ID: 1079170603

View in Genome Browser
Species Human (GRCh38)
Location 11:18091565-18091587
Sequence TAGGTTAAGAAAACTGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079170603 Original CRISPR TAGGTTAAGAAAACTGTTCT AGG (reversed) Intronic
902587360 1:17448461-17448483 TAAGTTAAGAAACTTGTTCACGG + Intergenic
903076443 1:20771073-20771095 TAGTTTAATAAATCTTTTCTAGG - Exonic
903188735 1:21644410-21644432 GAGGTTAAGTAACCTGTTCAAGG - Intronic
903573508 1:24323218-24323240 CAGTTTGAGAACACTGTTCTAGG - Intronic
904900537 1:33853773-33853795 TGGGTTAAGAACACTTTTATTGG + Intronic
906244217 1:44261903-44261925 TAGGTTAGGAGAACAGCTCTGGG - Intronic
906627296 1:47335144-47335166 TAGGTCAAAAAAACTTTTGTTGG - Intronic
907902069 1:58750135-58750157 ATGGTTAAGAATACTGTCCTGGG + Intergenic
908243300 1:62206427-62206449 TTAGTTAAGAAAACTATGCTGGG - Intronic
908641338 1:66227276-66227298 TAGGTTAAGAACACTGGTTCAGG + Intronic
908710856 1:67012404-67012426 TAGGTTTAGAAATGTGTTCTTGG - Intronic
909802710 1:79832573-79832595 TAGTTTAATAAAAATGTTCAAGG + Intergenic
910065503 1:83145844-83145866 AAGGTTGAGAAAACTGTGCCCGG + Intergenic
910184315 1:84520267-84520289 GATGTTAAGAAAACTAGTCTTGG + Intergenic
912014549 1:105016787-105016809 TAGGTTTAAAAAACTGTGCAGGG + Intergenic
912050155 1:105519532-105519554 CAGCTAAAGAAAACTGTTCCTGG + Intergenic
913251563 1:116916155-116916177 AAGTTTAAGTAAAATGTTCTGGG + Intronic
913424341 1:118710293-118710315 TAGGTTATAAACACTGTGCTAGG + Intergenic
913964102 1:143360590-143360612 TAGGTAAGGAACACTGTTCTAGG + Intergenic
914035600 1:144000044-144000066 TACGTTAAGAATACCATTCTGGG - Intergenic
914058467 1:144186194-144186216 TAGGTAAGGAACACTGTTCTAGG + Intergenic
914120681 1:144780177-144780199 TAGGTAAGGAACACTGTTCTAGG - Intergenic
914153853 1:145067901-145067923 TACGTTAAGAATACCATTCTGGG + Intronic
914678122 1:149919386-149919408 TGGGTCCAGAAAACTCTTCTTGG + Intergenic
914719288 1:150276243-150276265 TAGGTTAACAAATCTGTTTTGGG - Intronic
915042049 1:152976759-152976781 GAGGTTAAGGAACTTGTTCTAGG - Intergenic
917688652 1:177444769-177444791 TTTCTTAAGAAATCTGTTCTTGG + Intergenic
918566371 1:185938206-185938228 TAATTGAAGAAAACTGTTCTAGG + Intronic
918981483 1:191565857-191565879 TATGTTAAAAAAAATGGTCTAGG + Intergenic
920471065 1:206230924-206230946 TACGTTAAGAATACCATTCTGGG - Intronic
921478149 1:215634290-215634312 AAAGTTGAGAAAGCTGTTCTAGG + Intronic
923885057 1:238145483-238145505 TAAACTAAAAAAACTGTTCTTGG + Intergenic
1063503060 10:6571993-6572015 CAGGTTAAGAAACTTGATCTAGG - Intronic
1064943841 10:20766252-20766274 GTGATTAAGAAAATTGTTCTTGG - Intergenic
1065382326 10:25102769-25102791 AGGGTTAAAAAAATTGTTCTGGG + Intergenic
1065977004 10:30850454-30850476 TAGGTCAAGGAATCTGTTCTGGG - Intronic
1066086085 10:31973119-31973141 TAGGTTTAATAAACTGTTCAGGG - Intergenic
1066995908 10:42562875-42562897 AAGGTTAAAAAAAAAGTTCTTGG - Intergenic
1068524503 10:58112586-58112608 TAGGGGAAGAAAACTATTTTAGG - Intergenic
