ID: 1079159339

View in Genome Browser
Species Human (GRCh38)
Location 11:17977674-17977696
Sequence ATGGAGACAAGGCCTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 435}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079159333_1079159339 -7 Left 1079159333 11:17977658-17977680 CCTAACCCTTAATATTATGGAGA 0: 1
1: 0
2: 1
3: 9
4: 176
Right 1079159339 11:17977674-17977696 ATGGAGACAAGGCCTGTGGGAGG 0: 1
1: 0
2: 2
3: 40
4: 435
1079159329_1079159339 18 Left 1079159329 11:17977633-17977655 CCCCATCAAATTCATATGTTGAA 0: 4
1: 85
2: 556
3: 1617
4: 3251
Right 1079159339 11:17977674-17977696 ATGGAGACAAGGCCTGTGGGAGG 0: 1
1: 0
2: 2
3: 40
4: 435
1079159331_1079159339 16 Left 1079159331 11:17977635-17977657 CCATCAAATTCATATGTTGAAAT 0: 36
1: 266
2: 1210
3: 2687
4: 5616
Right 1079159339 11:17977674-17977696 ATGGAGACAAGGCCTGTGGGAGG 0: 1
1: 0
2: 2
3: 40
4: 435
1079159330_1079159339 17 Left 1079159330 11:17977634-17977656 CCCATCAAATTCATATGTTGAAA 0: 5
1: 76
2: 568
3: 1801
4: 3809
Right 1079159339 11:17977674-17977696 ATGGAGACAAGGCCTGTGGGAGG 0: 1
1: 0
2: 2
3: 40
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079159339 Original CRISPR ATGGAGACAAGGCCTGTGGG AGG Intronic
900160032 1:1219129-1219151 TTGGGGATCAGGCCTGTGGGAGG - Intronic
900516769 1:3085859-3085881 GGGGAGACAAGGCCTGGGTGGGG - Intronic
901761568 1:11475146-11475168 TTGCAGACACGGCCTGGGGGAGG - Intergenic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
902089262 1:13890267-13890289 TAGGAGACAAAGCCTTTGGGGGG - Intergenic
902675479 1:18005756-18005778 ATGGAGAGAAGGCCAGGGAGAGG + Intergenic
903328726 1:22586145-22586167 CTGGAGACAGGGCCTGGGGGAGG + Intronic
904344741 1:29860477-29860499 CTGCAGACAAGGGCAGTGGGAGG + Intergenic
904677503 1:32207316-32207338 ATGGGGAACAGGCCTGTGAGAGG + Exonic
905789159 1:40781300-40781322 GTGGAGACAGGGCCTGGGGGTGG + Intergenic
906057609 1:42929089-42929111 CTTGAGGCAAGGCCTCTGGGTGG - Intronic
906070578 1:43013507-43013529 ATGGTGACAAAGCCTGGGGATGG + Intergenic
906484296 1:46222320-46222342 ATGGGGACAAGAGCTGTGGCTGG + Intergenic
906811787 1:48834468-48834490 GTGGAGGTAAGGCCTTTGGGAGG + Intronic
907023265 1:51089311-51089333 TTGGAGATGGGGCCTGTGGGAGG - Intergenic
907165351 1:52405703-52405725 ATGGAGTTAAGGTTTGTGGGTGG + Exonic
907826129 1:58018420-58018442 AGGGAGCCAAAGGCTGTGGGAGG - Intronic
909351130 1:74654665-74654687 TTGGAGATGAGGCCTTTGGGAGG - Intronic
909406127 1:75291641-75291663 ATGGACAAAGGGCCTGTGAGGGG + Intronic
909417209 1:75420001-75420023 TAGGAGATAAGGCCTTTGGGAGG + Intronic
909522180 1:76582290-76582312 ATGGAAAGACTGCCTGTGGGAGG - Intronic
910278972 1:85477364-85477386 CTGTAGAAAAGGCCTGAGGGCGG - Intronic
912677701 1:111700521-111700543 TTGGAGGTGAGGCCTGTGGGAGG - Intronic
913201833 1:116501085-116501107 ATGGAGACAAGGGATGCTGGAGG - Intergenic
915066404 1:153228658-153228680 ATGGAGAGCAGGCATGGGGGTGG + Intergenic
915275012 1:154782557-154782579 TTGGAGAAAGGGTCTGTGGGAGG - Intronic
915493589 1:156265809-156265831 ATTGACGCAAGGCCTGTGGCTGG + Exonic
915681201 1:157583448-157583470 TTGGAGACAGGGCCTTTGAGAGG + Intronic
915724667 1:158008862-158008884 ATGGAGACAGGGCCATTGGGTGG - Intronic
916456950 1:164980828-164980850 TAGGAGATAAGGCCTTTGGGAGG - Intergenic
917690003 1:177459133-177459155 GAGGAGACTGGGCCTGTGGGAGG - Intergenic
917729351 1:177858649-177858671 AGGGAGACATGGACTGTGGAGGG + Intergenic
919190888 1:194217165-194217187 TTGGAAACGAGGCCTTTGGGAGG + Intergenic
919783909 1:201245077-201245099 ATGGAGATGAGGCCTTTGGAAGG + Intergenic
919857908 1:201718278-201718300 GAGGTGACAGGGCCTGTGGGTGG + Intronic
920718696 1:208366896-208366918 AAGGAGACAAGGATGGTGGGAGG + Intergenic
920977673 1:210801276-210801298 AGGGAGCCAGGGCATGTGGGTGG - Intronic
921075575 1:211697845-211697867 AGAGAGAAAAGGCCTGTGTGGGG - Intergenic
922074957 1:222234597-222234619 TTGGAGACCAGGCCTGAGGGTGG - Intergenic
922087311 1:222363245-222363267 TTGGAGATAAGACCTTTGGGAGG - Intergenic
923274396 1:232384025-232384047 TTGGAGGCAGGGCCTTTGGGAGG - Intergenic
924494313 1:244571922-244571944 TTGGAGACAGGGCCTTTAGGAGG - Intronic
1063578278 10:7281389-7281411 ATGGGGAGAAGTCCAGTGGGAGG - Intronic
1063659277 10:8022465-8022487 ATGGAGAAAAGGCCAGGGGTAGG + Intergenic
1064497357 10:15926522-15926544 ATGGAGACCAGGACCGGGGGTGG - Intergenic
