ID: 1079162357

View in Genome Browser
Species Human (GRCh38)
Location 11:18006875-18006897
Sequence CTGTGTATGTTCATGTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079162355_1079162357 -6 Left 1079162355 11:18006858-18006880 CCATCCAAGTTAATAAGCTGTGT 0: 1
1: 0
2: 1
3: 12
4: 119
Right 1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 258
1079162354_1079162357 10 Left 1079162354 11:18006842-18006864 CCAATAACTTTTTTTGCCATCCA 0: 1
1: 0
2: 0
3: 25
4: 233
Right 1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 258
1079162356_1079162357 -10 Left 1079162356 11:18006862-18006884 CCAAGTTAATAAGCTGTGTATGT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079162357 Original CRISPR CTGTGTATGTTCATGTATTC TGG Intronic
901927032 1:12572853-12572875 CTGTGTCTCTTCCTGTGTTCAGG - Exonic
903185042 1:21624128-21624150 CTGTGTATGTACGTGTGTGCAGG + Intronic
903197120 1:21699032-21699054 CTGTGCATGTACATGCATTTGGG - Intronic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
909159807 1:72132146-72132168 CTATTTATGTGCATGTATACTGG - Intronic
909961583 1:81851758-81851780 GTGTGTATGTGTATGTATTCTGG + Intronic
909998956 1:82318643-82318665 ATATGTGTGTTCATGTATTTAGG + Intergenic
911721514 1:101196292-101196314 CTATGTATGTTAAGGTTTTCAGG - Intergenic
912244766 1:107949723-107949745 CTGTGTGTGTACATGTACTTTGG - Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913420657 1:118664363-118664385 CTGTGTTTGTTCTTGCATTCTGG - Intergenic
914349299 1:146826545-146826567 CTGTGTCTGTTGATGTTTTAGGG - Intergenic
917142448 1:171850436-171850458 GTGTGTCTGTTTATGTTTTCTGG + Intronic
919218413 1:194591983-194592005 CTGTGTATCTTCCTTTTTTCAGG + Intergenic
919221602 1:194637643-194637665 CTGTGTTTGTGCTTTTATTCTGG + Intergenic
919636324 1:200006868-200006890 CTAAGTATGTTCCTGTAATCAGG + Intergenic
920016954 1:202919634-202919656 CTATGGATGTTCATGTTTGCTGG - Intronic
921786113 1:219231534-219231556 GTGTGTATTTCCATGTATTGAGG + Intergenic
1063475682 10:6326824-6326846 CTGTGTATTTTCATTAATTTTGG - Intergenic
1063482380 10:6386910-6386932 CTGTGTATGTGCCTGTATGTGGG - Intergenic
1065164408 10:22960136-22960158 GTGTGTATGTGTGTGTATTCTGG - Intronic
1065459635 10:25945507-25945529 CAGTGTTTGTTCATATATTTTGG + Intronic
1066135591 10:32442536-32442558 CAGTGTATCTTCATTTATTTAGG + Intergenic
1066272733 10:33839305-33839327 GTGTGTGTGTTTAAGTATTCTGG + Intergenic
1066482899 10:35814084-35814106 GTGTGTATGTGCATGTGTTCGGG - Intergenic
1067035890 10:42916327-42916349 CTTGGTATGTTATTGTATTCTGG - Intergenic
1067190497 10:44064037-44064059 CTGTGCATGTCCATGAATTATGG - Intergenic
1069598380 10:69687312-69687334 TTGTGTGTGTGCATGTCTTCAGG - Intronic
1069680525 10:70281927-70281949 CTGTGTTTGGTCATTTCTTCTGG + Intronic
1070104752 10:73420962-73420984 ATGTGTATGTGTATGTATTGGGG - Intergenic
