ID: 1079163014

View in Genome Browser
Species Human (GRCh38)
Location 11:18012411-18012433
Sequence CCGGTTCTTGCATGTGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079163014_1079163022 7 Left 1079163014 11:18012411-18012433 CCCCCAACACATGCAAGAACCGG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1079163022 11:18012441-18012463 AGAGTGTCAGCAAATAGGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 224
1079163014_1079163021 6 Left 1079163014 11:18012411-18012433 CCCCCAACACATGCAAGAACCGG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1079163021 11:18012440-18012462 CAGAGTGTCAGCAAATAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 203
1079163014_1079163023 25 Left 1079163014 11:18012411-18012433 CCCCCAACACATGCAAGAACCGG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1079163023 11:18012459-18012481 CAGGGTCTGTGCCTTGTGCGCGG 0: 1
1: 0
2: 0
3: 20
4: 208
1079163014_1079163020 2 Left 1079163014 11:18012411-18012433 CCCCCAACACATGCAAGAACCGG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1079163020 11:18012436-18012458 ACAGCAGAGTGTCAGCAAATAGG 0: 1
1: 0
2: 0
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079163014 Original CRISPR CCGGTTCTTGCATGTGTTGG GGG (reversed) Intronic
903194521 1:21674878-21674900 CTGGTTCTGTCATTTGTTGGGGG + Intergenic
905673348 1:39807849-39807871 CTGGTTCTTGCATTTTTTGGTGG + Intergenic
906157005 1:43619732-43619754 CCGGTTCTTGAACTTGTTGCAGG - Exonic
906703679 1:47878458-47878480 CCTGATGTTGCCTGTGTTGGTGG - Intronic
907827268 1:58030876-58030898 CCAGTTATTGCATGTCTTGAAGG - Intronic
909059282 1:70861429-70861451 CAGGTTGTTGCAGGTGTTGCAGG - Intronic
912355629 1:109052814-109052836 CTGGTTTTTGCATTTTTTGGTGG + Intergenic
913142799 1:115958087-115958109 CTGGTTATTGCATTGGTTGGAGG - Intergenic
915984702 1:160452750-160452772 CCTGTCCTTGCATTTCTTGGTGG + Intergenic
916671886 1:167029410-167029432 CTGGTTTTTGCATTTTTTGGTGG + Intergenic
919004862 1:191884407-191884429 CTGGTTCTTTCATGTTTTGGGGG - Intergenic
920144037 1:203842430-203842452 CTGGTGTTTGCATGTTTTGGTGG - Intronic
922699724 1:227751626-227751648 CTGTTTCTTGCATGTCCTGGAGG - Intronic
1065652151 10:27903784-27903806 GGGTTTCTTGCATGTATTGGTGG - Intronic
1066115364 10:32234105-32234127 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1069886126 10:71624880-71624902 GCACTTCTTGCATGTGTTGCAGG + Intronic
1076114172 10:127884005-127884027 CTTGTTCTTGCATGGGTTGGAGG - Intronic
1079163014 11:18012411-18012433 CCGGTTCTTGCATGTGTTGGGGG - Intronic
1082237605 11:49838264-49838286 CAGTTTCTTGTATTTGTTGGGGG + Intergenic
1082871137 11:57944465-57944487 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1083743149 11:64721787-64721809 CCTGTTTTTTCATGTGTTGGCGG - Intronic
1084813049 11:71627151-71627173 CCTGTTCTTGGTTGTGCTGGGGG + Intergenic
1086466310 11:87057439-87057461 CTGATTCTTGTATCTGTTGGGGG + Intronic
1086614929 11:88805046-88805068 CCTGTAAATGCATGTGTTGGAGG + Intronic