1069522067 10:69130380-69130402 TAGGTTAAGAATACTTTGCTTGG + Intronic
1069665936 10:70158436-70158458 TAGGTTGAGATAACTGGCCTGGG - Intronic
1071145785 10:82569341-82569363 TAGGTTAAGCAGCTTGTTCTAGG - Intronic
1071275501 10:84050681-84050703 TATGTTAAGGAAGCTCTTCTGGG - Intergenic
1071421677 10:85506271-85506293 TAGGTTAAGAAAATTGAGATGGG + Intergenic
1072972736 10:100031149-100031171 CAGGTTAAGAAAGCTTTTCATGG + Intergenic
1073392619 10:103192445-103192467 TAGTTTAAGAAAAACGTTTTGGG - Intronic
1073499462 10:103922743-103922765 TAGAATAAGAAAACATTTCTGGG + Intergenic
1073899221 10:108200334-108200356 TACGTTAAGTAATTTGTTCTAGG - Intergenic
1074513011 10:114136391-114136413 TAAAATAAAAAAACTGTTCTTGG - Intronic
1074643367 10:115414926-115414948 TAGGTTAACAAATCTATTCGGGG + Intronic
1074706565 10:116138157-116138179 TGGGTTAATAAAACTTTGCTTGG + Intronic
1075048835 10:119166727-119166749 GAGGTTAAGAAAAGTGAGCTAGG - Intergenic
1075387125 10:122062959-122062981 GAGGTTAAGGAACTTGTTCTAGG + Intronic
1077960186 11:7068452-7068474 TAGTTGAAGAAAAAAGTTCTAGG - Intronic
1079170603 11:18091565-18091587 TAGGTTAAGAAAACTGTTCTAGG - Intronic
1080301803 11:30792761-30792783 AAGGTTAGGAAAGCTGTTATGGG + Intergenic
1080483643 11:32679747-32679769 AAGGTTAAGAAAGCTTTTGTGGG - Intronic
1080761870 11:35258608-35258630 TAGGTTAAGGAGACAGTTCCTGG - Exonic
1080860988 11:36150044-36150066 TAGTTCAAGAAAGCTGTTTTGGG - Intronic
1081536553 11:44000950-44000972 TAAGTTAAGAAAATTGAGCTGGG + Intergenic
1082228517 11:49736828-49736850 CAGGTTAAGAAACCTGTCCAGGG + Intergenic
1085752822 11:79177101-79177123 TCGTTTAAAACAACTGTTCTAGG - Intronic
1088127009 11:106439127-106439149 TAAGATACGAAAATTGTTCTGGG + Intergenic
1090059029 11:123447914-123447936 TAGGTTAAGATAACTATTGTGGG - Intergenic
1090901283 11:131033914-131033936 TAGGATAAGAAACTTGTTCAAGG + Intergenic
1091436864 12:480291-480313 TAGGGTAAGAATACTCTTGTGGG + Intronic
1092733658 12:11558489-11558511 TAGGGTGACAGAACTGTTCTGGG - Intergenic
1093045550 12:14439887-14439909 TAGGTGTCGAAAACTGTTTTAGG - Intronic
1093913562 12:24774765-24774787 TAGGTATAGACAACTCTTCTGGG - Intergenic
1094535722 12:31321370-31321392 TACCTTAAGAAAGCAGTTCTGGG - Intronic
1094543839 12:31385648-31385670 TGGTTTAAGAAAATGGTTCTGGG - Exonic
1095750115 12:45701043-45701065 TATGTTAGAAAAACTGTTGTAGG + Intergenic
1098294357 12:68989383-68989405 TAGGTAAAGAAAACTTTTTATGG + Intergenic
1099113757 12:78596868-78596890 TAGGTTTAGAAAAGTATTCCAGG - Intergenic
1099294940 12:80818433-80818455 AAGGTTAAGAAATGTGTCCTAGG + Intronic
1099574917 12:84365921-84365943 TAAGTTAAGAAAACTGGGCCAGG - Intergenic
1099743506 12:86671220-86671242 TAGAGTATAAAAACTGTTCTTGG - Intronic
1099988862 12:89701513-89701535 AAGGTTAAGGAAATTTTTCTGGG + Intronic
1100077118 12:90798925-90798947 TAGGTCAAAAAACCTGCTCTAGG + Intergenic
1100419149 12:94413239-94413261 GAGGTAAAGAAAATTGTTCAAGG - Intronic
1102133896 12:110556585-110556607 AAGGTAAAGAAAACTGTTAAAGG + Intronic