1071037791 10:81267788-81267810 CTGTGTATGTTTGTGTGTTGCGG + Intergenic
1073494237 10:103876857-103876879 CTGTGTATGTGCCTATTTTCTGG + Intergenic
1073974852 10:109088760-109088782 CAGTATACCTTCATGTATTCTGG + Intergenic
1074871101 10:117576632-117576654 ATGTATATTTTCATGCATTCAGG - Intergenic
1074979307 10:118606839-118606861 GTGTGGGTGTGCATGTATTCGGG + Intergenic
1075370237 10:121928777-121928799 CTGCTTGTGTTCTTGTATTCAGG - Intronic
1076068678 10:127468889-127468911 GTGTGTGTGTTCATGCATGCAGG + Intergenic
1076535849 10:131176583-131176605 CTGTGTGTGTGCATGTGTTTTGG - Intronic
1078670324 11:13358835-13358857 CTCTGTATATGCATGTAATCAGG + Intronic
1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG + Intronic
1079205734 11:18412896-18412918 TTGTATATGTCGATGTATTCAGG + Intronic
1080676400 11:34431850-34431872 CTGTTTATGTCCACGTATCCTGG + Intergenic
1082653297 11:55821310-55821332 GTGTGTGTGTTTATGTATACGGG + Intergenic
1083739202 11:64699150-64699172 CTGTGTATGTGCGTGGATTATGG - Intronic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1085916771 11:80899211-80899233 CTCTGTAGATTCATCTATTCTGG + Intergenic
1086557562 11:88129155-88129177 CTGTATATGTTAAGGTACTCAGG - Intronic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087838697 11:102900456-102900478 ATGTATATGTTCCTGTATGCAGG - Intergenic
1089448238 11:118571152-118571174 CTGTGGATTTTCTTCTATTCTGG + Intronic
1091005189 11:131946892-131946914 ATGAGTATCTTCATGTATACAGG + Intronic
1091071010 11:132563368-132563390 GTGTGTATGTTTCTGTATTTGGG + Intronic
1092605945 12:10119067-10119089 CTGTATATTTTAATGTATCCTGG + Intronic
1093244474 12:16719228-16719250 CTTTGTATGTTTATGTTTTGGGG + Intergenic
1095315740 12:40759192-40759214 CTGTGCCTGGTCAAGTATTCAGG + Intronic
1095325346 12:40884890-40884912 CTTTGTATTTTCTTATATTCAGG + Intronic
1096747978 12:53740898-53740920 CTGTGTATCTGCATGTGTGCAGG + Intergenic
1096790767 12:54043420-54043442 TTCTGTGTGTTCAGGTATTCTGG - Intronic
1098002345 12:65958682-65958704 CTGTGTATGTTCAACTTCTCAGG - Intronic
1098467433 12:70803915-70803937 GTGTGTGTATTTATGTATTCAGG + Intronic
1099019620 12:77387337-77387359 CTGAGTATGTGGAAGTATTCTGG + Intergenic
1099147584 12:79066041-79066063 TTGTGTATGTTCATGCATGTGGG - Intronic
1099963688 12:89421915-89421937 ATGTGTTTGTATATGTATTCTGG - Intronic
1100782708 12:98046519-98046541 GTGTGTATGTTTGTGTATTTGGG - Intergenic
1101776716 12:107801622-107801644 CTGTGGATGATCAGGTATCCTGG - Intergenic
1106231295 13:27823255-27823277 CTGTCTATTTTCAAGTATTTGGG - Intergenic
1106887891 13:34209621-34209643 CTGTTTATGTAAATGTATTAGGG + Intergenic
1108809742 13:54207228-54207250 TTATGAATGTTCATGTATTGAGG - Intergenic
1109018556 13:57053334-57053356 CTGTCTTTCTTTATGTATTCTGG + Intergenic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1109561235 13:64052802-64052824 CTGTGTCTGTTCTTGCCTTCAGG - Intergenic