1064658150 10:17577437-17577459 ATGGAGTTAAGGTTTGTGGGTGG + Intergenic
1065146048 10:22769317-22769339 TTGGAGGCGAGGCCTTTGGGAGG - Intergenic
1065796309 10:29311511-29311533 ATGGTGTCTAGGCTTGTGGGTGG - Intronic
1065879583 10:30027357-30027379 ATGGAGGCCAGGCACGTGGGTGG + Exonic
1066237570 10:33501390-33501412 ATAAAGACAAGACCTGTGGTAGG + Intergenic
1066586881 10:36945414-36945436 TTGGAGATAAGGCCTTTGAGAGG - Intergenic
1067090986 10:43265844-43265866 AGGGAACCAAGGCCTCTGGGAGG + Intronic
1067683777 10:48455604-48455626 ATGGCCACCAGGCCTGTGGAAGG - Intronic
1067780090 10:49195685-49195707 AAAGAAACAAGGCCTCTGGGTGG - Intergenic
1067905012 10:50281603-50281625 TTGGAGGTGAGGCCTGTGGGAGG - Intergenic
1070399164 10:76037763-76037785 GTGGAGATGAGGCCTTTGGGAGG - Intronic
1071430513 10:85602924-85602946 ATGCAGCCAAGGCCTGTTGATGG - Intronic
1071447465 10:85762067-85762089 ATGGATACAGCGACTGTGGGTGG - Intronic
1072412473 10:95216303-95216325 TTGGAGATGAGGCCTTTGGGAGG - Intronic
1072459010 10:95602686-95602708 TTGGAGACGGGGCCTTTGGGAGG - Intergenic
1073427193 10:103462491-103462513 ATGGATACACCTCCTGTGGGAGG + Intergenic
1074436809 10:113441272-113441294 AATGAGACGAGGCCTGTGAGTGG - Intergenic
1074543667 10:114386150-114386172 ATGGAGAAAATGCCTATGGTAGG + Intronic
1075546199 10:123356709-123356731 ATGAAGACAAAGCAAGTGGGAGG - Intergenic
1075612673 10:123866004-123866026 ATGGAAACCAGGGCTGTGTGTGG - Intronic
1076307886 10:129477466-129477488 TTGGAGACAGGGCCTTTAGGAGG + Intronic
1076398868 10:130164101-130164123 ATGGAGACATGACCTGTGCAGGG - Intronic
1076471947 10:130725151-130725173 AGGGAGAAAAGGCCACTGGGTGG - Intergenic
1076727528 10:132420500-132420522 AGGGAGTCAAGGCCTGTGTGGGG + Intergenic
1076812498 10:132895778-132895800 TTGGCGACAGGGCCTCTGGGAGG + Intronic
1077309839 11:1883409-1883431 ATGCAGGCCGGGCCTGTGGGTGG - Exonic
1077384578 11:2262955-2262977 CTGGGGGCAAGGCCAGTGGGTGG + Intergenic
1077478352 11:2801615-2801637 TTGGAGACGAGGCCTTTAGGAGG - Intronic
1079159339 11:17977674-17977696 ATGGAGACAAGGCCTGTGGGAGG + Intronic
1079468738 11:20758102-20758124 TTGGAGACAAGGCCTTTGGAAGG - Intronic
1079670225 11:23159818-23159840 ATGGAGACCAGGGCTGGGAGTGG + Intergenic
1079915061 11:26359304-26359326 ATGGAGACAAGGCTTTTTTGGGG + Intronic
1080004517 11:27392466-27392488 ACCCAGACAAGGCCTTTGGGTGG + Exonic
1080406131 11:31980965-31980987 TTGGAGATAAGGCCTTTGAGAGG - Intronic
1081006954 11:37756592-37756614 GTGGAGATAAGGCCTTGGGGAGG + Intergenic
1081805499 11:45887782-45887804 GCGGAGACAAGGCCAGTGCGTGG + Intronic
1084163804 11:67365728-67365750 ATGGAGACAGGGCCAGTGTCAGG - Intronic
1084881125 11:72172399-72172421 AGGTAGACAAGGCCTGAGGGAGG - Intergenic
1084881869 11:72177398-72177420 AAGGAGACCAGAGCTGTGGGAGG - Intergenic
1085407854 11:76274553-76274575 ATGGAGTCATGGTCTGTTGGAGG - Intergenic
1086059218 11:82683062-82683084 ATGGAGAAAAACCCTGTGTGCGG + Intergenic
1087873767 11:103331284-103331306 ATGGAGAAAAAGCCTGTAAGGGG - Intronic
1089538230 11:119173672-119173694 GCTGAGACAAGGCCAGTGGGGGG - Exonic
1089640251 11:119843210-119843232 AGGGAGAGCAGGCCTGGGGGTGG + Intergenic
1089741916 11:120590339-120590361 ATTCAGACAAAGCCTGTGGCTGG - Intronic
1089982060 11:122780698-122780720 ATGGAGGAAAGGCCTGCAGGCGG + Intronic
1090237718 11:125161599-125161621 ATGAAGACAGGGCCTTTAGGGGG + Intergenic
1091791286 12:3273626-3273648 AAGGAGGCAAGGCCTGTCTGTGG - Intronic
1092313051 12:7379265-7379287 ATGGAGCTGAGGCTTGTGGGTGG - Exonic
1092318063 12:7440332-7440354 ATGGCGGCAGGGCCGGTGGGCGG - Intronic
1092909565 12:13134716-13134738 ATGCAAAAAAGGCCTTTGGGTGG + Intronic
1093233433 12:16576829-16576851 ATGGACATAAGACCTGTAGGTGG + Intronic
1094004730 12:25737518-25737540 ATTGAGCCAAGTCCTGTGTGAGG + Intergenic
1094177955 12:27561128-27561150 AGAGAGAAAAGGCCTCTGGGAGG + Intronic
1095933518 12:47652781-47652803 GTGGAGACGGGGCCTTTGGGAGG - Intergenic
1096638612 12:52976770-52976792 ACAGAGACAAGGGCTGAGGGAGG + Intergenic
1096982916 12:55738573-55738595 AGGGAGACTAGGACAGTGGGCGG + Intergenic
1098339024 12:69432586-69432608 TTGGAGATAAGGCTTTTGGGAGG - Intergenic
1100767571 12:97884694-97884716 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1101015324 12:100494631-100494653 ATGCAGTCAAGGGCAGTGGGAGG + Intronic
1101254138 12:102960930-102960952 ATGGAGACTAGGTCTGGGTGGGG + Intergenic
