ID: 1079170319

View in Genome Browser
Species Human (GRCh38)
Location 11:18087949-18087971
Sequence CTAATGTAGCACTATGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079170315_1079170319 6 Left 1079170315 11:18087920-18087942 CCAAGTGGGGTAATTACAATAAA 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1079170319 11:18087949-18087971 CTAATGTAGCACTATGGGCTAGG 0: 1
1: 0
2: 1
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079170319 Original CRISPR CTAATGTAGCACTATGGGCT AGG Intronic
906005866 1:42469615-42469637 CTAAGGAAGCAGTATGGGATGGG + Intronic
906925006 1:50106156-50106178 CTTACGTGGCACAATGGGCTAGG - Intronic
909509164 1:76431781-76431803 CAAATGTACCACTCTGGGCGGGG - Intronic
910497801 1:87852536-87852558 ATAAGGTAGCACTTTGGGCCTGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912693891 1:111825862-111825884 CTAAAGTAGCACTATTTCCTCGG + Intronic
912820098 1:112860525-112860547 CTAAAGTACCATAATGGGCTAGG - Intergenic
913462834 1:119106264-119106286 CAAATGTACCACTATGGTGTGGG - Intronic
920744453 1:208613439-208613461 CCCATGCAGCTCTATGGGCTTGG - Intergenic
924159440 1:241215877-241215899 CCAATGGAGCACTCTGGTCTTGG - Intronic
924204114 1:241693580-241693602 CCAATGTAGCACTGTGGTGTGGG + Intronic
1065173898 10:23058606-23058628 GGAATTTTGCACTATGGGCTGGG - Intergenic
1067557267 10:47281689-47281711 CTAATATAGCACCATGGGTGTGG + Intergenic
1067804789 10:49385131-49385153 CCAATGTTGCTCTATGGGGTTGG + Intronic
1071091708 10:81926414-81926436 CTAAAGTAGCATTATGGGCTGGG - Intronic
1071858236 10:89646841-89646863 CTAATGTAGCCCTAAGGGTCAGG - Intergenic
1073368984 10:102969505-102969527 CTAAGATAGCACTACTGGCTGGG - Intronic
1073849523 10:107598823-107598845 CTACTGTAACAATATGTGCTTGG - Intergenic
1079170319 11:18087949-18087971 CTAATGTAGCACTATGGGCTAGG + Intronic
1087255993 11:95954225-95954247 ATAATGTAGGAATATGGGATGGG - Intergenic
1088453473 11:110008132-110008154 CTCATGCAGCACTATGTGCTAGG + Intergenic
1088976813 11:114823091-114823113 CTTATGCAGTACTAGGGGCTTGG + Intergenic
1089339214 11:117746249-117746271 CTTATATAGCACTATGTGCCAGG - Intronic
1089344061 11:117778824-117778846 CTAATGCAGCACCAAGTGCTGGG - Intronic
1095110275 12:38287408-38287430 GTAAGGTAACACTATGAGCTTGG + Intergenic
1095943894 12:47743131-47743153 CTTATGTATCACTATGTGCCGGG + Intronic
1097393112 12:59040004-59040026 TTAATGAACCACTTTGGGCTTGG - Intergenic
1098000897 12:65941514-65941536 CTAATTTAGCACTATTTTCTTGG - Intronic
1098310548 12:69144520-69144542 TTAAGGTAGCAATCTGGGCTGGG - Intergenic
1100494145 12:95109296-95109318 CTAAGGGAGCACTATGGCCTTGG - Intronic
1100619976 12:96261713-96261735 GCAATGGAGCACTATTGGCTGGG + Intronic
1102023607 12:109700541-109700563 ATAATTTTGCACTATTGGCTTGG - Intergenic
1111454465 13:88462234-88462256 CAAATGTAGCACTTTGGTGTGGG - Intergenic
1113088688 13:106594712-106594734 CTAATGTTGCAGAATGGGGTGGG + Intergenic
1115224297 14:31087249-31087271 CTAAAGTAGCTCTATGGATTGGG - Intronic
1117651359 14:57909232-57909254 CAAATATACCACTATGGGGTGGG - Intronic
1118424174 14:65640651-65640673 CTAATGTAGCACTTTGTTTTGGG - Intronic
1118981415 14:70719875-70719897 CTAAAGGAGCACTGTGGGCTGGG - Intergenic
1119457950 14:74772650-74772672 AGAATGTAGAACTATTGGCTGGG - Intronic
1128548251 15:68581493-68581515 CTAATTTAGGACTAGGGGCCAGG - Intronic
1135608722 16:23846312-23846334 AGAATGTAAAACTATGGGCTGGG + Intronic
1136747377 16:32603139-32603161 AGAATGTATCACTATTGGCTCGG - Intergenic
1138247807 16:55480093-55480115 CTAATGTAGGACTTTGGGAACGG + Intronic
1139024961 16:62805262-62805284 CTAATCTAGCAGGTTGGGCTGGG + Intergenic
1139249156 16:65478172-65478194 TAAATGAAGCACTATGGGGTAGG - Intergenic
1203049512 16_KI270728v1_random:862345-862367 AGAATGTATCACTATTGGCTCGG - Intergenic
1148032388 17:44630186-44630208 CATATGTAGCACCAGGGGCTGGG + Intergenic
1148186051 17:45644548-45644570 CTAATGAAGCACACTGGGCTTGG + Intergenic