1110091821 13:71460494-71460516 CAGTGTATTTACATGTTTTCTGG + Intronic
1110370360 13:74733094-74733116 GTGTGTATGTGCATGTGTTTAGG - Intergenic
1110621798 13:77604966-77604988 GTGTGTATGTGCATGTAGTGTGG + Intronic
1110808754 13:79789344-79789366 CTTTATATGTTCATGTTTTTGGG + Intergenic
1111393359 13:87628866-87628888 ATGTTTCTGTTCATGTATGCGGG + Intergenic
1111447709 13:88371194-88371216 CTGTGTTTTTTCATGTAATTTGG + Intergenic
1112168092 13:96941391-96941413 CTGTGTATGTTCACATTTTGGGG - Intergenic
1115790423 14:36871440-36871462 CTGGGTATGTTCATCTGTCCAGG - Intronic
1117096426 14:52303285-52303307 ATGTGTTTGTTTATTTATTCAGG - Intergenic
1119074642 14:71623978-71624000 CAGTGCATGTACATGTGTTCAGG + Intronic
1121189297 14:92010688-92010710 CTGTGTATGTTCCTGCTGTCAGG + Intronic
1122986771 14:105215463-105215485 GTGTGTGTGTGCATGTGTTCTGG - Intronic
1123916694 15:25037656-25037678 CTGTGTATATTCTGGTATTTGGG + Intergenic
1124823554 15:33071031-33071053 CTGTGTGTGGTCTTCTATTCGGG - Intronic
1125819614 15:42617556-42617578 CTGTGTATATTTATGTACACAGG - Intronic
1131205634 15:90443525-90443547 ATGTGAATGTTGATCTATTCTGG + Intronic
1131823787 15:96299873-96299895 CTGTGTATCTTCATTTCCTCTGG - Intergenic
1133242055 16:4420553-4420575 GTGTGTGTGTTCTTGTTTTCAGG - Intronic
1135338614 16:21627227-21627249 CTGTGTAGATTCATGAATGCTGG + Intronic
1135590352 16:23700790-23700812 CTCTGTAAGTTCATGCAGTCTGG - Intronic
1137577101 16:49607425-49607447 CTGTGTATGTTGATGTTTGATGG + Intronic
1139984737 16:70889009-70889031 CTGTGTCTGTTGATGTTTTAGGG + Intronic
1140079472 16:71731566-71731588 CTATGTATGTTCAAGTATTCAGG - Intronic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1141260930 16:82453295-82453317 ATGTGGATATTCATGGATTCTGG - Intergenic
1141759699 16:86019825-86019847 GTGTGTGTGTGCATGTGTTCAGG - Intergenic
1143340762 17:6208947-6208969 CTGTGCCTGTTTATGTATGCAGG - Intergenic
1143739096 17:8939824-8939846 CTTTTGATATTCATGTATTCTGG + Intronic
1143755918 17:9067512-9067534 CTGTGTAAATTAATGTATCCCGG - Intronic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1148581116 17:48744742-48744764 CTGAGTCTGTTCATGTAAACAGG + Intergenic
1151946673 17:77323494-77323516 CTGTGCATGGTCATGAATGCAGG + Intronic
1152034297 17:77862481-77862503 GTGTGTGTGTTCATGTCTGCAGG - Intergenic
1153834590 18:8952334-8952356 CTGGGTGTGTTCATGGTTTCAGG - Intergenic
1154029330 18:10737988-10738010 CTGTGTATCTTCATGAATGGAGG - Intronic
1154084409 18:11289119-11289141 CTGTGTATCTTACTGTATTATGG - Intergenic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155835432 18:30576787-30576809 TTGTATATTTTCATTTATTCAGG - Intergenic
1158262518 18:55624410-55624432 CAGTGCATGTTCAAGTGTTCTGG + Intronic
