ID: 1079171882

View in Genome Browser
Species Human (GRCh38)
Location 11:18104601-18104623
Sequence GCTTAAATATCAGCACCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079171882_1079171885 19 Left 1079171882 11:18104601-18104623 CCCTTAGGTGCTGATATTTAAGC 0: 1
1: 0
2: 1
3: 18
4: 149
Right 1079171885 11:18104643-18104665 AGTAGTTTGTCATGTGAAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 255
1079171882_1079171884 -10 Left 1079171882 11:18104601-18104623 CCCTTAGGTGCTGATATTTAAGC 0: 1
1: 0
2: 1
3: 18
4: 149
Right 1079171884 11:18104614-18104636 ATATTTAAGCTAAATTTTAAAGG 0: 1
1: 1
2: 6
3: 114
4: 987

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079171882 Original CRISPR GCTTAAATATCAGCACCTAA GGG (reversed) Intronic
901722676 1:11212545-11212567 GCTTAACAATCAGCACCAAAGGG + Intronic
904701313 1:32360031-32360053 GCTTAAATACTAGCACCTCCAGG + Intronic
905253865 1:36667296-36667318 GCTTAATTATTAGCAGTTAAGGG - Intergenic
905676763 1:39831598-39831620 TTTTAAATATCAGCATGTAAAGG - Intergenic
906007588 1:42490015-42490037 GCTTAAATGTCAGCTCCTCAGGG - Intronic
906788594 1:48638560-48638582 ACTTAAATATCAGCTCCTCCAGG + Intronic
907295933 1:53454264-53454286 GCTTAGAAATCAGCCCCTCAGGG + Intergenic
908425688 1:64004803-64004825 GCTTAAATACCAAAACCTTATGG + Intronic
910471200 1:87554636-87554658 GCTCAAATATCACCACCTCTGGG + Intergenic
916937361 1:169643494-169643516 GCTTAAAAATCAACTCATAATGG + Intergenic
916996870 1:170310510-170310532 GCTTAAATATAGTCTCCTAAGGG - Intergenic
917657157 1:177137940-177137962 GTTAAAATATCAGCACTTAAAGG + Intronic
917713646 1:177711809-177711831 GCTTAAATAACACCAGATAAGGG - Intergenic
918696772 1:187554682-187554704 GCTTAAATGTCACCTCCTCAAGG - Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1064312640 10:14225321-14225343 GCTTTCAAATCAACACCTAATGG + Intronic
1068201141 10:53785711-53785733 GCTAAACTATCATCACATAAAGG + Intergenic
1070733823 10:78850053-78850075 GCTTAAATGTCACCTCCTGAGGG + Intergenic
1071889469 10:89987383-89987405 TCTCAAATATCAGCATCTATAGG + Intergenic
1073102733 10:101015299-101015321 GCTTAAATATCACCTCCTCTAGG + Intronic
1073935539 10:108626890-108626912 GCTGTAATCTCAGCACTTAAGGG - Intergenic
1076001085 10:126913526-126913548 GCTTTAATATCAGGAGCTCATGG + Intronic
1077722884 11:4645360-4645382 GCTTAAATGTCACCTCCTCAGGG + Intronic
1079171882 11:18104601-18104623 GCTTAAATATCAGCACCTAAGGG - Intronic
1079595270 11:22237040-22237062 GTTTAAATTTCACCACCTATTGG + Intronic
1081391532 11:42535296-42535318 GCTCAGATCTCAGGACCTAAGGG - Intergenic
1083116080 11:60461264-60461286 GCTCAAATGTCAGCTCCTAGAGG - Intronic
1085728199 11:78973860-78973882 GCTTAAATGTCACCTCCTCAGGG - Intronic