1102039012 12:109788704-109788726 AGGGAGACCAGGGCTGTGGGAGG + Exonic
1102890126 12:116552372-116552394 CTGGAGTCACTGCCTGTGGGAGG + Intergenic
1103019475 12:117522396-117522418 ATGGAGAGAAGGCCAGGGGTGGG + Intronic
1103705964 12:122872595-122872617 ATGGAGAGCCGCCCTGTGGGTGG - Intronic
1104027214 12:125036735-125036757 TTGGAGACAGGGTCTTTGGGAGG + Intergenic
1104401606 12:128481080-128481102 ATGGAGTCCAGGCCTGTGTGTGG + Intronic
1105392443 13:19993073-19993095 ATGGACACAAGTTCAGTGGGAGG + Exonic
1105825289 13:24116795-24116817 TTGGAGAAAGGGCCTTTGGGAGG + Intronic
1106083590 13:26520931-26520953 ATGTGGACAAGGCCTGCTGGGGG + Intergenic
1106339038 13:28810530-28810552 TTGGAAATAAGGCCTTTGGGAGG + Intergenic
1106986193 13:35354234-35354256 AGGGAGACAAGGTCTGTAGATGG - Intronic
1108395957 13:49991861-49991883 ATGAAGACAAGGCCAGAGGAAGG - Intergenic
1108487363 13:50940550-50940572 ATGGAGAGATGGAATGTGGGAGG + Intronic
1108502962 13:51084785-51084807 ATGGTAACTAGGCCTGGGGGAGG + Intergenic
1110833243 13:80055435-80055457 TTGGAGACGGGGCCTTTGGGAGG - Intergenic
1111819671 13:93197034-93197056 TTGGAGGCAAGGCCTTCGGGAGG - Intergenic
1112396693 13:99040069-99040091 TTGGAGACAGGTCCTTTGGGAGG + Intronic
1112921237 13:104615207-104615229 ATGAAGACTAGGCCTGTGACTGG - Intergenic
1113023059 13:105910116-105910138 TTGGAGACGAGGCCTTTGGGAGG - Intergenic
1113078940 13:106496335-106496357 AAGAAGACAAGGGTTGTGGGAGG - Intronic
1113487456 13:110664742-110664764 CTGAAGGCAGGGCCTGTGGGAGG + Intronic
1113499940 13:110765293-110765315 TTGGAGGCAGGGCCTGTGGGAGG + Intergenic
1113790058 13:113023469-113023491 CTGGAGACAGTGGCTGTGGGGGG + Intronic
1115505685 14:34092336-34092358 ATGGAGCCAATGACTGAGGGTGG - Intronic
1115648077 14:35384082-35384104 ATGGTGACAAGGCCAGGTGGAGG + Intergenic
1115972520 14:38961877-38961899 CTGGAGACAAGGCACGTGAGGGG - Intergenic
1116429428 14:44828808-44828830 TTGGAAGCAAGGCCTTTGGGAGG + Intergenic
1117804475 14:59476675-59476697 ATAGAGACAAAGGCTGTGAGAGG + Intronic
1118189009 14:63563777-63563799 ATAAAGACAAGTCCTGTGAGTGG - Intergenic
1118270137 14:64335601-64335623 TTGGAGGCAGGGCCTTTGGGAGG - Intronic
1119629412 14:76214676-76214698 TTGAAGACAGGGCCTTTGGGAGG - Intronic
1119724145 14:76911881-76911903 TTGGAGATAGGGCCTTTGGGAGG + Intergenic
1120640643 14:87007545-87007567 ATGGAAACAAGGCACTTGGGGGG + Intergenic
1120994393 14:90405645-90405667 ATGGGGACAAGGCAGGTGGAGGG + Exonic
1121709012 14:96023195-96023217 TTGGAGACGGGGCCTTTGGGAGG + Intergenic
1122028670 14:98896427-98896449 TTGGAGACAGGGCCTTTGGGAGG - Intergenic
1122345802 14:101059402-101059424 CTGGACACAAGGCCTGTGTAAGG + Intergenic
1122357504 14:101132417-101132439 ATGGAGTCAAGGCCTGGGGTGGG + Intergenic
1122771648 14:104100356-104100378 CTCAAGACAAGGCCTGTGTGTGG + Intronic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1202863582 14_GL000225v1_random:100680-100702 AAGGAGGCAGTGCCTGTGGGTGG + Intergenic
1128228521 15:66019152-66019174 TTGGTGACAGGGCCTGTGCGTGG + Intronic
1128355689 15:66925001-66925023 ATGGAAAAGAGGCGTGTGGGAGG + Intergenic
1128554988 15:68625458-68625480 ATGCTGGCAAGGCCTGGGGGTGG - Intronic
1129318279 15:74759406-74759428 ATGGGGTCGAGGCCTGTGAGGGG - Intergenic
1129552549 15:76468791-76468813 CTGGAGACGGGGCCTGTGGGAGG + Intronic
1129903194 15:79167434-79167456 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1130140931 15:81225674-81225696 ATCGAGGCAAGACCTGTAGGAGG + Exonic
1130609792 15:85350650-85350672 TTGGAGACGGGGCCTTTGGGAGG + Intergenic
1130843572 15:87723964-87723986 ATGGAGGCCAAGCCTGTGGATGG - Intergenic
1131076573 15:89499112-89499134 AGGGAGACAAGGGCTGGGGTGGG + Intergenic
1132590216 16:723314-723336 ATGGCTCCAAGGCCTGGGGGGGG - Intronic
1133778984 16:8922146-8922168 ATGCAGCCAGGGCCTGTGGATGG - Intronic
1134104478 16:11476121-11476143 ATGGAAAGAAGGCTGGTGGGAGG + Intronic
1134185722 16:12083554-12083576 ATGGAGACAAGGCCTTAATGAGG - Intronic
1134640820 16:15827935-15827957 ATGGAGTCGAGGCCTGAAGGAGG - Intronic
1135087447 16:19486754-19486776 TTGGAGACAGGGCCTTTGAGAGG - Intronic
1135684057 16:24483622-24483644 GTGGAGAAAGGGCCTTTGGGAGG - Intergenic
1137382406 16:48011618-48011640 TTGGAGGCAGGGCCTTTGGGAGG - Intergenic
1138024539 16:53512162-53512184 ATGGACAAAAAGCCTATGGGGGG + Intergenic
1138108771 16:54306654-54306676 ATGGAGACAAGGCACGTTGAAGG + Intergenic