1148461126 17:47839566-47839588 TTACTGGAGCACTATGGGCAGGG - Exonic
1149869861 17:60171599-60171621 CTACTGGAGCACTGTGTGCTTGG + Intergenic
1153152386 18:2110114-2110136 CAAATGTACCACTCTTGGCTGGG + Intergenic
1153558150 18:6339954-6339976 CTAGTGAAGCTCTCTGGGCTTGG - Intronic
1158118476 18:54023227-54023249 CTAATTTAAGACTATGTGCTGGG - Intergenic
925901083 2:8509975-8509997 CCAATGTACCACTTTGGGGTGGG - Intergenic
928148543 2:28805425-28805447 AGAATGTAGCTCTATGGGCAGGG + Intronic
929856288 2:45640931-45640953 CTCATGTAGCAGTATTGGGTAGG - Intergenic
933670846 2:85005803-85005825 CTGAAATATCACTATGGGCTGGG - Intronic
939977940 2:148741307-148741329 CTTATATAGTACTATGGGCAAGG - Intronic
942110997 2:172682656-172682678 CTTATGTAACAGTCTGGGCTGGG - Intergenic
943042565 2:182820821-182820843 CTATTGTAGCACTACTGGCAAGG + Intergenic
943343453 2:186709166-186709188 CTCATGTAGCACCATGCCCTGGG - Intronic
944759699 2:202801795-202801817 TTAATGTAGAATTGTGGGCTCGG - Intronic
946842770 2:223835213-223835235 CTATTCTAGCAGTATGGCCTTGG - Intronic
1170432366 20:16288148-16288170 CTAATGCAGCACCATGAGCAGGG + Intronic
1174987368 20:55470137-55470159 CTAATAAAGCAATATAGGCTGGG - Intergenic
1184472677 22:44704562-44704584 CTGATGTAGGCCTAAGGGCTGGG - Intronic
953615183 3:44483503-44483525 CTAATGTACCACTGTGGTTTGGG - Intergenic
954379629 3:50212765-50212787 CAAACGTAGCACTCAGGGCTAGG - Intronic
959157188 3:102681098-102681120 TTCATGTAGCAGTATGTGCTAGG + Intergenic
962323606 3:134412976-134412998 CAAATGTAGCACTTTGGTGTGGG + Intergenic
962499309 3:135973786-135973808 CTAATTTATCACTATGTGCCAGG + Intronic
966949996 3:184807715-184807737 CTAATGTAGCACTCTGGTGGAGG - Intergenic
968312618 3:197696541-197696563 AAAATGTAGAACTTTGGGCTGGG + Intronic
970031682 4:11683277-11683299 GGAATGTAACACAATGGGCTGGG + Intergenic
977018678 4:91730713-91730735 CTGATGCAGCACTATGGTATAGG - Intergenic
977473597 4:97474128-97474150 CAAATGTACTACTATGGTCTAGG + Intronic
977490311 4:97701760-97701782 CTTATGTAGAGCTATGGGATTGG - Intronic
980453158 4:133002601-133002623 CTAATTGAGCAATCTGGGCTTGG - Intergenic
984368107 4:178824202-178824224 CTAATGTAGTACCAAGTGCTTGG + Intergenic
992226269 5:74622079-74622101 CAAATGTACCACTCTGGGCTGGG - Intergenic
994281787 5:97912952-97912974 ATAACGTAAGACTATGGGCTTGG - Intergenic
994796479 5:104307132-104307154 TGAATGTATCACTATGGGCAGGG + Intergenic
996578528 5:125003270-125003292 CTAATGTGGGACTCTGGGGTGGG + Intergenic
999600460 5:153257352-153257374 CTAATTTAGTACTGTGGGGTGGG - Intergenic
999713091 5:154335774-154335796 CAAATGTACCACTATGGTATGGG - Intronic
1003965133 6:11245720-11245742 CAAATGTAGCACTTTGGCATTGG - Intronic
1006989999 6:38207176-38207198 ATAATGAAGGACTATGAGCTGGG + Intronic
1010424188 6:75707980-75708002 CCAATGAAGCACTATGGGGCCGG - Intronic
1010473509 6:76259344-76259366 CTTATGTAACACTATGTGCCAGG + Intergenic
1012701937 6:102469263-102469285 CAAATGTAGCACTGTGGCATAGG - Intergenic
1025620651 7:63167111-63167133 CTTATTTAGAAATATGGGCTGGG - Intergenic
1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG + Intronic
1031366924 7:120912715-120912737 ATAAAGAAGCATTATGGGCTGGG + Intergenic
1042820068 8:72920673-72920695 CTAATGTAGCACTAAAGACCAGG + Intronic
1046406834 8:113784719-113784741 CTAATTTAGCAATTTGGGGTGGG - Intergenic
1047387623 8:124424749-124424771 CTAGTGAAGCACTGTGGGCTTGG - Intergenic
1047732637 8:127738966-127738988 CTCATGGAGCACCAGGGGCTCGG - Exonic
1061718470 9:132536687-132536709 TAAAAGTAGAACTATGGGCTGGG - Intronic
1187717907 X:22121886-22121908 CAGATGTAGCAGTATGGGGTGGG - Intronic
1189714154 X:43847397-43847419 CTCATGAAGCACTTTGGTCTGGG + Intronic
1189725437 X:43964110-43964132 CTAAGGTAGCACTCTGGGGACGG - Intronic
1192349052 X:70340271-70340293 CTTCTATAGCATTATGGGCTAGG - Intronic
1199463787 X:148113316-148113338 CTTATATAGCACTATGTGCCAGG + Intergenic
1199972250 X:152870035-152870057 CTAATGTGGGACACTGGGCTGGG + Intergenic