCTGAGCTGG + Intronic
1144531568 17:16044214-16044236 TGCTGACCAGAATTGTTATCAGG - Intronic
1144970624 17:19107000-19107022 GGCTGACCAACATGGTGAAACGG + Intergenic
1144990927 17:19233162-19233184 GGCTGACCAACATGGTGAAACGG + Intronic
1147718475 17:42523195-42523217 GGCTGCCCAGGAATGTGACCTGG + Intergenic
1148461852 17:47843579-47843601 CGCTGACCTGCATTCTTAGCAGG - Intergenic
1149317704 17:55454064-55454086 AGCTGACCACCAGTGTCAGCTGG + Intergenic
1151856830 17:76727391-76727413 GCCTGACCAACATAGTGACCAGG - Intronic
1156791083 18:40975886-40975908 GGCTGACCAGGTAGGTGAGCAGG + Intergenic
1157258437 18:46158441-46158463 GGCTGACAAGAATTGTATGCTGG - Intergenic
1160595329 18:79969481-79969503 GGCTCACCAGCTTTCTGACCTGG - Intronic
1161260735 19:3336631-3336653 GTCTGTCCAAGATTGTGAGCTGG + Intergenic
1163224588 19:15949115-15949137 GGTTGCCCAGCAATGTGAACAGG - Exonic
1164513204 19:28913850-28913872 GGCTGCCCAGAAGGGTGAGCTGG - Intergenic
1164767658 19:30784156-30784178 GGCTCACCAGCCTTGGGAACTGG + Intergenic
1165879320 19:39031661-39031683 GGCGGGGCAGCATTGGGAGCCGG - Intronic
1165879333 19:39031700-39031722 GGCGGGGCAGCATTGGGAGCCGG - Intronic
1166665898 19:44680319-44680341 GCCTTACCAGCATCATGAGCAGG - Exonic
929670285 2:43871877-43871899 GGGTGATCAGCATTGTGAGCTGG + Intronic
930610944 2:53542857-53542879 TGCTGACCAGCAGTGTGACTTGG + Intronic
931722739 2:65079200-65079222 TCCTGACCAGCATGGTGGGCAGG + Intronic
941248228 2:163127541-163127563 TTCTGCCCAGCATTGTGGGCAGG - Intergenic
944361488 2:198862493-198862515 TGCTGACCAGCACTGTGGCCTGG + Intergenic
945509171 2:210679473-210679495 GGCTGACCAGCATTGTCTGATGG + Intergenic
1172941307 20:38656583-38656605 GGCTGGCCAGAACTGTGGGCGGG + Intergenic
1175811391 20:61860312-61860334 GGCAGACCAGCAGGGTGACCAGG - Intronic
1176120837 20:63453850-63453872 GGCTGACCAGACTTGAGAACAGG + Intronic
1180003428 21:45006226-45006248 GGCTCACCAGAAATTTGAGCAGG - Intergenic
1180105872 21:45617691-45617713 GGCTGAGCAGCAGAGGGAGCTGG - Intergenic
1180551520 22:16545462-16545484 TGCTGACCAGCACTGTGACTGGG - Intergenic
1180782528 22:18529127-18529149 GGCGGAGCAGCAGCGTGAGCGGG + Intronic
1181126080 22:20703156-20703178 GGCGGAGCAGCAGCGTGAGCGGG + Intergenic
1181319571 22:21994202-21994224 GGTGGCCCAGCATGGTGAGCTGG + Intergenic
1182748599 22:32624358-32624380 GGATGAGCAGCATTCTGAGGAGG + Intronic
1184233950 22:43173242-43173264 GGCTGCCCAGCAGGGTGAGGTGG - Intronic
1184255324 22:43283147-43283169 GGTTGACCAGCATATTGGGCAGG + Intronic
950660113 3:14461923-14461945 GGCTGAGCAGCAGGGGGAGCCGG - Intronic
954055361 3:48018927-48018949 AGATGACCAGCATGGAGAGCTGG - Intronic
957966174 3:87324274-87324296 TGCTGAGCAGCATGGGGAGCTGG + Intergenic
960841343 3:121962701-121962723 GGCTGAGCAGCATAGTCTGCAGG + Intergenic
969703723 4:8781167-8781189 GGGAGACCAGCATCCTGAGCTGG + Intergenic
982483903 4:155944514-155944536 GCCTGGCCATCTTTGTGAGCTGG + Intronic