1102575769 12:113855262-113855284 TGGGGAAAGAACACTGTTCTGGG + Intronic
1102662364 12:114540540-114540562 GAGGATAAGAAAAGTGGTCTTGG + Intergenic
1102665595 12:114569918-114569940 TATTTTTAGAAAGCTGTTCTTGG - Intergenic
1105488368 13:20860262-20860284 AAGGTTAAAAAAATTGTTTTTGG - Intronic
1107818876 13:44268343-44268365 TAGATTAAGCAAAATGTGCTAGG + Intergenic
1109274782 13:60291327-60291349 TATGCTAAGAATACTGTTCTGGG - Intergenic
1110202624 13:72870653-72870675 TATGTTAAGAAGTCTGTTGTAGG + Intronic
1112193343 13:97199788-97199810 TAAGATAAGAAAACTATTCAAGG - Intergenic
1112619329 13:101038670-101038692 TAGCTAAAGAAGACTTTTCTGGG + Intergenic
1112695550 13:101944185-101944207 TAGATAAAGAAAACTGGGCTTGG - Intronic
1112738887 13:102451943-102451965 TAGGCTAACATAAGTGTTCTGGG - Intergenic
1114624701 14:24121317-24121339 TAGGTTAGGAAATCTGCTTTGGG - Intronic
1114755008 14:25249175-25249197 TAAGTTAAGAAAACAGCTCAGGG + Intergenic
1116729636 14:48605728-48605750 AATGTTTAGATAACTGTTCTTGG + Intergenic
1118297002 14:64579667-64579689 AAGGTTAAAAAACCTGCTCTTGG + Intronic
1118417007 14:65550373-65550395 TAGGCTAATATAAGTGTTCTGGG - Intronic
1118783862 14:69029231-69029253 TTGGTTGATAAAAATGTTCTGGG + Intergenic
1118866477 14:69708371-69708393 GAGGTTAAGAACACAGTTTTTGG + Intronic
1121197237 14:92084873-92084895 AAGTTTAAGAAAAATGTGCTAGG - Intronic
1121411568 14:93752095-93752117 TAGGGTAAGAAAACGGCTCCTGG - Intronic
1123160326 14:106272232-106272254 TAGGTTAAGATAACAGGTTTTGG + Intergenic
1123207954 14:106731767-106731789 TAGGTTAAGATAACGGGTTTTGG + Intergenic
1124936162 15:34173212-34173234 TAATTTAAGAAAACTGTACAAGG + Intronic
1125150976 15:36531705-36531727 TAGGTTTAAAAAAATTTTCTTGG - Intergenic
1125663732 15:41414487-41414509 TATCTTAGGAAAACTCTTCTAGG + Intronic
1127559392 15:60120664-60120686 TATGTTAAGAGAATTTTTCTAGG - Intergenic
1128956505 15:71952293-71952315 TTGTTTAAGTAAATTGTTCTGGG - Intronic
1131330798 15:91497442-91497464 CAGGTTTAGAAAACTGATCATGG - Intergenic
1131612612 15:93980979-93981001 AAGGTTAAGTAAATTGTTCCAGG - Intergenic
1132037941 15:98502107-98502129 AAGGTTAAGAAACCTGCTCAAGG + Intronic
1132315947 15:100890634-100890656 GAGGTTAAGTAACCTGTCCTAGG + Intronic
1134309448 16:13062426-13062448 GAGGTTAAGCAATCTGCTCTAGG - Intronic
1135486831 16:22872984-22873006 AAGGTTAAGAAACTTGTTCATGG - Intronic
1137734999 16:50717198-50717220 TAGGGCAAGAAAGCTTTTCTAGG + Intronic
1137739001 16:50746697-50746719 TAGGTTTATAAAAATGTTTTAGG - Intronic
1138435530 16:56997473-56997495 GAGGTTAAGAAAACTGTCCAAGG + Intronic
1138467701 16:57204617-57204639 CAGGTTATGAAAACAGTACTTGG + Exonic
1138857829 16:60715960-60715982 TAGTTAAAGAAAAAAGTTCTCGG - Intergenic
1139961161 16:70718268-70718290 TCTTTTAAGAAAACTGTGCTTGG + Intronic
1140254644 16:73324586-73324608 TGGGTTAAGAAAGCTGTCCTGGG + Intergenic
1140320627 16:73948188-73948210 TGGAATAAGAAAAATGTTCTAGG + Intergenic
1140739624 16:77929770-77929792 CAGGTTAAGCAAACTGTCCGAGG + Intronic