1086696735 11:89855986-89856008 CAGTTTCTTGTATTTGTTGGGGG - Intergenic
1086709423 11:89988504-89988526 CAGTTTCTTGTATTTGTTGGGGG + Intergenic
1089510289 11:118992349-118992371 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1090686548 11:129128747-129128769 CTGGTTTTTGCATTTTTTGGTGG + Intronic
1096717922 12:53502032-53502054 CGGGGTCTTGCCTGGGTTGGCGG - Exonic
1099892809 12:88610395-88610417 CAGGGTCTTTCAGGTGTTGGGGG + Intergenic
1107546080 13:41434855-41434877 TCTGTTCTTGCTTGTGGTGGGGG - Intergenic
1107562565 13:41571512-41571534 CTGGTTTTTGCATTTTTTGGTGG + Intronic
1110192528 13:72747434-72747456 CCAGACCTTGCATGTTTTGGGGG - Intronic
1113583540 13:111447191-111447213 CCTGTTGCTTCATGTGTTGGGGG + Intergenic
1119085872 14:71738430-71738452 CCGGTGCCTGCATGTGTTTGGGG + Intronic
1119722160 14:76898700-76898722 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1120193881 14:81462971-81462993 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1122027239 14:98886864-98886886 CCTGTTCTTTCATGTCTGGGAGG - Intergenic
1124478607 15:30058638-30058660 CCTGGTTTTGCATGTGTTGTTGG + Intergenic
1125880792 15:43192933-43192955 ACAGTTCTTGCATGCGTTTGGGG + Intronic
1126331044 15:47531849-47531871 CTGTTCTTTGCATGTGTTGGAGG + Intronic
1127944403 15:63735837-63735859 CCTGTTCTTAACTGTGTTGGAGG - Intronic
1128182301 15:65614760-65614782 CAGGGTCTGGCATGTGATGGTGG + Intronic
1132158889 15:99518331-99518353 CTGGTTCTTTCCTGTGTTGTGGG + Intergenic
1134237131 16:12475328-12475350 CCAGATCTTGGATATGTTGGTGG + Intronic
1136588235 16:31201693-31201715 CCGCATCTTGCTTGGGTTGGTGG + Exonic
1145086914 17:19950473-19950495 CTGGTTTTTGCATTTTTTGGTGG + Intronic
1150166759 17:62951161-62951183 ACTGAGCTTGCATGTGTTGGGGG - Intergenic
1151538336 17:74750930-74750952 CAGATTCCTGCATGTTTTGGAGG + Intronic
1152267570 17:79305204-79305226 AGGGTTCTTGCCTGTGTGGGGGG + Intronic
1152419097 17:80182530-80182552 CCGATTCTTACATGTGCGGGGGG + Intronic
1159722370 18:71907680-71907702 CCAATTTTTCCATGTGTTGGGGG - Intergenic
1163799154 19:19354563-19354585 CCAGTTCTAGCATGGGTAGGGGG + Intronic
1164012275 19:21213272-21213294 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1164168673 19:22703686-22703708 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1164651264 19:29892546-29892568 CGGCTTCTTGCCTGCGTTGGAGG - Intergenic
1165411546 19:35665502-35665524 CTGGTCCATGCGTGTGTTGGGGG + Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926979018 2:18546927-18546949 CCTGTGCTTTCATGGGTTGGTGG + Intergenic
937734986 2:125277615-125277637 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
940817422 2:158311303-158311325 CTGGTTCTTGTATTTTTTGGTGG - Intronic
940846358 2:158646811-158646833 TGGGTTCATGCATGTGATGGCGG - Intronic
946859993 2:223991759-223991781 CCTGTTCTAGGATGTGCTGGCGG - Intronic
948638028 2:239352783-239352805 CCGGTACTTGTATGTGTTGGTGG - Exonic
1174837068 20:53866640-53866662 CCGCTGCTTGTATTTGTTGGGGG + Intergenic
1175219538 20:57409021-57409043 ACGGTTCCTGCCTGTCTTGGGGG + Exonic
