ID: 1079159566

View in Genome Browser
Species Human (GRCh38)
Location 11:17979309-17979331
Sequence CACTGCTTGCAGAAATTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079159561_1079159566 26 Left 1079159561 11:17979260-17979282 CCTCGCAAACCTCAAGAAATAGT 0: 1
1: 0
2: 1
3: 7
4: 96
Right 1079159566 11:17979309-17979331 CACTGCTTGCAGAAATTAACTGG 0: 1
1: 0
2: 1
3: 10
4: 128
1079159563_1079159566 17 Left 1079159563 11:17979269-17979291 CCTCAAGAAATAGTAAGGCATGG 0: 1
1: 0
2: 0
3: 23
4: 267
Right 1079159566 11:17979309-17979331 CACTGCTTGCAGAAATTAACTGG 0: 1
1: 0
2: 1
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079159566 Original CRISPR CACTGCTTGCAGAAATTAAC TGG Intronic
901962932 1:12841497-12841519 CACTTATTGCAGAAAGGAACTGG - Intergenic
901990123 1:13105803-13105825 CACTTATTGCAGAAAGGAACTGG - Intergenic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
908065456 1:60398789-60398811 CACTGCTTTCAGAAATAATTAGG - Intergenic
908894676 1:68884960-68884982 CACTGGTTGCAAAAATAAAGTGG - Intergenic
913207917 1:116558109-116558131 CACTGCCTGCAGATTTTAGCAGG + Intronic
914748559 1:150516518-150516540 CACTGCTTCCAGATAATAGCTGG - Intergenic
918639423 1:186821090-186821112 CACAGCTTGGAGAAATTGAAGGG - Intergenic
921224480 1:213004501-213004523 TACTGCTTGGAGGAATTAACAGG - Intronic
924291739 1:242543398-242543420 CACTTCTTGCAAACTTTAACGGG + Intergenic
1063958533 10:11286763-11286785 CTTTTCTTGCAGAAATTCACAGG + Intronic
1065869305 10:29942365-29942387 TACTGCTGGCAGAAATTCACAGG + Intergenic
1072142164 10:92598750-92598772 AACTGCTGGCAGAAATTAAGGGG - Intronic
1072833610 10:98686985-98687007 CACTTCTTTCAGTAATTAACAGG - Intronic
1073803734 10:107072210-107072232 CTCTGCTTGCAGAGCTTAACAGG + Intronic
1074248506 10:111718944-111718966 CACTGCTGGTAGGAATAAACTGG + Intergenic
1075097884 10:119484645-119484667 CACTGCCTGCATAAACTATCTGG - Intergenic
1075289165 10:121213742-121213764 CAATTCTTGGAGAAATTAATGGG - Intergenic
1075463609 10:122634940-122634962 CACTGCAAACAGAAATCAACAGG - Intronic
1079159566 11:17979309-17979331 CACTGCTTGCAGAAATTAACTGG + Intronic
1079920405 11:26427172-26427194 GACTGCTTGCAGCAATGGACAGG - Intronic
1085178733 11:74513733-74513755 CACTGATTGCATAAACAAACAGG - Intronic
1085387939 11:76167827-76167849 CACTGTTTCCAGTAAATAACTGG - Intergenic
1085944240 11:81247049-81247071 CAATCCTTACAGAAATTAAAGGG + Intergenic
1086851390 11:91813258-91813280 CACTGCTTGCATATATTTAGTGG - Intergenic
1092234321 12:6796720-6796742 CACTGCCTGCACAAATTAGCTGG + Intronic
1095919444 12:47514618-47514640 CCATGCTTGCAGAATGTAACAGG - Intergenic
1099128793 12:78800234-78800256 CACTGCTTTTAGAGATTCACTGG + Intergenic
1100715701 12:97302942-97302964 CACTTATTGAATAAATTAACTGG + Intergenic
1100874801 12:98950673-98950695 GGCTGCTTGCAGGAATTACCTGG - Intronic
1104520548 12:129470563-129470585 CGCTGCTTGCACAAATAAAGTGG + Intronic
1106240381 13:27907335-27907357 CACTGCTTTCAGGAAATAACTGG + Intergenic
1107355087 13:39557865-39557887 CACATCTTGCATAAACTAACTGG - Intronic
1107761511 13:43684224-43684246 CACTGCTTAAAGAATTTAAAGGG - Intronic
1108024754 13:46166002-46166024 CACTGATTTAAGAAATGAACAGG - Intronic
1108504995 13:51104876-51104898 TGCAGCTTGAAGAAATTAACAGG + Intergenic
1108604191 13:52020881-52020903 AAAGGCTTGTAGAAATTAACTGG - Intronic
1109021918 13:57107603-57107625 CACTGCTTGTATAAACAAACTGG + Intergenic
1109036599 13:57270263-57270285 CACTACTTAAAGAAATTAAAAGG + Intergenic
1112090107 13:96074168-96074190 CACTGCTTGGAGGAAATAATAGG + Intergenic