1159019029 18:63127812-63127834 TTGTGTATATTCATATATTTTGG - Exonic
1160277706 18:77453059-77453081 CTGTTTATGATCATATATTCAGG - Intergenic
1160541974 18:79628775-79628797 CTGTGTGTCTGCTTGTATTCTGG - Intergenic
1160999707 19:1904414-1904436 CTCTGTGTGTTCATGAATTTTGG - Intergenic
1164541811 19:29127140-29127162 GTGTGAGTGTTCATGTATGCAGG + Intergenic
1164808271 19:31135047-31135069 CTGTATATTTCCATTTATTCAGG - Intergenic
1165192156 19:34073905-34073927 GTGTGTATGTGCATGTGTGCGGG + Intergenic
1166616724 19:44255442-44255464 CAGTTTCTGTTCATTTATTCTGG - Intronic
926845154 2:17128742-17128764 TTTTGTATATTCATATATTCTGG + Intergenic
926888336 2:17617860-17617882 ATGTGCATGTGCATGTATGCAGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
933516347 2:83308548-83308570 CTGTTTATGTTTCTGTGTTCAGG + Intergenic
935120720 2:100181309-100181331 GTGTGTATGTACATGTGTTGGGG + Intergenic
935438038 2:103057884-103057906 ATGTGTCTGTTCTTCTATTCAGG - Intergenic
937962792 2:127474444-127474466 CAGTGTTTGTTCATATATTTAGG - Intronic
938830102 2:135041904-135041926 CTGTACATGTTCACGTAGTCTGG - Intronic
939014718 2:136888973-136888995 GTGTGTGTGTACATGTATTTAGG + Intronic
939384023 2:141473212-141473234 GTATGTATGTTCATTTTTTCAGG - Intronic
940415922 2:153419651-153419673 ATGTGTGTGTGCATGTATTTAGG - Intergenic
941145371 2:161837448-161837470 ATGTGTATCTTCATTTATTTAGG - Intronic
941655421 2:168138582-168138604 CAGTGACTGTTCATGTATACAGG + Intronic
943327498 2:186518744-186518766 ATATGTATATTCATGTATTTAGG + Intergenic
943454278 2:188083761-188083783 TTGTGAATGTTCATGTCATCAGG + Intergenic
944774115 2:202944599-202944621 TTGTTTATGTTCAGGTTTTCTGG + Intronic
945353351 2:208808251-208808273 CTGGGTTTCTTCATGTATGCTGG + Intronic
948161704 2:235830000-235830022 CTGTGTATGTCCAGGTGTCCTGG - Intronic
1169476961 20:5940292-5940314 CTGTGTCAGTTCAGGTCTTCTGG - Intronic
1170338705 20:15299510-15299532 CAGAGTATTTTCATGTATTTTGG + Intronic
1171320870 20:24242969-24242991 CTGTGCATGTGCATGTATGCAGG - Intergenic
1172973316 20:38888864-38888886 GTGTGTGTGTTCAGGGATTCTGG - Intronic
1173111407 20:40193955-40193977 ATGTGTGTGTCCATGTATACTGG + Intergenic
1173121876 20:40300267-40300289 CTGTGTCTGTTCTTGAATTTGGG - Intergenic
1175430056 20:58895218-58895240 GTGTGAATGTTCATGTATCAGGG + Intronic
1177077182 21:16590366-16590388 CTATGTATGTTCTTTTGTTCTGG - Intergenic
1178050361 21:28740308-28740330 TTGTCTATGTTCATGTGTTTTGG - Intergenic
1178886767 21:36490869-36490891 CTGAATATGTTCATGTGTTTGGG - Intronic
1179317304 21:40255189-40255211 CTGTGTATGTTACTGTGTGCTGG + Intronic
1181868350 22:25877249-25877271 CTGGGTATCTTCATGGATGCTGG + Intronic
1183881445 22:40834603-40834625 CTGTGTCTGTTCATTGCTTCTGG - Intronic
1184990628 22:48167034-48167056 CTGTGTGTGTGCATGTATGAAGG - Intergenic