1085855571 11:80172049-80172071 GTTTAAATATCACCTCCTCAAGG + Intergenic
1088032906 11:105274159-105274181 TCTTAAATATAAGAGCCTAAAGG - Intergenic
1093158078 12:15712572-15712594 TCTTAAATACCATGACCTAAAGG + Intronic
1094419547 12:30256132-30256154 GCTTTTACATCAGCACCCAATGG - Intergenic
1094428561 12:30341511-30341533 GCTTTTACATCAGCACCCAATGG + Intergenic
1100109102 12:91216038-91216060 GCTTAAATAGCAGAACTTAATGG + Intergenic
1103639000 12:122333398-122333420 CCTGAAATGTCAGCACCTCAGGG - Intronic
1103807707 12:123586208-123586230 ACATAAATGTCAGGACCTAAAGG + Intronic
1104799486 12:131544008-131544030 GCTTAAATACCCGTGCCTAAAGG - Intergenic
1105496689 13:20936649-20936671 GCTTAAACTTCATCACCTCATGG + Intergenic
1106544167 13:30715896-30715918 AGTAAAATATCAGCACTTAATGG + Intronic
1106907414 13:34423264-34423286 GCTAAAATATCAGCAGCTGATGG + Intergenic
1107414473 13:40188168-40188190 AATTAAATATAAGCACCCAAAGG - Intergenic
1108869494 13:54965491-54965513 GTTTAAATATCTGCTCCTCAGGG + Intergenic
1108983243 13:56547423-56547445 GCTTAATTATCAGTATATAAGGG - Intergenic
1109099142 13:58157744-58157766 ACTCAAATATCAGCACCCATAGG + Intergenic
1109600860 13:64626742-64626764 GCTTCAATCTAAGCACTTAATGG - Intergenic
1113141228 13:107152405-107152427 ACATAAATATCAGGACCTGATGG - Intergenic
1113373562 13:109743934-109743956 GTGTAAATATCTGCACCTAAGGG - Intergenic
1114158665 14:20136950-20136972 GCTTAACTTTCAGCTCCTCAGGG + Intergenic
1115439294 14:33413514-33413536 GCTCAAAGATAAGCAGCTAAAGG - Intronic
1117195547 14:53336450-53336472 GCTTAAATATCCTCACATAATGG - Intergenic
1117558139 14:56907523-56907545 GCTCAAATATCACTTCCTAAGGG - Intergenic
1118824296 14:69366451-69366473 GCTTAAATGTCAGCCCTTACAGG + Intergenic
1121898004 14:97666492-97666514 GCTTTAAGGTCAGCAACTAAAGG - Intergenic
1122196714 14:100093059-100093081 GCTAAAATCTCAGTACCTAATGG - Intronic
1126057819 15:44748407-44748429 GCTTCAATCTCAGTGCCTAAAGG - Intronic
1126105575 15:45144888-45144910 AGTTAAACAGCAGCACCTAAGGG - Exonic
1129539192 15:76337429-76337451 GCCTGGATATCAACACCTAACGG - Intronic
1129567270 15:76635909-76635931 GATTATATATCATCACCAAATGG - Intronic
1130687392 15:86050699-86050721 GCTTAAATATCAGCTTATTAAGG + Intergenic
1131815909 15:96220964-96220986 GTTTAAATATCGGCACGTCAAGG - Intergenic
1134782405 16:16910153-16910175 ACTAAAATATAAGCACCCAAGGG - Intergenic
1135765883 16:25177721-25177743 GCTCAAAGTTCAGCACATAAAGG + Intronic
1138083467 16:54113737-54113759 TTTTAAATATGGGCACCTAATGG - Exonic
1138439805 16:57027118-57027140 TCTTGAATATCAGAACATAATGG + Intronic
1138446415 16:57066948-57066970 GCTTAAATGCCACCACCTCAGGG + Intronic
1139236718 16:65347296-65347318 TCTTGAATATCAGCACCTTGCGG - Intergenic
1140024782 16:71276645-71276667 ACTAAAAAATCAGCACCTAATGG + Intergenic