1203142021 16_KI270728v1_random:1772903-1772925 TAGGATAAGAAATCTGTCTTAGG - Intergenic
1144368249 17:14566034-14566056 AATTTTAAGAAATCTGTTCTGGG + Intergenic
1144458541 17:15438642-15438664 AAGGTTAAGAAACTTGTTCAAGG - Intronic
1147657089 17:42097211-42097233 GAGGTTAAGAAACTTGTTCAAGG + Intergenic
1148263084 17:46201210-46201232 TGGGTTAAAAATAATGTTCTAGG - Intronic
1149073195 17:52568237-52568259 TAAGTTTAGTAAACTGTACTCGG - Intergenic
1149641784 17:58207435-58207457 GAGGTTAAGAAACCTGTCCTGGG - Intronic
1150245419 17:63671079-63671101 CAGGTAAAGAAAACTGGGCTTGG + Intronic
1150292765 17:63990979-63991001 TAGGTTTAGAAAACAGCTCTGGG - Intergenic
1153806754 18:8715203-8715225 CAGGCTATGAAAACTGTTCAAGG - Intronic
1154242524 18:12665421-12665443 CAGGTTAACAGAACTGTTCAGGG - Intronic
1155361648 18:25009148-25009170 TAGGTTAAGAATACTGAGCAAGG + Intergenic
1155488664 18:26375022-26375044 TAGGGTAATGAAAATGTTCTGGG - Intronic
1155489790 18:26389168-26389190 TAGGTTAAGCAATCTGTTCAAGG - Intronic
1155721514 18:29018770-29018792 AGGTTTTAGAAAACTGTTCTTGG + Intergenic
1157235587 18:45962093-45962115 TATGTTCCGAAAACTATTCTAGG - Intronic
1157826179 18:50814414-50814436 GCAGTTGAGAAAACTGTTCTTGG + Intronic
1158384631 18:56975298-56975320 TGGGAGAAGAAAACTTTTCTGGG + Intronic
1159128164 18:64249001-64249023 TAAGATATAAAAACTGTTCTTGG - Intergenic
1165239480 19:34453827-34453849 CAATTTAAGAAAACTGTTTTAGG - Intronic
1167171020 19:47832039-47832061 TAGTTTTAAAAAATTGTTCTAGG - Intronic
1167300545 19:48675032-48675054 GAGGTTAAGAAGCTTGTTCTCGG - Intergenic
1202697948 1_KI270712v1_random:138851-138873 TAGGTAAGGAACACTGTTCTAGG + Intergenic
926871979 2:17430455-17430477 GATGTTATGGAAACTGTTCTTGG + Intergenic
927325460 2:21800271-21800293 TGTGTTCAGAAATCTGTTCTTGG + Intergenic
927804668 2:26136170-26136192 TAGGTTAAGAGATTTATTCTAGG - Exonic
928565387 2:32541817-32541839 TAAGTTCAGAAAACTTCTCTTGG + Intronic
929012354 2:37457386-37457408 TAGGCGAAGAAAACTGTCCCTGG - Intergenic
931067388 2:58601733-58601755 CATGTTGAGAAAAGTGTTCTAGG - Intergenic
931111610 2:59117259-59117281 TAGGTTAAGAAACTTGCTCAGGG - Intergenic
931380604 2:61749540-61749562 GAGGTTAACCAAATTGTTCTAGG - Intergenic
934279122 2:91595852-91595874 TAGGTAAGGAACACTGTTCTAGG + Intergenic
935005467 2:99071720-99071742 TAGCTTTAGCAAACTGTTCCTGG + Exonic
935143326 2:100375924-100375946 TAGCTTATGCAAACTGTTCCAGG + Intergenic
935542283 2:104362694-104362716 TACTTTATGAAAATTGTTCTTGG - Intergenic
936351470 2:111716060-111716082 GAGGTTAAGAAACCTGTCCATGG + Intergenic
939147739 2:138436594-138436616 TAGGTTAAGAAATTTGTCCATGG - Intergenic
939960942 2:148565276-148565298 GAGGTTGAGAAAGCTGCTCTAGG - Intergenic
941112567 2:161431660-161431682 TAGGTTAAAAAAAAAGTTGTTGG - Intronic
942717626 2:178911716-178911738 TAGGTTCAAAAAACTTTTGTCGG - Intronic
943035083 2:182734026-182734048 AAGGTTAAGAAACCTCTCCTTGG - Intronic
943483361 2:188449910-188449932 GATATTTAGAAAACTGTTCTTGG + Intronic