951533437 3:23720103-23720125 TTGTTTATTTTCAAGTATTCTGG + Intergenic
951933044 3:27991280-27991302 CTTTGGATGTTCATGTAAGCAGG - Intergenic
952455831 3:33471127-33471149 CTGTGTGTATTAATATATTCAGG + Intergenic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954936301 3:54330130-54330152 CCTTGCATGTTCATCTATTCAGG - Intronic
955789398 3:62572787-62572809 CTGTGGATTTTGATGTCTTCAGG - Intronic
956453377 3:69396026-69396048 CTTTGTATGTTTATATATTTTGG + Intronic
961133322 3:124488686-124488708 CTGTGTGTGTTTATGTGATCAGG - Intronic
961664009 3:128485351-128485373 CTCTGTATGTGCATGTGTTTGGG - Intronic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
963431919 3:145217676-145217698 CTGTGTATGCTAATGTAGACAGG + Intergenic
963545658 3:146655000-146655022 CAATGTGTTTTCATGTATTCAGG + Intergenic
963546457 3:146664904-146664926 CATTGTATTTTCATGTATACGGG - Intergenic
964723260 3:159789086-159789108 CTGTATATGTGTATGTATACAGG + Intronic
965014148 3:163134273-163134295 TTGTATATGTTCATGTTTTGAGG + Intergenic
965120262 3:164545453-164545475 AAGTGTCTGTTCATGTATTTTGG - Intergenic
966586707 3:181634496-181634518 CTGTGTATGTTTGTGTGTTTAGG - Intergenic
970654718 4:18218506-18218528 CTGTGAATATTTATTTATTCTGG + Intergenic
970721064 4:18988961-18988983 GTGACTATGTTCATGGATTCTGG + Intergenic
972792436 4:42385978-42386000 ATGTGTGTGTTTATGTATACAGG + Intergenic
973757581 4:54091058-54091080 ATCTTTATGTTCATGTACTCAGG - Intronic
974161242 4:58142971-58142993 TTATGTAGGTTCATGTAGTCTGG - Intergenic
974472972 4:62341697-62341719 CTCTGTATGTCCATGTATACTGG - Intergenic
974693622 4:65335628-65335650 GTGTGTATTTTCATGCATTTTGG - Intronic
978340266 4:107715000-107715022 ATCTGTGTGTTTATGTATTCAGG - Intronic
978837108 4:113164041-113164063 CTCTGTATGTTTGTCTATTCTGG + Intronic
979324039 4:119358168-119358190 GTGTGTATGTGCATGTATGAAGG + Intergenic
979815179 4:125092219-125092241 CTGAGTATTTTAATATATTCAGG + Intergenic
981578112 4:146226005-146226027 ATGTGTGTGTGTATGTATTCTGG + Intronic
982806382 4:159770124-159770146 CTGTCTTTATTCATATATTCTGG - Intergenic
982819212 4:159925768-159925790 CTGTATATATTTATGTTTTCAGG + Intergenic
982925256 4:161329088-161329110 GTGTATATGTGCATGTGTTCTGG - Intergenic
983157968 4:164375662-164375684 ATGTGTATGTGCATGTAGTAGGG - Intronic
983241877 4:165242854-165242876 GTGTGTATGTGCATGTATGAAGG + Intronic
983924758 4:173388322-173388344 ATGAGAATCTTCATGTATTCTGG - Exonic
986128279 5:4904040-4904062 ATGTGTATGTGCATGTCTTGGGG - Intergenic
986459720 5:7958122-7958144 GTGTGTGTGTGTATGTATTCAGG + Intergenic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
989086769 5:37685020-37685042 CTGTGCATGTTCATGCAGCCAGG + Intronic
989584484 5:43064022-43064044 CTGTGCAAGTTCTTTTATTCCGG - Intergenic
989998258 5:50861294-50861316 CTGTGTCTGTTGATGTTTCCAGG + Intergenic