1138244313 16:55455291-55455313 TAGGAGGCAAGGCCTTTGGGTGG + Intronic
1138598766 16:58042961-58042983 ATGGAAGCGAGGGCTGTGGGTGG + Intronic
1139152984 16:64406897-64406919 CAGGAGACATGGGCTGTGGGAGG - Intergenic
1140333742 16:74083349-74083371 ATGGAGATAAGGCATTTAGGCGG - Intergenic
1141153667 16:81582174-81582196 TTGGAGAAGGGGCCTGTGGGAGG - Intronic
1141481176 16:84307993-84308015 ATGGAGACGAGGCCTTAAGGAGG - Intronic
1142005266 16:87686794-87686816 ATGAAGACAAGAACTGTCGGAGG - Intronic
1142016012 16:87747872-87747894 ATGTGGAGAAGGCCTGTGTGCGG + Intronic
1142218462 16:88841394-88841416 CTGGAGACCAGGCAGGTGGGAGG - Intronic
1143108093 17:4539379-4539401 ATGGAGGCAGGGGCTGAGGGGGG + Intronic
1143627780 17:8121171-8121193 ATGGAGAGCAGGACTGAGGGTGG + Exonic
1144470149 17:15532311-15532333 ATGAAGACAAGCCCTGTGATTGG + Intronic
1144826239 17:18107259-18107281 AGGGAGACGAGGCAGGTGGGCGG - Exonic
1144926192 17:18811338-18811360 ATGAAGACAAGCCCTGTGATTGG - Intergenic
1145109866 17:20153039-20153061 TTGGAGACAGGGCCTTTAGGAGG - Intronic
1146522661 17:33538343-33538365 ATACAGACACGGCCAGTGGGAGG + Intronic
1147387179 17:40089538-40089560 AAGGAGAGAAGGGGTGTGGGGGG - Intronic
1149952248 17:61001650-61001672 ATGGAGAAAAATCTTGTGGGGGG + Intronic
1151313442 17:73308366-73308388 CCAGAGATAAGGCCTGTGGGCGG - Intronic
1151313661 17:73309542-73309564 ATGGGGACAAGCACGGTGGGTGG + Intronic
1151407816 17:73900867-73900889 AGCTAGACCAGGCCTGTGGGTGG - Intergenic
1151971554 17:77460074-77460096 TTGGAGGTAAGGCCTGGGGGGGG - Intronic
1152125000 17:78441312-78441334 AGCGGGACAAGGCCTGTGGCAGG + Intronic
1152133581 17:78491558-78491580 GTGGAGAACAGGCCTGGGGGAGG + Exonic
1152211757 17:79006169-79006191 ATGGAGCCATGGCCCGTGTGAGG - Intronic
1156599407 18:38587051-38587073 ATGCATACAAGGCCTGAGCGTGG + Intergenic
1156871457 18:41950516-41950538 TTGGAGACAGGGCCTTTAGGAGG - Intergenic
1158571115 18:58597792-58597814 TTGGAGGCAGGGCCTCTGGGAGG + Intronic
1160059459 18:75516152-75516174 ATGGAAATAAGGCCAGTGGCTGG + Intergenic
1160397027 18:78580114-78580136 ATGGAGCCAAGTGCTGAGGGAGG + Intergenic
1160526894 18:79543623-79543645 AGGGAGACCAGGCCTGGGGAGGG + Intergenic
1161475565 19:4482980-4483002 AAGGAGACAAGCGCTGGGGGTGG - Intronic
1161804431 19:6434287-6434309 TTGGAGACAGGGCCTTTGGGAGG + Intergenic
1162888727 19:13716440-13716462 TTGGAGGCAGGGCCTTTGGGAGG - Intergenic
1163018190 19:14469609-14469631 AGGGAAGCAAGGCCTGAGGGTGG - Intronic
1163176175 19:15565306-15565328 ATGGAGAAAAGTCCTCTAGGGGG - Intergenic
1163331030 19:16637900-16637922 TTGGAGACAGGGCCTTTGGGAGG + Intronic
1166125614 19:40714141-40714163 ATGGGGACAAGGTCTGAGGGTGG + Intronic
1167311666 19:48740674-48740696 GAGGAGACCAGGCCTGGGGGAGG + Exonic
1167707547 19:51090512-51090534 GTGGAGACAAGGGGTGTTGGTGG + Intergenic
1168657268 19:58139626-58139648 TTGGAGATGAGGCCTGTGGGAGG - Intronic
1168677948 19:58292485-58292507 TTGGAGATGAGGCCTTTGGGAGG - Intronic
925288052 2:2728783-2728805 AGGGAGACATGGCCTGCCGGAGG + Intergenic
925865475 2:8222749-8222771 TTGGAGATAGGGCCTGTAGGAGG - Intergenic
926122841 2:10254211-10254233 TTGGAGGCAAGGCCTTTGAGAGG - Intergenic
926219448 2:10925298-10925320 ATGGAGAGAAGCCCTGTGCATGG - Intergenic
926251885 2:11159449-11159471 TCGGGGACCAGGCCTGTGGGAGG + Intronic
926922113 2:17949373-17949395 TTGGAGATGAGGCCTTTGGGAGG + Intronic
927290822 2:21403250-21403272 TAGGAGATAAGGCCTTTGGGAGG + Intergenic
927405972 2:22767183-22767205 TTGGAGACAGGGCCTTTGGAAGG - Intergenic
927884264 2:26708929-26708951 GTGGAGACAGAGCTTGTGGGTGG + Intronic
929664914 2:43826479-43826501 ATGCAGTCCAGGCCTGTGGTTGG + Exonic
930200639 2:48549350-48549372 ATGGAGTCCAGGCCTGGGGTGGG + Intronic
930379967 2:50615274-50615296 GTGGAGACACTGCCTGTGTGAGG - Intronic
931483396 2:62666442-62666464 TTAGAGATAAGGCCTTTGGGAGG - Intergenic
932104301 2:68928649-68928671 ATGGAGACAAGCATGGTGGGGGG - Intergenic
933364532 2:81333512-81333534 ATGGAGAAAAAGCCTATTGGAGG - Intergenic
936478804 2:112866148-112866170 AGAGACACAAGGCATGTGGGAGG - Intergenic
937087477 2:119181068-119181090 ATGGAGGGAAGGCCTTGGGGCGG - Intergenic
937199986 2:120195710-120195732 TTGGAGGCGAGGCCTTTGGGAGG + Intergenic
937356202 2:121199648-121199670 ATGGAGACAAGGTGTGATGGGGG - Intergenic
937885915 2:126899864-126899886 ATGGGGACTGGGCCTGGGGGAGG + Intronic
938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG + Intergenic