943608512 2:190004839-190004861 AAGGTTATGAACACTGTTGTAGG + Intronic
945848346 2:214975262-214975284 TAGATTAAGAAAACAGTCCTAGG - Intronic
1168837057 20:884550-884572 TGGGTCAAGAAAACAATTCTGGG - Intronic
1170560165 20:17550400-17550422 GATTTAAAGAAAACTGTTCTTGG + Intronic
1171992552 20:31708040-31708062 GAGGTTAGGAAGACTCTTCTGGG - Intronic
1172189939 20:33055878-33055900 TAGGGTAAGGGAACTGTACTTGG + Intronic
1173337620 20:42125586-42125608 TAGGTTAAGAGCACTGTCCAAGG - Intronic
1174679052 20:52386741-52386763 AAGGTTGGGAACACTGTTCTAGG + Intergenic
1174717738 20:52777872-52777894 GAGGTAATGAAAACTGATCTGGG + Intergenic
1174760778 20:53205494-53205516 AATGTTAAGAAAACTATCCTGGG + Intronic
1174996424 20:55573908-55573930 AAGGTAAAGAAAACTGTGCAAGG + Intergenic
1175049725 20:56143606-56143628 GAGGTTAAGTAAACTGTCCAAGG + Intergenic
1177504626 21:22004111-22004133 TAGAATATAAAAACTGTTCTTGG - Intergenic
1181321229 22:22007955-22007977 TAGGATCAGAAAGCTGTACTTGG + Intergenic
1181508404 22:23377231-23377253 TAGGTTAAGTAAACTGCCCAAGG - Intergenic
949859835 3:8494940-8494962 TAGGTTAAGTAAGCTGTTCCAGG - Intergenic
949929775 3:9069541-9069563 TCAGTTAAGACCACTGTTCTTGG + Intronic
951441219 3:22726311-22726333 AAGGTTAAGAACACTGCTTTGGG - Intergenic
951553756 3:23900332-23900354 TGGGTTAAGAAAAAAATTCTAGG + Intronic
952299382 3:32090496-32090518 TAAAATATGAAAACTGTTCTTGG + Intergenic
955451548 3:59073368-59073390 TATATGAATAAAACTGTTCTTGG + Intergenic
955888835 3:63629122-63629144 GTGGTTAAGAAAACTGACCTTGG + Intergenic
956030606 3:65033326-65033348 TAGGTTAAGGAATTTGTTCAAGG + Intergenic
956127093 3:66020916-66020938 GAGCTTAAGAAAACTGTCATCGG + Intronic
956214144 3:66831046-66831068 GAGGTTAAGTAACCTGCTCTGGG + Intergenic
956726471 3:72160735-72160757 GAGGCAAAGAAAATTGTTCTGGG + Intergenic
956937424 3:74119180-74119202 TAGGCAAAGAAAAATGTTCCAGG - Intergenic
960317486 3:116195670-116195692 TATTTTTAAAAAACTGTTCTAGG + Intronic
960799597 3:121524761-121524783 TAGGGTAATGAAAATGTTCTAGG + Intronic
962083660 3:132167470-132167492 AAGGTTAAGAAGACATTTCTGGG + Intronic
962433156 3:135338788-135338810 TAGGTTTAGAAAGCAGGTCTTGG - Intergenic
963014678 3:140810599-140810621 TAAATTATAAAAACTGTTCTTGG + Intergenic
963738061 3:149043790-149043812 TAGGTTAAGCAACCTGTCCAAGG - Intronic
964356570 3:155856358-155856380 TAGGTTAAGTAATCTGTCCAAGG - Intergenic
965166673 3:165202948-165202970 TAGTTTAAGAAAAGGGTTGTTGG + Intergenic
965693172 3:171379603-171379625 CAAGTTAAGAAAACTCTTCAGGG + Intronic
965907838 3:173731737-173731759 TAGGTACAGAATATTGTTCTAGG - Intronic
968155002 3:196373504-196373526 TTGGAAAAGAATACTGTTCTAGG - Intronic
969031667 4:4220622-4220644 TAGGTAAGGAACACTGTTCTAGG - Intronic
970077862 4:12245216-12245238 TAGTTAAAGAAAATTATTCTTGG + Intergenic
970360020 4:15299810-15299832 GAGGTTAAGCAAACTGCTCGAGG - Intergenic
971074353 4:23130524-23130546 GAGGTTAAGTAAACTGTTAAAGG + Intergenic
971213098 4:24638970-24638992 TAGGCTAGTAAAATTGTTCTTGG + Intergenic