992809674 5:80374077-80374099 TTGTTTGTGTTCATGAATTCTGG + Intergenic
994885503 5:105556141-105556163 CTGTATATATTAATGTAGTCAGG + Intergenic
995406769 5:111806675-111806697 CTGTTTAGATTCTTGTATTCTGG + Intronic
995953842 5:117750111-117750133 CTGTGTGTGTCCATTTATCCTGG - Intergenic
998771107 5:145546720-145546742 CTGGTTATGTTCAGGTGTTCAGG + Intronic
999042832 5:148434595-148434617 TTGTGTATGTGTATGTATACAGG + Intronic
999969210 5:156842370-156842392 GTCTATATGTTCATGTCTTCAGG + Intergenic
1002056874 5:176603223-176603245 CTGTGTGTGTACATGTTTTGGGG - Intronic
1006737362 6:36283985-36284007 CTGGAAATGATCATGTATTCAGG - Intronic
1009469966 6:64020395-64020417 ATGTGTATGTTTATGTAATTTGG - Intronic
1010239727 6:73603753-73603775 CTGTATATATTCATGAATTCTGG + Intronic
1011198951 6:84813590-84813612 CTGTGTATTTTAATAAATTCAGG - Intergenic
1011379489 6:86727211-86727233 GTATGTATGTGCATGTATTTAGG + Intergenic
1014695467 6:124615465-124615487 CTTTGTATGTGCATTTATTAAGG - Intronic
1014810194 6:125876820-125876842 CTGTGGATGATCAAGCATTCTGG + Intronic
1015455925 6:133426100-133426122 CTGTAAATGTACATGTATGCAGG - Intronic
1015660648 6:135570379-135570401 CTGTGTATGTTCTTCTACTGTGG - Intergenic
1016319831 6:142830844-142830866 GTGTGGATGTGCATGCATTCTGG - Intronic
1017243018 6:152192417-152192439 TTATGTATGCTCATGTATCCAGG - Intronic
1018412435 6:163565022-163565044 CTGTGTGTGTGCATGCACTCAGG + Intronic
1019403886 7:872448-872470 TTGTGTATGGTCTTGTTTTCAGG + Exonic
1019934968 7:4248335-4248357 ACGTGTGTGTGCATGTATTCAGG - Intronic
1019934979 7:4248673-4248695 GTATGTGTGTGCATGTATTCAGG - Intronic
1019934992 7:4249048-4249070 CTGTGTATGTGTTTGTATTTAGG - Intronic
1020416953 7:7957395-7957417 TTGTGTTTGTTCATGTGATCAGG + Intronic
1021141203 7:17028029-17028051 CTGTGTTGGTTCCTGTGTTCAGG + Intergenic
1021191409 7:17624045-17624067 TTGTATATTTTCATGCATTCTGG - Intergenic
1022492224 7:30829916-30829938 GTGTGTGTGTGCATGTTTTCTGG + Intronic
1022624285 7:32018604-32018626 CTGTGTAGATTCACCTATTCTGG - Intronic
1027575669 7:79927819-79927841 GTGAGTATGTGCATATATTCAGG - Intergenic
1028869979 7:95759447-95759469 CTGTGTATGTGCCTTTAATCAGG - Intergenic
1030665852 7:112277418-112277440 GTGTGTATGTTAATTTTTTCTGG - Intronic
1031281198 7:119801818-119801840 CTATGGATGTTCATGTAAACAGG + Intergenic
1031642183 7:124178784-124178806 CTGTGTGTTTTAATGCATTCAGG - Intergenic
1031787603 7:126053952-126053974 CTATTTATTTTCTTGTATTCAGG - Intergenic
1033469011 7:141626922-141626944 CTGTGTATGTTCTTGTTCTTAGG + Intronic
1033759147 7:144421684-144421706 CTGGGTATGTTTATCTATTGAGG - Intergenic
1036643381 8:10597773-10597795 GTGTTTATGTGCATGTATTGGGG - Intergenic
1037632301 8:20669247-20669269 TTGTGTATGTTCATGTGCTTTGG + Intergenic
1037987863 8:23300810-23300832 GTGTGTATCTCCCTGTATTCTGG - Intronic