940042505 2:149375318-149375340 ATGAAGTCATGGACTGTGGGAGG + Intronic
941024601 2:160444685-160444707 TTGGAGACAGGGGCTGTAGGAGG + Intronic
943285064 2:185987717-185987739 ACGGAGACAGGACCTGTGAGAGG + Intergenic
943642624 2:190375903-190375925 TAGGAGACAGGGCCTTTGGGAGG + Intergenic
945135576 2:206624195-206624217 GAGGAGACAAGGGCTGAGGGAGG + Intergenic
945158804 2:206867142-206867164 ATCTAGACTAGCCCTGTGGGTGG - Intergenic
945206127 2:207334480-207334502 AGAGAGACAGGGCCAGTGGGTGG + Intergenic
945958085 2:216105052-216105074 TTGGAGATGAGGCCTTTGGGAGG - Intergenic
946106099 2:217371166-217371188 TTGGAGACAGGGCCTTTGAGAGG + Intronic
947009727 2:225552462-225552484 TTGGAGATGAGGCCTTTGGGAGG + Intronic
947791896 2:232873373-232873395 ATGGGGACAGGGCCTGAGTGGGG + Intronic
948180750 2:235978133-235978155 TTGGAGACTGGGCCTTTGGGAGG - Intronic
948869600 2:240791562-240791584 ATGGGGGCCAGGCCTGTGCGGGG - Intronic
949008960 2:241667788-241667810 ATGGAGACGGGGCCTATGTGTGG - Intronic
949031444 2:241799240-241799262 AGGGAGACAGGCCCAGTGGGGGG - Intronic
1169582236 20:7036618-7036640 TTGGAGATCAGGCCTTTGGGAGG - Intergenic
1170123427 20:12935946-12935968 AGGGAGACAAGGGCTGTTGCAGG - Intergenic
1172277478 20:33687554-33687576 ATGGAGAAAAGGAGTGTGTGTGG - Intergenic
1172939532 20:38644911-38644933 ATAGAGGGAAGGACTGTGGGTGG - Intronic
1173134482 20:40427238-40427260 AATGAGTCAAGGCATGTGGGTGG - Intergenic
1173762483 20:45575812-45575834 ATGGAAACAGGGCCTGGGGCTGG - Intronic
1173819999 20:46013597-46013619 TTGGACACAGGGCCAGTGGGCGG - Intronic
1174447268 20:50598414-50598436 TTGGACACAAGGCCTGGGTGGGG - Intronic
1175347834 20:58294944-58294966 ATAGCCACAAGGCCTGTGGCTGG - Intergenic
1175372606 20:58502060-58502082 ATGGTGACAAGCACTGTGAGAGG - Intronic
1175877486 20:62237212-62237234 GGGGAGACAAGGCCTGAGGAGGG + Intronic
1175892421 20:62321562-62321584 GTGGAGGCAGGGCCTGTGGAGGG + Intronic
1175897941 20:62347668-62347690 AGAGAGACAAGGCCTGAGGTTGG + Intronic
1175951800 20:62587627-62587649 AGGCAGACAAGGCCCGGGGGAGG + Intergenic
1177219437 21:18172304-18172326 ATAAAGACAAGTCCTGTGAGTGG + Intronic
1178204175 21:30443880-30443902 TTGGAGAAGAGGCCTTTGGGAGG + Intergenic
1178299190 21:31437593-31437615 TTGGAGAAAGGGCCTGTGGGAGG + Intronic
1178365459 21:31985985-31986007 ATGGAGACAAGCCCTTTGGAAGG + Intronic
1178606186 21:34037953-34037975 ATGGACACAAGCCCTTGGGGAGG - Intergenic
1178692599 21:34761825-34761847 ATGGAGACAAGGTCTGCAGAAGG - Intergenic
1179128270 21:38611573-38611595 CTGGAGTGAGGGCCTGTGGGAGG - Intronic
1179152884 21:38823577-38823599 ACAGGGATAAGGCCTGTGGGGGG + Exonic
1179417790 21:41212342-41212364 TAGGAGGCAAGGCCTTTGGGAGG - Intronic
1179429891 21:41314069-41314091 TTGGAGATAGGGCCTTTGGGAGG + Intronic
1180145240 21:45915084-45915106 GTGGAGACGAGGCCAGTGTGGGG - Intronic
1180850406 22:19016471-19016493 ATGGAAAAATGGCCTGTGGATGG - Intergenic
1182963304 22:34497138-34497160 TTGGAGATAGGGCCTTTGGGAGG + Intergenic
1183152821 22:36051437-36051459 ATGGAGATAGGGTCTTTGGGAGG - Intergenic
1184320663 22:43739979-43740001 AGGGAGACACGGCCAGGGGGTGG - Intronic
1184747959 22:46466811-46466833 TTGGAGATGAGGCCTCTGGGAGG + Intronic
1185275158 22:49947572-49947594 ATGGAGACTGGGCCTGTCGGTGG - Intergenic
1185345125 22:50307626-50307648 ATGGAGACGGGGCCTTTGTGTGG + Exonic
950463231 3:13138139-13138161 AGGAAGACAAGACTTGTGGGAGG - Intergenic
951362736 3:21743694-21743716 ATGGAGGTGGGGCCTGTGGGAGG - Intronic
951688520 3:25371311-25371333 ATGTGGACAAGGCTTGGGGGAGG + Intronic
952451832 3:33440266-33440288 AAGGAGTCAAGGCTTGGGGGCGG - Exonic
953552720 3:43916875-43916897 TAGGAGACAGGGCCTTTGGGAGG + Intergenic
953927618 3:46990396-46990418 GTGGAGAGAAAGGCTGTGGGAGG - Intronic
954945958 3:54424616-54424638 ATGGAGCCAGGACCTGGGGGTGG + Intronic
955013203 3:55040223-55040245 TTAGAGACAGGGCCTTTGGGAGG - Intronic
955289556 3:57678570-57678592 TTAGAGACAGGGCCTTTGGGAGG + Intronic
956192861 3:66623602-66623624 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
956379176 3:68647734-68647756 TTGGAGGCAGGGCCTTTGGGAGG + Intergenic
956470281 3:69559370-69559392 TTGGAGACAGGGCCTTTGGGAGG + Intergenic
957232731 3:77540844-77540866 ATTGAGATAATGCCTGTGGAGGG + Intronic
961041671 3:123682648-123682670 AGGGAGACAAGGCCTGATGGAGG - Intronic
961379030 3:126485415-126485437 ATGGGCAGAAGGCGTGTGGGTGG + Intronic