1177735325 21:25081976-25081998 CAGGTTATTGTGTGTGTTGGGGG - Intergenic
1183537322 22:38410529-38410551 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
965408977 3:168306178-168306200 CTGGTTCTTCTCTGTGTTGGAGG + Intergenic
970622598 4:17839414-17839436 CCAGTTGCTGCATGTTTTGGAGG - Intronic
973263236 4:48186021-48186043 CTGGTTTTTGCATTTTTTGGTGG + Intronic
978194369 4:105953815-105953837 CCAGTTCTGGCATTTGTTGTTGG - Intronic
982285052 4:153725410-153725432 CTGGTACTGGCAGGTGTTGGGGG - Intronic
983628639 4:169827967-169827989 CTGGTTTTTGCATTTTTTGGTGG + Intergenic
984229204 4:177073972-177073994 ACGGTACTGGCATGTGTTAGAGG + Intergenic
985087357 4:186326375-186326397 CAGGTTCTTTAATGTATTGGTGG + Intergenic
989174206 5:38505344-38505366 CTGTATCTTGCATGTGGTGGTGG + Intronic
992415944 5:76551686-76551708 CTGGTTTTTGCATTTTTTGGTGG - Intronic
997732179 5:136189756-136189778 CCAGTCCTTGCATTTGTTTGTGG + Intergenic
998130609 5:139649484-139649506 CCGCTTCTTCCAAGTGGTGGGGG - Intronic
999279176 5:150353705-150353727 CTGGTTCCTGGAGGTGTTGGTGG + Intergenic
1000103573 5:158037827-158037849 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1000496021 5:161986276-161986298 CAGGTATTTGCGTGTGTTGGGGG + Intergenic
1000630384 5:163584417-163584439 CTGGTTTTTGCATTTTTTGGTGG - Intergenic
1002626301 5:180531816-180531838 CTGGTTCTTGCATTTTTTGGTGG - Intronic
1004802199 6:19161423-19161445 CTGGTTTTTGCATTTGGTGGAGG + Intergenic
1005401090 6:25435470-25435492 CCGGTTCTTGCAGATGATTGTGG + Exonic
1008022221 6:46592554-46592576 CCTGTTCTTGCATATGTATGTGG - Intronic
1008106436 6:47444468-47444490 CCGGTTTTTGTATTTTTTGGTGG - Intergenic
1011452450 6:87509037-87509059 CAAGTTCTTGCAAGTGTTGGTGG + Exonic
1014753417 6:125277822-125277844 CCGGTATGTGCATGTGTTGCAGG + Intronic
1018239204 6:161755532-161755554 CTGGTACTTTCATATGTTGGGGG + Intronic
1018657350 6:166051160-166051182 CCGTATCTTGGATGTGGTGGTGG - Intergenic
1020312950 7:6883228-6883250 TCTGTTCTTGGATGTGCTGGGGG - Intergenic
1027826682 7:83124918-83124940 CTGGTTTTTGCATTTTTTGGTGG + Intronic
1032890393 7:136189161-136189183 CTGCTTCTTGCTTGTTTTGGGGG - Intergenic
1036818886 8:11923423-11923445 CCTGTTCTTGCTTGTGGTGGGGG - Intergenic
1041201339 8:55453771-55453793 CCAGTTCTTGGATGTGATGCAGG + Intronic
1045022038 8:98052349-98052371 CTGGTTTTTGTATTTGTTGGTGG - Intergenic
1052338504 9:27342630-27342652 CTGGTTTTTGCATTTTTTGGTGG + Intronic
1056956325 9:91084553-91084575 CAGGTTCTTACATGTGCTTGCGG + Intergenic
1060657242 9:125380527-125380549 CAGGTCCTTCCATCTGTTGGGGG + Intergenic
1061977176 9:134075323-134075345 CTGGTTTTTGCATTTTTTGGTGG + Intergenic
1192739788 X:73881850-73881872 CTGGTTTTTGCATTTTTTGGTGG + Intergenic
1194157438 X:90409464-90409486 CTGATTCTTGACTGTGTTGGTGG - Intergenic
1194662641 X:96643612-96643634 CTGGTTCTGACATGTGTGGGTGG + Intergenic
1200503771 Y:3986445-3986467 CTGATTCTTGACTGTGTTGGTGG - Intergenic
1202056479 Y:20837782-20837804 CCTGTGCTTGCATGTTTTTGTGG - Intergenic