1038570326 8:28656645-28656667 CTGTATTTTTTCAAGTATTCAGG + Intronic
1039884844 8:41649008-41649030 CTGTGTGTGTACCTGCATTCAGG + Intronic
1040799621 8:51326002-51326024 CTGTGTCTGTTGATGTGCTCAGG + Intronic
1041744734 8:61196498-61196520 ATGTGTTTATTCATGTATTTTGG + Intronic
1041956825 8:63565600-63565622 CTGTGTTTGTTCATTTCTCCGGG + Intergenic
1043920393 8:85976192-85976214 GAGTGCATGTGCATGTATTCTGG - Intergenic
1044155211 8:88838032-88838054 CTGTGTATGTCTATGTTTTGGGG + Intergenic
1044422979 8:92019985-92020007 ATGTATATGTGCATATATTCAGG + Intronic
1045818949 8:106312243-106312265 CTGTTTATCTTAATGTACTCAGG - Intronic
1048550230 8:135427151-135427173 AAGTGTATGTTAATGTATTTGGG + Intergenic
1048718248 8:137292647-137292669 TTGTGTATGTTTATATATTATGG + Intergenic
1048720939 8:137323691-137323713 TTTTGTGTGTTCATATATTCAGG - Intergenic
1048748887 8:137648372-137648394 CTGGGTATGTTTATGTACACAGG - Intergenic
1049078554 8:140421453-140421475 CTTTGTATGTTTTTGTTTTCTGG + Intronic
1051496798 9:17732428-17732450 CCTTGTCTGTTAATGTATTCTGG + Intronic
1051694115 9:19750187-19750209 CAGTGAATCTTCCTGTATTCTGG - Intronic
1052275273 9:26668236-26668258 CTGAGTATGATCCTGTATTATGG - Intergenic
1052405631 9:28056559-28056581 CTGTGTAGGGTGCTGTATTCAGG - Intronic
1055325648 9:75125692-75125714 CTAAGTATTTTCATGTATTATGG + Intronic
1055700998 9:78945900-78945922 CTCTTTATGGTCATGTGTTCAGG + Intergenic
1057523709 9:95781488-95781510 GTGTGTGTGTGCATGTATTGGGG - Intergenic
1060575507 9:124688810-124688832 GTGTTTATGTACATGTATTTAGG + Intronic
1062316151 9:135967948-135967970 GTGTGCATGTTCATGTGTGCGGG + Intergenic
1185795905 X:2964194-2964216 CTGTGAATGTTCATTTGTGCTGG - Intronic
1186061940 X:5718463-5718485 CTCTGTATGTTCCTGCATTTTGG - Intergenic
1186703815 X:12120750-12120772 ATGTGTATATTCATCTATGCTGG + Intergenic
1186808927 X:13167827-13167849 CTGTGTATCTTCGTACATTCTGG + Intergenic
1187607295 X:20899420-20899442 CTGTGTGTGTTCATGGGTTGGGG + Intergenic
1189681658 X:43522798-43522820 CCTTGTATGTGCATATATTCAGG - Intergenic
1190520112 X:51269758-51269780 CAGTTTTTCTTCATGTATTCCGG - Intergenic
1190593533 X:52029748-52029770 ATGTGTATGATCATGTCTTCTGG - Intergenic
1190709766 X:53058814-53058836 GTGTGTAGGTTCATGTAGTTTGG + Intronic
1191874807 X:65785771-65785793 CTATGTACGTTCAAGTATTCAGG - Intergenic
1195514350 X:105755989-105756011 CTGTGTATGTGTATGCACTCTGG - Intronic
1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG + Intergenic
1197894337 X:131295184-131295206 GTTTGTATATTTATGTATTCAGG - Intronic
1197973534 X:132140571-132140593 CTATGTATGTTTATCTGTTCAGG + Intergenic
1198879704 X:141266047-141266069 CTATGTCTGTTCATTTATTCAGG - Intergenic
1199169000 X:144713794-144713816 GTGTGTATGTGTGTGTATTCAGG - Intergenic
1199331783 X:146569211-146569233 TTGTGTGTGTCCATGTGTTCGGG + Intergenic