962422113 3:135237964-135237986 ATGGTGACCAGCCCTGTGGAGGG - Intronic
963250411 3:143097399-143097421 TTGGAGATAGGGCCTCTGGGAGG + Intergenic
963272969 3:143303400-143303422 AAGGAGGCAAGGCCTCTTGGGGG + Intronic
963687156 3:148450885-148450907 TTGGAGGCGTGGCCTGTGGGAGG + Intergenic
964477412 3:157109563-157109585 ATGGATACTAGGCCTGTGAAGGG - Intergenic
964523469 3:157591780-157591802 TTGGAGACAAGGCCAGGGAGTGG + Intronic
964941122 3:162158691-162158713 ATGGAGAGAAGGGGTGGGGGAGG + Intergenic
966301300 3:178482272-178482294 TTGGAGTCAAGGGGTGTGGGGGG + Intronic
967120418 3:186377942-186377964 ACTGAGGCAAGGCCTCTGGGTGG - Intergenic
968548924 4:1212665-1212687 ATGGGCACGGGGCCTGTGGGAGG - Intronic
968855051 4:3113814-3113836 AAGGAGAGAAGTCCTGTGGCTGG + Intronic
969356723 4:6632224-6632246 TTGGAGATGAGGCCTTTGGGTGG - Intergenic
969470387 4:7384272-7384294 CCAGGGACAAGGCCTGTGGGGGG + Intronic
969486443 4:7474935-7474957 ATGGAGACAGTGACTGGGGGAGG - Intronic
969574271 4:8027466-8027488 CTGAGGACAAAGCCTGTGGGCGG + Intronic
969858037 4:10015565-10015587 TTGGAGATGAGGCCTTTGGGAGG + Intronic
970075182 4:12210462-12210484 TTGGAGATGAGGCCTCTGGGAGG + Intergenic
972324192 4:37999592-37999614 TGGGAGAGCAGGCCTGTGGGGGG + Intronic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
975759580 4:77605751-77605773 CTGGAGACAAAGGCAGTGGGAGG + Intronic
976021850 4:80639093-80639115 TTGGAGATGAGGCCTTTGGGAGG - Intronic
976059199 4:81106741-81106763 TTGGAGGTGAGGCCTGTGGGAGG + Intronic
976188596 4:82467812-82467834 TTGGAGATAAGGCCTTTGGGAGG + Intergenic
976740122 4:88348276-88348298 ATGGAGAGAAGGGGTGGGGGGGG + Intergenic
977389616 4:96391081-96391103 TTGGAGATGGGGCCTGTGGGAGG + Intergenic
977756122 4:100674416-100674438 TTGGAGATACGGCCTTTGGGAGG - Intronic
978490164 4:109303157-109303179 ATGGAGAAATGGCCTCCGGGAGG + Intergenic
978570770 4:110134504-110134526 AAGAACACAAGGCCTCTGGGGGG + Intronic
978827463 4:113042486-113042508 TGGAAGACAAGGCCTTTGGGAGG - Intronic
978889922 4:113813171-113813193 TTGGAGACGGGGCCTTTGGGAGG + Intergenic
982307935 4:153953252-153953274 AAGGAGAAAAGGCCGATGGGAGG + Intergenic
982425764 4:155257778-155257800 TTGGAGAAAAGGCCTTTGAGAGG - Intergenic
982504041 4:156195990-156196012 TAGGAGATAAGGCCTTTGGGAGG + Intergenic
983000137 4:162404103-162404125 ATTGAGACATGACCTCTGGGAGG + Intergenic
984281451 4:177675388-177675410 ATGAAGCCAAGGACTGTGGTAGG - Intergenic
984314452 4:178109145-178109167 AGGGAAACAAGGCCAGTGGAAGG + Intergenic
985035693 4:185838200-185838222 AGGAAGCTAAGGCCTGTGGGCGG - Intronic
985136252 4:186788732-186788754 ACAGAGAGATGGCCTGTGGGAGG - Intergenic
985533004 5:444654-444676 AAGGAAACAAGCCCTGTTGGAGG + Intronic
985668732 5:1195618-1195640 GTGCAGGCCAGGCCTGTGGGAGG + Intergenic
985672335 5:1213243-1213265 ATGGGGGCAGGGGCTGTGGGGGG - Intronic
986677156 5:10196134-10196156 TTGGAGACAGGGCCTTTAGGAGG - Intergenic
986984685 5:13487156-13487178 ATGGAGGAAGGGCCTTTGGGAGG + Intergenic
987623327 5:20365318-20365340 TTGGAGATGAGGCCTTTGGGAGG - Intronic
989661075 5:43798166-43798188 ACGGACACAAAGCCTGTTGGTGG + Intergenic
990716168 5:58639611-58639633 TTGGAGGCGAGGCCTGTGGAAGG - Intronic
990765404 5:59177125-59177147 TTGGAGGCCGGGCCTGTGGGAGG + Intronic
990840720 5:60076922-60076944 ATGGCGACATGGCTTGGGGGCGG + Intronic
991163698 5:63536058-63536080 GTGGAGAAAAAGCCTGTTGGAGG - Intergenic
991948302 5:71922954-71922976 TTGGAGAAGAGGCCTTTGGGAGG + Intergenic
992413600 5:76532038-76532060 TAGGAGATATGGCCTGTGGGAGG - Intronic
995536148 5:113138359-113138381 TTGGAGACAGGGCCTTTGGGAGG + Intronic
996262159 5:121485541-121485563 ATTGTAACAAGGCCTGTGAGTGG + Intergenic
997590533 5:135069374-135069396 ATGCAGAGAAGGCCTGCGTGGGG + Intronic
997849378 5:137317174-137317196 AGGGAGACAAGGGCTGTAGTTGG - Intronic
998040881 5:138950416-138950438 TGGGAGAGAAGGCCTGGGGGAGG + Intronic
998319443 5:141215618-141215640 ATGGAGACCAGGGATGTGAGGGG - Exonic
998376342 5:141693368-141693390 ATCGAGACCAGAGCTGTGGGTGG + Intergenic
1001093284 5:168757201-168757223 ATGGAGAGAAGCCCCCTGGGTGG - Intronic
1001248125 5:170121047-170121069 TTGGAGACAAGGCTTCTGGGGGG - Intergenic
1001549846 5:172594938-172594960 ATGGAGTCATGGTCTGTGGAAGG + Intergenic
1001847820 5:174937371-174937393 AAGGAGCTAAGGCCTGTGTGAGG + Intergenic
1002103658 5:176869470-176869492 TGGGAGAGAAGGCCTGGGGGAGG - Intronic