1141051346 16:80767540-80767562 CATAAAATATGAGCACCTAATGG + Intronic
1141091231 16:81131744-81131766 CACTAAATATCTGCACCTAAAGG - Intergenic
1141301186 16:82817008-82817030 GCTTAGATATCTCCTCCTAAGGG - Intronic
1148869191 17:50646006-50646028 GCTTACATGTCAGCAAGTAAAGG + Intronic
1149177043 17:53884970-53884992 GCCAAAATATCAACATCTAAGGG - Intergenic
1153063721 18:1021148-1021170 GCTTAAATATCACTTCCTTAGGG + Intergenic
1154314370 18:13292609-13292631 GCTTCAATTTCTGCACCTAGAGG - Intronic
1156978162 18:43251159-43251181 GGTTAAAGATCAGAACCCAAAGG + Intergenic
1164069521 19:21753893-21753915 TCTTAAATAGCAGGACTTAATGG - Intronic
1165895593 19:39139192-39139214 GCTTAAAGGTCAGCACCTCTGGG + Intronic
928889140 2:36181588-36181610 GCGTTCATATCAGCTCCTAAAGG - Intergenic
929673609 2:43901597-43901619 TTTTAAATATGAGCACCAAATGG + Intronic
929938588 2:46313338-46313360 GCTTAAATATCACCTCCCTAGGG + Intronic
930882809 2:56291507-56291529 GCTTAAATATCATCTACTCAGGG - Intronic
931717166 2:65038294-65038316 GCTTAAATGTCACCTCCTCAGGG + Intergenic
933346736 2:81096135-81096157 ACTTAAATACCAGAACATAATGG - Intergenic
933349673 2:81137407-81137429 GCTGAAATATCTGGAACTAAAGG - Intergenic
936272145 2:111057121-111057143 GCTCAAATATCACCTCCTCAGGG - Intronic
938404451 2:131022002-131022024 GATTATATATCAGGACCAAATGG - Intronic
939020621 2:136954261-136954283 GCTTAAATATCACCTCCTTAGGG - Intronic
939928468 2:148202324-148202346 GCTTGAATATCACTACCTCAGGG - Intronic
942523884 2:176832445-176832467 GCTACAATATCAGCAGCTTATGG - Intergenic
944097982 2:195991759-195991781 GCTTTAATAGCAGCAACCAATGG + Intronic
945249842 2:207755691-207755713 TCTTAAATAGCAGGACTTAATGG - Intronic
946083867 2:217151436-217151458 CCTAAAATATCAGCATGTAAAGG - Intergenic
947645769 2:231738571-231738593 GGTAAAATATCAGCACAAAATGG + Intronic
947782118 2:232777439-232777461 GTTTTAAAATCAGCAGCTAACGG - Intronic
947936125 2:234005442-234005464 GCTTAAAAATCAGCATGGAAAGG - Intronic
1170983310 20:21235985-21236007 GCTTTTATATAAGAACCTAAAGG - Intronic
1173538616 20:43834563-43834585 GCTTTAATATCACCTCCTCAAGG + Intergenic
1174360180 20:50023960-50023982 GCTCAAATATCACCTCCTCAGGG - Intergenic
1178493090 21:33066658-33066680 GTGTAAATATCAACACCTACTGG + Intergenic
1179545298 21:42109311-42109333 CCTTAAATATTAGCACCCATGGG - Intronic
1182265959 22:29115602-29115624 GATTAACTATGAGCAACTAAAGG - Intronic
1183226906 22:36556739-36556761 GTTCAAATCTCAGCACCTCACGG - Intergenic
1183400970 22:37604286-37604308 GCTTAAATATCAACTCCAACAGG + Intergenic
951678816 3:25273362-25273384 CCTTTAAAATCATCACCTAATGG + Intronic
952397901 3:32937499-32937521 GCGTAAATATTAGCACCACAGGG - Intergenic
952946724 3:38482806-38482828 GTTTGAATATCAGCACTTCAAGG + Intronic