972428522 4:38958251-38958273 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
972649777 4:41005426-41005448 TTGGTGAAGAAAACTAATCTGGG + Intronic
972967673 4:44531565-44531587 TAGATTAAGAACACAGTTATAGG - Intergenic
973053450 4:45624388-45624410 TATGTTTATAAAATTGTTCTAGG + Intergenic
975317824 4:72975838-72975860 AACTTTAAGAAAACTTTTCTTGG - Intergenic
975639791 4:76488899-76488921 TAGGTTAAGGCAATTGTTCAAGG + Intronic
976776355 4:88710470-88710492 TAGGTTAAGAAACCTGCCCAAGG - Intergenic
976799226 4:88969795-88969817 AAGGCTGAGAAAACTGTCCTAGG + Intronic
978580337 4:110225592-110225614 AAGCTTAAGAAAAATGTTCAGGG - Intergenic
979029266 4:115619674-115619696 TAAGTTTAAAACACTGTTCTGGG + Intergenic
979083694 4:116378141-116378163 TTGGAGAAGAAATCTGTTCTAGG - Intergenic
979645700 4:123065340-123065362 GAGGTTAAGGAACCTGTCCTAGG - Intronic
979853858 4:125607645-125607667 TTTGTTCAGAAAACTGTCCTTGG - Intergenic
980734013 4:136859351-136859373 TATTTTAACAAAACTATTCTAGG - Intergenic
981392194 4:144204082-144204104 TCAGTAAAGAAAAGTGTTCTTGG + Intergenic
981840453 4:149105606-149105628 CAGGTAAAGAAAAGTGTTCTTGG - Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982577894 4:157139447-157139469 TAGGTCAAGAAGACTGTACAGGG - Intronic
982706101 4:158711537-158711559 TAGGTTAAAAGACCTGTTGTAGG - Intronic
983850566 4:172575477-172575499 AAGTTTGAGAAAACTGTCCTTGG + Intronic
984198321 4:176687110-176687132 TTGGTTAAGAAAACTGCTTTTGG + Intronic
986970523 5:13331406-13331428 TATTTTTAGAAAACTGGTCTGGG + Intergenic
988570506 5:32360328-32360350 TAGGGTAATGAAAATGTTCTAGG - Intronic
988825125 5:34928775-34928797 TAGGTTAAGAAAGCAGTTAAAGG - Intergenic
988955893 5:36318572-36318594 TAAAATATGAAAACTGTTCTTGG - Intergenic
989362231 5:40615463-40615485 TAAGTTAGAAAGACTGTTCTAGG - Intergenic
992365962 5:76089799-76089821 GAGGTTAAGAAACTTGTTCATGG - Intronic
993630156 5:90276995-90277017 TAAGTTAATAAAAATTTTCTGGG + Intergenic
993946078 5:94118093-94118115 TAAAATATGAAAACTGTTCTTGG - Intergenic
995787632 5:115847154-115847176 TAGGGTAAGAATATTGGTCTTGG - Intronic
997047721 5:130339582-130339604 TAAATTAAGGAAACTCTTCTTGG + Intergenic
997271695 5:132544823-132544845 TAGCTTTGGAAAACTGTTCTGGG - Intronic
997918712 5:137956365-137956387 TATCTTAGGAAAACTGTTCTGGG - Intronic
998205870 5:140156491-140156513 GAGGTTAAGACATCTGGTCTGGG - Intergenic
998563510 5:143194462-143194484 TAACTTAAGAGAACTATTCTTGG - Intronic
998829228 5:146139375-146139397 AAGGAAAAGAAAACTCTTCTGGG + Intronic
1000116743 5:158160835-158160857 GAGGTTAAGAAATGTGTGCTAGG + Intergenic
1000769072 5:165328663-165328685 TAGTGTAAGCAAACTGTTCATGG - Intergenic
1001296415 5:170502328-170502350 CAGGTGAAGAAAACTATTCAAGG + Intronic
1001878802 5:175224443-175224465 TAGGTTAAATACCCTGTTCTGGG - Intergenic
1002671339 5:180870211-180870233 GAGGGTAAGAAAACTGTCCCAGG + Intergenic
1002862249 6:1090416-1090438 TAGGTTATCAAAATTGTTTTAGG + Intergenic