1112418247 13:99223368-99223390 CACTTCTAGCAGAAATGATCAGG - Intronic
1112564366 13:100540432-100540454 CACATCTTGCAGAAATAAAAAGG - Intronic
1114731355 14:24995940-24995962 CACTGCTTTCAGAACTCAAATGG + Intronic
1115287633 14:31733368-31733390 AAATCCTAGCAGAAATTAACAGG - Intronic
1122748180 14:103912601-103912623 CACGGCTTGCTGAAATTTACAGG + Exonic
1123811868 15:23935112-23935134 CAGTGCTTGCAGGAACTAAGGGG - Intergenic
1126384571 15:48080807-48080829 CATCGCTGGCAGAAATCAACGGG + Intergenic
1128772661 15:70294015-70294037 GACTGCTTGCAGTAATTGCCAGG + Intergenic
1128955108 15:71932616-71932638 AACCCCTTCCAGAAATTAACTGG + Intronic
1134527984 16:14959192-14959214 CACTGTTTGGGGACATTAACGGG - Intergenic
1139203704 16:65005031-65005053 CTCTGCTTGCAGAAGCTAACTGG - Exonic
1141229339 16:82150205-82150227 CACTGCCCGCAGAAATTGATGGG - Intronic
1142521379 17:507277-507299 CTCTGCTTGCAGAAGTGAACAGG - Intergenic
1144185631 17:12792567-12792589 TACTGATTTAAGAAATTAACAGG - Intronic
1144345377 17:14344919-14344941 CACTGCTTCCAGAAATAAGAGGG + Intronic
1144887891 17:18476459-18476481 CACTGGTTCCAGAAAATAATGGG - Intergenic
1145144320 17:20467842-20467864 CACTGGTTCCAGAAAATAATGGG + Intergenic
1145175771 17:20699245-20699267 CACTGGTTCCAGAAAATAATGGG + Intergenic
1147245525 17:39117763-39117785 CTCTGCTTCCAGAAAGTAAAAGG - Intronic
1148909321 17:50932321-50932343 CACTGCTTCCAGAGAATTACAGG - Intergenic
1149408355 17:56378100-56378122 CTCTCCTTGCAGAAACTGACAGG + Intronic
1149818097 17:59746863-59746885 CAGTGCTTTCAGAAATTAACAGG - Intronic
1157412777 18:47477431-47477453 GACTGCCTGCAAAAATTGACAGG - Intergenic
1158215267 18:55094432-55094454 CAATGATTACACAAATTAACAGG - Intergenic
1165056462 19:33179594-33179616 GATTGTTTGCAGAAATTTACAGG - Intronic
1165645835 19:37435219-37435241 CACTGATTGCATAAACAAACAGG - Intronic
926901049 2:17753054-17753076 CATTTCTTACAGAAATGAACCGG - Exonic
927679354 2:25129813-25129835 CACAGCTGTCAGAAATTAAATGG - Intronic
929873944 2:45780954-45780976 CAGTGTTTGCAGAAATTGCCAGG + Intronic
930892500 2:56407316-56407338 CATTGCTAGCAGAAATTGAAAGG + Intergenic
932962045 2:76424174-76424196 CACTGGTTTCAGGAACTAACTGG - Intergenic
933783428 2:85818300-85818322 CACTGTTAGCAGAACCTAACAGG - Intergenic
934706911 2:96487929-96487951 CACTGCTTGCAAGAATGACCTGG - Intergenic
934872637 2:97881188-97881210 CACTGCATGCAGACAGTATCTGG + Intronic
936052617 2:109236279-109236301 CACTGCATGCAGAAACAACCTGG - Intronic
937081888 2:119146214-119146236 CAGTCCTTGCAGAAATCCACTGG + Intergenic
939178303 2:138777644-138777666 GACTGCTTTCAGAAACAAACAGG + Intronic
940619891 2:156098597-156098619 CTCTGCTTGCTTAAACTAACAGG + Intergenic
941581126 2:167296003-167296025 AACTGCTTGTATAAATTAAGTGG - Intergenic
943989085 2:194662831-194662853 CACTGGTTTCAGAAACAAACAGG + Intergenic
944616106 2:201462629-201462651 CACTGATTGCAAAAACAAACAGG + Intronic
944850134 2:203710625-203710647 CACTGCTTGCAGGAAATACTTGG - Intronic
945597556 2:211813551-211813573 CACTGCATGCAAAGATAAACGGG - Intronic
945700518 2:213164007-213164029 CACTGCTTTTAAAATTTAACGGG - Intergenic
945932361 2:215867623-215867645 CACAGCTGGCAGATATTAGCAGG + Intergenic
946736858 2:222762401-222762423 CACTGCTGTCAGAGATGAACGGG + Intergenic
1169571548 20:6912037-6912059 ACCTGCTTGTAGACATTAACAGG + Intergenic
1173148728 20:40547666-40547688 CATTGCTTTGAGAAAATAACAGG + Intergenic
1174885746 20:54331944-54331966 TACTGCTCTAAGAAATTAACAGG + Intergenic
1176658962 21:9615813-9615835 CTCTGCTTAGAGACATTAACAGG - Intergenic