985070045 4:186158668-186158690 GGCTGAGCAGCAGTGCGTGCAGG - Intronic
988809734 5:34772649-34772671 AGCTGACCAGCCTTGTCACCTGG + Intronic
994058957 5:95452370-95452392 GGCTGTCCAGCATTGGGTGGTGG - Intergenic
994523477 5:100873058-100873080 GGATGACCAGCATTATCACCTGG - Intronic
994842520 5:104943731-104943753 GTCTTACCATCACTGTGAGCTGG - Intergenic
1001747671 5:174104224-174104246 GGCTGACAAGGATGGTGACCTGG - Exonic
1003067633 6:2917291-2917313 GCCTAACCATCAGTGTGAGCTGG - Intergenic
1005994562 6:30923403-30923425 GGCTGCCCAGGAGTGTGAGCGGG + Exonic
1016897101 6:149064177-149064199 TGGTGACAAGCCTTGTGAGCAGG + Intronic
1019617961 7:1975085-1975107 GGCTGGGCAGCACTGTCAGCAGG - Intronic
1024594245 7:50918619-50918641 TGCTGTCCAGCAGTGTGTGCAGG - Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1027565071 7:79781230-79781252 GGGTGAGTAGCATTGTGAACAGG - Intergenic
1029188004 7:98753261-98753283 GGCTCACCATGAATGTGAGCGGG + Intergenic
1030633996 7:111927445-111927467 TGCTGACCAGCAATGAAAGCTGG + Intronic
1030737356 7:113065364-113065386 GGCAGGACAGCATGGTGAGCAGG + Intergenic
1031859535 7:126962120-126962142 GGTTGAAAAGCATTCTGAGCAGG - Intronic
1032758441 7:134914739-134914761 GGATGGCTAGCATTGGGAGCTGG - Intronic
1034294928 7:149963734-149963756 TGCTGACCAGCTATGTGACCTGG + Intergenic
1034811134 7:154133213-154133235 TGCTGACCAGCTATGTGACCTGG - Intronic
1035024824 7:155818617-155818639 GGCTGACCTCCAGTGTGGGCGGG - Intergenic
1035738820 8:1909879-1909901 CGCTGCCCAGCAGTGTGAGCAGG - Intronic
1036478866 8:9120158-9120180 TGCTGATCAGAATTGTAAGCTGG - Intergenic
1038576799 8:28711591-28711613 GGCTGAGCTGCATCCTGAGCCGG + Intronic
1038850914 8:31275556-31275578 GGCTGAACCTCATTGTGACCTGG + Intergenic
1041740302 8:61150580-61150602 TGCTGATCTGCATTGTGGGCAGG - Intronic
1043247757 8:78027093-78027115 TGCTGCCCAGCATTGAGAGAGGG - Intergenic
1050389674 9:5127351-5127373 CGCTGGCCAGCATTATAAGCAGG + Exonic
1053281903 9:36825927-36825949 GGCTTACCAGCTGTGTGACCTGG + Intergenic
1053877349 9:42558095-42558117 GGCTGACAAGCATGGGGAGGAGG - Intergenic
1054234344 9:62543627-62543649 GGCTGACAAGCATGGGGAGGAGG + Intergenic
1056700850 9:88906142-88906164 GGCTGGTGAGCATTGTGTGCGGG - Intergenic
1057110730 9:92468298-92468320 GCCTGCCCTGCATGGTGAGCTGG + Intronic
1060312784 9:122477779-122477801 GGATGAGCAGCATGATGAGCAGG + Exonic
1060315983 9:122510927-122510949 GGATGAGCAGCATGATGAGCAGG - Exonic
1060717911 9:125951426-125951448 GTCTCACCAGCACTGGGAGCAGG + Intronic
1061293746 9:129666283-129666305 GGTTGACCAGCACTCTGGGCTGG + Intronic
1061763624 9:132867907-132867929 AGCTGACCAGCATGGTGAGAAGG + Intronic
1193152402 X:78139313-78139335 GGCTGCCCAGCTTTGTGTCCTGG - Intronic
1195977134 X:110539471-110539493 GGCCTATCAGCATTGTGAGTGGG - Intergenic
1200116869 X:153773323-153773345 GGCTGGCGAGCAGTGTGCGCTGG - Exonic
1201590344 Y:15608066-15608088 GCCTGAGCAGCAGAGTGAGCTGG - Intergenic