1003502888 6:6716857-6716879 AAAATTAAGAAAACTGTTCCTGG + Intergenic
1003774856 6:9348843-9348865 CAGGTTAAGACAATTGTACTGGG + Intergenic
1003795994 6:9604729-9604751 TTGAGTAAGAAAACTTTTCTTGG - Intronic
1005878923 6:30039280-30039302 TGGATTAAGATAACTGCTCTTGG + Intergenic
1008107477 6:47454907-47454929 TAGGTCAAGAAAACTGGGCTGGG - Intergenic
1008114497 6:47532176-47532198 AAGGTTAAGAAAAGTATACTTGG + Intronic
1008166172 6:48141057-48141079 TAGGTTAAAAACATTCTTCTTGG - Intergenic
1008294811 6:49762342-49762364 TAGGCTAAGGTAAGTGTTCTGGG - Intergenic
1008766393 6:54921408-54921430 TAAGTGAAGAAAAATGTCCTTGG + Intronic
1008836475 6:55837925-55837947 TAGGTTAAGTAAAATGATCCAGG - Intronic
1010124744 6:72418932-72418954 TAGGTGAGGAGAGCTGTTCTGGG - Intergenic
1010347909 6:74834675-74834697 TAGGTAAAGAGCACTGTGCTAGG + Intergenic
1010689996 6:78899107-78899129 TAGGTAAAGAATACTGAGCTTGG + Exonic
1010817893 6:80380813-80380835 GAAATTAAGAAAACAGTTCTTGG - Intergenic
1011044817 6:83069230-83069252 TGGTTTTAGAACACTGTTCTGGG - Intronic
1012421141 6:99066472-99066494 TAGACCAAGAAAATTGTTCTTGG + Intergenic
1012456748 6:99415398-99415420 TATGTTAAGAAACCAGGTCTTGG - Intronic
1012615774 6:101278113-101278135 AACGGTAAGAATACTGTTCTTGG + Intergenic
1012844040 6:104367411-104367433 TAGGGGAAGAAAAAGGTTCTTGG + Intergenic
1013028174 6:106301029-106301051 TATGTTAAGAGACCAGTTCTTGG - Intronic
1013609500 6:111781036-111781058 AAGGTTAGGAAAACTGTCCAGGG - Intronic
1014046739 6:116897542-116897564 TAGGTTAAGAATTCTGTAATGGG + Intronic
1014899011 6:126940524-126940546 AAGGACAAGAAAAATGTTCTGGG + Intergenic
1019836495 7:3390484-3390506 TAGGTGAAAATAACTTTTCTGGG - Intronic
1020597463 7:10226366-10226388 TAGGCTAAGAAAACAATTATTGG + Intergenic
1021019201 7:15575505-15575527 GAGGTCAAGAAAAGTATTCTAGG - Intergenic
1021139312 7:17004070-17004092 TAGGATAACAAAAATGTTCAGGG - Intergenic
1022077766 7:26990373-26990395 TAGTTTTAGAAAACTTTTCGTGG - Intronic
1022335647 7:29419211-29419233 TAGATTCAGAACACTGTGCTAGG - Intronic
1023179071 7:37462915-37462937 TAGTTTAAGAAAACATTTTTGGG - Intergenic
1024362703 7:48485422-48485444 TAGTTTTAGAAAACCATTCTTGG + Intronic
1026261914 7:68762675-68762697 TAGGTGAAGAGTACTTTTCTTGG + Intergenic
1027278607 7:76588909-76588931 AAGGTTGAGAAAACTGTGCCCGG - Intergenic
1027353014 7:77330829-77330851 TAGGTTTTGAAAAATGTCCTGGG - Intronic
1027893775 7:84013875-84013897 AAGGTATAGAAAACTGTGCTAGG + Intronic
1028236323 7:88366516-88366538 AAGGTTAAAAAATTTGTTCTAGG - Intergenic
1028364913 7:90017014-90017036 AAGATTAAGAAAACTGTAATAGG + Intergenic
1028381740 7:90208032-90208054 AGGGTTAAGAAAACTATTCTAGG + Intronic
1028739772 7:94260432-94260454 AAAATTAAGAACACTGTTCTGGG - Intergenic
1031165240 7:118220110-118220132 TAGTATAAAGAAACTGTTCTTGG - Intronic
1031781412 7:125971343-125971365 TAGTTCAATGAAACTGTTCTAGG - Intergenic
1032503254 7:132415791-132415813 TAGGTTAAGTAAACTGCCCAAGG + Intronic
1032844746 7:135742859-135742881 GAGGTTAAGAAAATTGCCCTAGG + Intronic