1002167375 5:177356766-177356788 TTGGAGACAGGGCCTTTGAGAGG + Intergenic
1002458270 5:179358468-179358490 CTGGAGACAGGGCTTTTGGGAGG + Intergenic
1005283784 6:24302785-24302807 ATGGAAAAAAGAACTGTGGGAGG - Intronic
1005397581 6:25399109-25399131 GTGGAGAGAAGGCCTCTGGAAGG + Intronic
1005990355 6:30898364-30898386 ATGGAGACCAGGGCTGTGAGTGG - Intronic
1006034328 6:31199826-31199848 ATGCAGGCAAGGGCTGTGAGAGG + Intronic
1006067727 6:31474446-31474468 ATGGGGGCAAGGGCTGTGGCAGG + Intergenic
1007122317 6:39393214-39393236 AGGGAGAGAGGGCCTGCGGGTGG - Intronic
1007330074 6:41100048-41100070 ATGCAGACAAGTCTTGTCGGGGG - Intergenic
1007385621 6:41518418-41518440 TTGGAGCCAAGGCCTGTCGTGGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008165398 6:48132153-48132175 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1008515186 6:52312192-52312214 ATGGAGATGGGGCCTTTGGGAGG + Intergenic
1009361550 6:62820642-62820664 TTGGAGATGAGGCCTTTGGGAGG - Intergenic
1009711057 6:67321364-67321386 ATTGAAAGAAGGCCTGTGTGGGG - Intergenic
1009753163 6:67899045-67899067 TTGGAGATAAGGCCTTTAGGAGG - Intergenic
1009897023 6:69764205-69764227 TTGGAGATGAGGCCTTTGGGAGG + Intronic
1009947641 6:70358222-70358244 TTGGAGATATGGCCTTTGGGAGG + Intergenic
1011793999 6:90932375-90932397 ACAGAGGCAAGACCTGTGGGGGG + Intergenic
1012413246 6:98984211-98984233 TTGGAGATAGGGCCTGTGGAAGG + Intergenic
1013612967 6:111812246-111812268 GGGGTGACAAGGCCTCTGGGAGG + Intronic
1013698851 6:112738487-112738509 ATGGCGACAAGGCATTTGTGTGG + Intergenic
1014559103 6:122869312-122869334 TTGGAGGTAAGGCCTCTGGGAGG - Intergenic
1014611910 6:123557804-123557826 ATGGAGAGAAGGGGTGGGGGGGG - Intronic
1014705916 6:124747228-124747250 AGTGAGAAAAGACCTGTGGGTGG - Intronic
1016502682 6:144739666-144739688 ATGGAGAAAAGCCTTCTGGGTGG - Intronic
1017131125 6:151109008-151109030 GTGGATACAAGGCCTCTGGCAGG - Intergenic
1017598614 6:156057848-156057870 ATGGAGACAGAGCCTGTCAGAGG - Intergenic
1017890612 6:158635606-158635628 ATGGAGACAAGGCGTGGGTTTGG + Intergenic
1018044358 6:159952677-159952699 ATGGGGACCTGGCCTGGGGGCGG + Intergenic
1019503796 7:1380422-1380444 AGGGAGAAAAGGGCTGTGTGAGG + Intergenic
1021062449 7:16130839-16130861 TTGGAGGTAAGGCCTTTGGGGGG + Intronic
1021828140 7:24574034-24574056 ATGGAGAGCCGGCCTGGGGGCGG + Intronic
1022902541 7:34825155-34825177 AAGGAGAAAAGGCCTGGAGGTGG - Intronic
1026106132 7:67422249-67422271 TTGGACACATGGCCTGTGGAAGG - Intergenic
1026226313 7:68445124-68445146 ATGGAGACAAGGAATTTGGCAGG - Intergenic
1027179061 7:75925054-75925076 ATTGAGAAAAGGACTCTGGGAGG + Intronic
1028598884 7:92579157-92579179 ATGGAGACAAGGGCGGCGGGGGG + Intronic
1029165811 7:98589462-98589484 ATGGAGATATGGCCTTTAGGTGG - Intergenic
1030283737 7:107803690-107803712 ATGCAGATATGGCCTGTGGCTGG - Intergenic
1031086476 7:117306306-117306328 AAGGAGACAAGGACTGTGAGGGG + Intronic
1031482465 7:122295589-122295611 TTGGAGATAGGGCCTCTGGGAGG + Intergenic
1032474330 7:132202113-132202135 ATGGAGCAAAGACCTGGGGGAGG - Intronic
1032702881 7:134397659-134397681 GTGGAGGCCAGGCCTGTTGGAGG + Intergenic
1033016625 7:137678202-137678224 GTGGGGCCAAGGCCTGTGTGTGG - Intronic
1033045872 7:137961827-137961849 ATGGAGGAAAGGCCTGGGGTAGG - Intronic
1034725153 7:153329133-153329155 ATGGGGACATGGCATGTGGTGGG - Intergenic
1034726385 7:153340072-153340094 TTGGAGACAAGGCCTTTGAAAGG - Intergenic
1034900531 7:154905659-154905681 AAGGATACAAGGCCGGAGGGAGG - Intergenic
1034902631 7:154916680-154916702 AGAGAGAGAAGGCCGGTGGGTGG + Intergenic
1035538055 8:407241-407263 GTGGGGACGGGGCCTGTGGGAGG + Intronic
1035568692 8:658610-658632 TTGGAGACAAGACCTTAGGGAGG + Intronic
1036602952 8:10279511-10279533 ATACAGAGAAGGCGTGTGGGGGG - Intronic
1038846782 8:31237423-31237445 AGAGAGAAAAGGTCTGTGGGGGG - Intergenic
1039167433 8:34699726-34699748 TGGGAGACATGGCCTTTGGGAGG - Intergenic
1040036592 8:42876372-42876394 TTGGAGACAAAACCTTTGGGAGG + Intronic
1041264232 8:56048051-56048073 ATGGAGATGAGGCCTTTGGGAGG - Intergenic
1041336712 8:56793558-56793580 ATAGAGACACGGCTTGTGGGTGG + Intergenic
1041814308 8:61950585-61950607 GTGGTGACAAGGCATGAGGGAGG - Intergenic
1041882496 8:62767777-62767799 ATAGAGAGAAGGCATGTGGCAGG + Intronic
1042504904 8:69549551-69549573 AGGGAGACAAGTCCTGCTGGGGG + Intronic