1178804472 21:35826933-35826955 GACTGATTGCAGAAACTATCTGG - Intronic
952957867 3:38569399-38569421 CACTGCAAGCATAAAATAACTGG - Intronic
953048186 3:39314640-39314662 CACTGCTTTCAAGCATTAACTGG - Intergenic
954015036 3:47680916-47680938 TACTGCTTGCCAAAATTAATTGG + Intronic
954974765 3:54682815-54682837 CACTGCTTGGAGAGATCAAGTGG + Intronic
956547085 3:70416842-70416864 CACTGATTGTAGAAGCTAACAGG + Intergenic
956598890 3:70997665-70997687 CAGTGCTAGCTGACATTAACAGG - Intronic
962386213 3:134934644-134934666 CACTGATTGCAGAAATATATTGG + Intronic
964268791 3:154932292-154932314 CTGTGCTTGAAGAAATTATCTGG + Intergenic
964987447 3:162761891-162761913 CAATCCTTGCAGATATTAAAGGG - Intergenic
970376328 4:15460912-15460934 TACTGCTTCCAGAATTTAGCAGG - Intergenic
971370837 4:26017513-26017535 GGCTGCTTGTTGAAATTAACAGG + Intergenic
982941445 4:161562348-161562370 CACAGCTGTCAGAAATTGACAGG - Intronic
985752400 5:1688078-1688100 CAGGGCTTGCAGAGGTTAACAGG + Intergenic
990932871 5:61112992-61113014 CACTGATTGCATAAACAAACAGG + Intronic
992405159 5:76450049-76450071 CACTGCTCTCAGAAAGTAAATGG - Intronic
993716107 5:91277244-91277266 CAATGCTAGCAGAGATTAAATGG + Intergenic
994064608 5:95524012-95524034 CACTGCTTATAGAAAGTAAAAGG + Intronic
994265145 5:97706439-97706461 CACCGTTTGCAAAAATAAACAGG - Intergenic
994319246 5:98371655-98371677 CACTGATTGAAGAAATTGAAGGG - Intergenic
995040192 5:107578799-107578821 CACTGCTGTCTGAAATTAAAAGG + Intronic
999061104 5:148636480-148636502 CAAGGCTTGCAGAAAATTACAGG + Intronic
1017034485 6:150254916-150254938 AACTGCTTCTAGAGATTAACTGG - Intergenic
1017731941 6:157324406-157324428 CCCAGCTTTCAGATATTAACTGG + Intergenic
1023469707 7:40502382-40502404 AACTGCTTTCAAAAATTAGCTGG - Intronic
1024530283 7:50385767-50385789 CATTGCTTTTAGAAATTAATAGG - Intronic
1026527598 7:71168853-71168875 CCCCACCTGCAGAAATTAACTGG - Intronic
1028471755 7:91213410-91213432 GTCTGCTTGGAGAAATCAACAGG + Intergenic
1031722148 7:125189643-125189665 CACTGATTGCAAAAACAAACAGG - Intergenic
1034742468 7:153489927-153489949 CTCAGACTGCAGAAATTAACAGG + Intergenic
1035425960 7:158773379-158773401 AACAGCTTTTAGAAATTAACTGG - Exonic
1035478345 7:159159564-159159586 CACTGCATGCAGAAAGTTCCAGG + Intergenic
1035548829 8:504219-504241 ATATGTTTGCAGAAATTAACAGG - Intronic
1037193492 8:16156746-16156768 CAGGGCTTTTAGAAATTAACTGG + Intronic
1040506894 8:48057123-48057145 TCTTGCTTGCAGAAATGAACAGG - Intronic
1044803609 8:95982012-95982034 CAGTGCTGGAAGAAATTAAGAGG + Intergenic
1045633602 8:104156489-104156511 CACTGTTTTCAGAAATTATAAGG + Intronic
1045800906 8:106099357-106099379 CACTGATTGCAAAAAACAACAGG - Intergenic
1047569459 8:126082365-126082387 CCCTGCTGGCAGAACCTAACAGG - Intergenic
1049628466 8:143637345-143637367 TACAGCCTGAAGAAATTAACAGG - Intronic
1058663846 9:107290894-107290916 AATTTCTTTCAGAAATTAACTGG - Intronic
1191039707 X:56066543-56066565 CCCTGCTTGCAAAAATCACCTGG - Intergenic
1192266784 X:69544014-69544036 CAATGCTGGCAGAAATTGTCTGG + Intergenic
1193909563 X:87285744-87285766 CACTGCTGGTAGAAATTGAAGGG + Intergenic
1194409097 X:93535401-93535423 CACTTCTTGCATAAATTTAATGG - Intergenic
1197337855 X:125230212-125230234 CACTGCTTACAGAAATAAGAAGG + Intergenic
1201270355 Y:12248014-12248036 CTCTGCCTCCAGAATTTAACAGG - Intergenic
1201769817 Y:17609248-17609270 CACTGTTTGCTCAAATAAACTGG + Intergenic
1201831737 Y:18296739-18296761 CACTGTTTGCTCAAATAAACTGG - Intergenic
1201866583 Y:18662045-18662067 CAGTGCTTGCAGAATAGAACTGG + Intergenic