1033286148 7:140042305-140042327 AAGGTGAAGAAACCTGTTCAAGG + Intronic
1033401519 7:141030056-141030078 TTGGTTAGGCAAAATGTTCTTGG + Intergenic
1037771906 8:21806393-21806415 TAGGCTAATATAAGTGTTCTCGG + Intronic
1039304387 8:36245846-36245868 GAGGTTAAGAAAACTTTCCATGG - Intergenic
1040322204 8:46320534-46320556 TAGCTTCAGAACACTGTTTTTGG - Intergenic
1041303757 8:56438841-56438863 TAGATTAAAAAAACTGTGCTTGG + Intronic
1043137168 8:76542568-76542590 AAGTTTAAAAAAACTATTCTAGG + Intergenic
1043653075 8:82623694-82623716 TAATTTATGAAAAGTGTTCTAGG - Intergenic
1044151750 8:88786370-88786392 TAGGTCAAAATAACTGTGCTGGG - Intergenic
1045587642 8:103556961-103556983 TAGGTTAAAACAACTGATTTAGG + Intronic
1045613971 8:103884334-103884356 AAGGTTTAGAAAACTATTATGGG - Intronic
1045845947 8:106636455-106636477 TAGTTTTTGAAAACTATTCTCGG - Intronic
1047332403 8:123903509-123903531 TAAAATATGAAAACTGTTCTTGG - Intronic
1047526267 8:125637006-125637028 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
1047637992 8:126786893-126786915 TAGCTTAAGAAAATATTTCTTGG - Intergenic
1050348008 9:4712154-4712176 CAGGTTAAGAAATGTGTTTTAGG - Exonic
1050495920 9:6242417-6242439 TAGAATACAAAAACTGTTCTTGG + Intronic
1051181654 9:14418079-14418101 TTGTTTAAAAAAACTGTTCCTGG - Intergenic
1051196019 9:14563707-14563729 GAGGTTAAAAGAACTGTCCTGGG + Intergenic
1051415291 9:16833394-16833416 TTGCTTGAGAAAACTGTTCCAGG - Intronic
1053096594 9:35333917-35333939 CAGGTTGAGAAAACTGCTTTGGG + Intronic
1054707679 9:68479600-68479622 CAGTTTTAGAAACCTGTTCTAGG - Intronic
1055021350 9:71673640-71673662 TACGTTCAGAAAACAGTGCTGGG - Intergenic
1055803034 9:80061417-80061439 CAATTAAAGAAAACTGTTCTAGG - Intergenic
1058123900 9:101170011-101170033 GAGCTTAAAAAAACTGATCTAGG + Intronic
1058270281 9:102964139-102964161 TAGCTTATAAAAAATGTTCTAGG - Intergenic
1059259396 9:112961442-112961464 TAGGTTAAGCAAACTGAATTTGG - Intergenic
1185550420 X:979592-979614 TAGGATAAGAAATCTGTCTTAGG + Intergenic
1187136198 X:16550106-16550128 AAGGTTAAGAACACCGTTTTGGG - Intergenic
1188170991 X:26926218-26926240 TAGGTTCAAAAAACTGTGGTGGG + Intergenic
1188626383 X:32290160-32290182 TGGGTTAGGAAAACTATTTTTGG - Intronic
1189504783 X:41601490-41601512 CTGGTTAATAAAACAGTTCTTGG + Intronic
1189654475 X:43228223-43228245 TAGGATAAGAAAAAAGATCTGGG + Intergenic
1190416802 X:50188275-50188297 GATGTAAAGAAAACTATTCTTGG + Intergenic
1191054227 X:56225758-56225780 TAGGTTAAGTAACTTGTCCTAGG + Intergenic
1195516615 X:105783992-105784014 TACTTTAAGACAACTTTTCTGGG + Intergenic
1197243141 X:124141122-124141144 TAGGTAAAGAAAGCTTTTCATGG - Intronic
1197248639 X:124191933-124191955 TAGGCTAATATAACTGTTCTGGG + Intronic
1201467045 Y:14293946-14293968 TTGGTTTAGAAAACTAATCTAGG + Intergenic
1201776559 Y:17672125-17672147 CAGGTTAAAAACACTGTTTTTGG - Intergenic
1201824997 Y:18233867-18233889 CAGGTTAAAAACACTGTTTTTGG + Intergenic
1201906434 Y:19090497-19090519 TAAAGTACGAAAACTGTTCTTGG - Intergenic