1042993758 8:74669933-74669955 CTGGAGACAGGGCCTTTAGGAGG + Intronic
1043101861 8:76057748-76057770 TTGGACGCAAGACCTGTGGGAGG + Intergenic
1043300581 8:78726060-78726082 ATGGAGAAAAAGCATGGGGGTGG + Intronic
1043423346 8:80123080-80123102 CTTGAGACAAGGACAGTGGGTGG + Intronic
1043532066 8:81161779-81161801 TTGGAGACAGGGCCTTTGGGAGG - Intergenic
1044357616 8:91242520-91242542 CTAGAGACAGGGCCTCTGGGAGG + Intronic
1044543771 8:93436614-93436636 ATGGAGCTTAGACCTGTGGGTGG - Intergenic
1044598503 8:93981064-93981086 ATGGAGACAAGACCTGGGGAGGG + Intergenic
1044745445 8:95366427-95366449 TTGGAGATAGGGCCTTTGGGTGG - Intergenic
1046618362 8:116501604-116501626 AAGGAGCCAAGGGCTGTGGTGGG - Intergenic
1048141077 8:131795038-131795060 ATGGTGATAATGCCTGTGGGAGG + Intergenic
1048142805 8:131811188-131811210 TTGGACACAGGGCCTTTGGGAGG + Intergenic
1048295855 8:133212854-133212876 CTGGAGAGAGGGCCTGCGGGGGG - Exonic
1048410388 8:134166647-134166669 TTGGAGACAGGGCCTTTGAGAGG + Intergenic
1048469636 8:134695516-134695538 ATGCAGGCAGGGCCTGGGGGTGG - Intronic
1048469816 8:134696162-134696184 ATGGGGCCAGGGCCTGGGGGTGG - Intronic
1048655056 8:136526823-136526845 TTGGAGACAGGGCCTTTGGGAGG - Intergenic
1049222105 8:141432907-141432929 ATGGAGGCGGGGCCTGGGGGGGG + Intergenic
1051976481 9:22956350-22956372 TTGGAGGCAGGGCCTTTGGGAGG - Intergenic
1053423658 9:37997200-37997222 ATGGAGATACAGCCTGTGGCCGG - Intronic
1054950674 9:70847778-70847800 ATATAGACAAGGCCTGTGTGGGG - Intronic
1054961583 9:70975992-70976014 ATGGAGATAGGGGCTGGGGGAGG - Intronic
1056691310 9:88810921-88810943 AAGGAGAGAAAGCCTGAGGGTGG - Intergenic
1056868206 9:90250283-90250305 ATGGAGAGAATGGCTGTGAGAGG + Intergenic
1056912562 9:90716141-90716163 TTGGAGGTGAGGCCTGTGGGAGG + Intergenic
1057256302 9:93550503-93550525 ATATAGACAAGTCCAGTGGGAGG - Intronic
1058280166 9:103103811-103103833 ATGGAGAGAAGACCTGAGGTAGG - Intergenic
1058848670 9:108988467-108988489 ATGGAGACAAGGGCAGAGGCAGG - Intronic
1059717976 9:116931292-116931314 GTGGAGACATGGGTTGTGGGTGG + Intronic
1060041266 9:120303749-120303771 ATGGAGAGAAAGCCAGTGGAAGG + Intergenic
1061646595 9:132007756-132007778 ATGGAGACAAGGCCAGGAGTAGG + Intronic
1061720608 9:132548732-132548754 ACAGAGACAAGGACTGTGGGGGG - Intronic
1061888695 9:133606287-133606309 ATTGGGCCAAGGCCTGCGGGAGG + Intergenic
1062294998 9:135820110-135820132 ATGTAGCCGAGGCCTGTGGGGGG - Intronic
1062317238 9:135973997-135974019 AGGGAGACAAGGCCAGCAGGGGG - Intergenic
1062369600 9:136231029-136231051 ATGGAAACAAGGCCGGTCGGAGG - Intronic
1062543051 9:137049977-137049999 AGGCAGAGAAGGCCTGTAGGGGG + Exonic
1062710433 9:137972378-137972400 CTGGAGACAGGGCCTGTTTGGGG + Intronic
1203740743 Un_GL000216v2:175332-175354 AAGGAGGCAGTGCCTGTGGGTGG - Intergenic
1185431730 X:15105-15127 TTGGAGATATGGCCTTTGGGAGG - Intergenic
1185441051 X:227824-227846 TTGGAGATATGGCCTTTGGGAGG - Intergenic
1186403210 X:9278545-9278567 ATGGAGACATGGCAGGAGGGAGG - Intergenic
1186543544 X:10425607-10425629 TTGGAGACGGGGCCTTTGGGAGG - Intergenic
1187338795 X:18403276-18403298 ATGGAGAGAAGGCAGGAGGGAGG + Intergenic
1189916477 X:45860621-45860643 ATTGAGACAGGGCAAGTGGGTGG + Intergenic
1190033980 X:47003367-47003389 TTGGAGACAAGGCCTACAGGAGG - Intronic
1190682258 X:52836847-52836869 ATGTAGAAAAGGCCTTTGGCCGG - Intergenic
1192263783 X:69524931-69524953 GAGGACACCAGGCCTGTGGGTGG - Intronic
1192316781 X:70058522-70058544 TTGGAGGCGGGGCCTGTGGGAGG - Intergenic
1192540427 X:71965004-71965026 ATGGAGACAGGGAGTGTAGGAGG + Intergenic
1192882194 X:75297699-75297721 GTGGAGTCATGGCCTGTGTGAGG + Intronic
1193522962 X:82552849-82552871 ATGTACACAAGTGCTGTGGGAGG + Intergenic
1194869119 X:99105814-99105836 ATGGAAACAGGGCCTTTGGGAGG + Intergenic
1197578397 X:128251674-128251696 TTGGAGATGAGGCCTTTGGGAGG + Intergenic
1198127385 X:133659388-133659410 ATCGAGTGAAGACCTGTGGGCGG - Intronic
1198206052 X:134466039-134466061 TTGGAGACAGGGCCTTTGGAAGG + Intronic
1198410911 X:136366918-136366940 TTGGAGATGAGGCCTTTGGGAGG + Intronic
1199557366 X:149123761-149123783 TAGGAGGCAAGGCCTTTGGGAGG + Intergenic
1199830173 X:151541647-151541669 ATGGAGACAAGGGCTGGGGGAGG - Intergenic
1200018619 X:153183327-153183349 TTGCAGCCAAGGCCAGTGGGAGG + Exonic
1200203948 X:154302575-154302597 TTGGAGGCAGGGCCTTTGGGAGG - Intronic
1200386249 X:155893751-155893773 TTGGAGACAAGGCCTTTGGGAGG - Intronic