953283140 3:41578251-41578273 GTTTAAAAATCAGCAGCAAAAGG + Intronic
961907525 3:130277727-130277749 GTTTAAATATCAGAACTAAAGGG - Intergenic
961980362 3:131071521-131071543 ACTTCTATATCATCACCTAAGGG + Intronic
962956059 3:140267962-140267984 GCTTATATAACAGGAGCTAATGG - Intronic
963017200 3:140836650-140836672 CTTTACATATCAGCACCTATGGG + Intergenic
963099659 3:141587752-141587774 GCTAAAATATCAGAAGCTAATGG - Intronic
963211233 3:142693749-142693771 GGTTAAATAACAGCACCTGAAGG + Intronic
963342920 3:144058787-144058809 ATTTACATATTAGCACCTAATGG - Intergenic
964602685 3:158519433-158519455 GCTTAAATGTCAGCTCCTTAGGG - Intronic
966991483 3:185235447-185235469 CCACGAATATCAGCACCTAAGGG + Exonic
968440365 4:620928-620950 GCTTAAATCTCAGCTCCAGATGG - Intergenic
971324267 4:25631329-25631351 ACTTAAATATCAGTTCCTCAAGG - Intergenic
977438480 4:97032038-97032060 GCTTAAATATCACCTCCTCAGGG + Intergenic
978187243 4:105870994-105871016 GCTCAAATGTCATCGCCTAAAGG - Intronic
979585170 4:122406814-122406836 GCTTAAATTTCAGCTCGTTAGGG + Intronic
980785358 4:137547207-137547229 GTTTAAATATTAGCACTTAACGG + Intergenic
981968230 4:150632759-150632781 GCTTAGATGTCAGCTCCTACAGG + Intronic
983340949 4:166459828-166459850 GCTTAAATATCATCTTCCAAGGG + Intergenic
984725463 4:183015736-183015758 TTTTAAATGTCAACACCTAACGG - Intergenic
985339055 4:188928687-188928709 GGAAAAATATCACCACCTAAAGG + Intergenic
986363139 5:7001631-7001653 GCATAAATATCAGCACAGAATGG + Intergenic
987250763 5:16098813-16098835 ATTTAAATATCAGCAGCAAAAGG + Intronic
987816621 5:22909593-22909615 GCTTAAAAATAAGCAAATAATGG + Intergenic
989488444 5:42020863-42020885 GTTTAAATATCACTTCCTAAAGG - Intergenic
992259014 5:74951425-74951447 TCTTTAATATAGGCACCTAAAGG - Intergenic
995300359 5:110573718-110573740 GCTTGAATATCACCTCCTCATGG - Intronic
995751302 5:115455897-115455919 AATTAAATATCAGCTCCTGAAGG + Intergenic
1000041082 5:157485784-157485806 GCTCAAATGTCACCACCTCAGGG + Intronic
1001281614 5:170390204-170390226 GATTAAAAATCAGCAACAAAGGG + Intronic
1001365955 5:171140105-171140127 GCTTAAATTTCATCTCCTCATGG + Intronic
1001370669 5:171197705-171197727 GCTTAAATATCTGCAATTCAAGG + Intronic
1002432861 5:179213212-179213234 GCTGAAATGTCAGCTCCTAAGGG + Intronic
1003142624 6:3484330-3484352 CCCTATATCTCAGCACCTAAGGG - Intergenic
1004904225 6:20221349-20221371 GCTTAAAATCCAGCCCCTAAAGG + Intergenic
1005706126 6:28455372-28455394 GCTTAAACACCAGCAACCAAGGG - Intergenic
1009790719 6:68398833-68398855 GCCTAAATGTCACCACCAAAAGG + Intergenic
1009972189 6:70636671-70636693 ACCTAAATATAAGCACCAAAGGG + Intergenic
1011355406 6:86468172-86468194 GCTCAAATATCACCTCCTCAGGG - Intergenic
1012458573 6:99434477-99434499 GCTTAAATATCAAAAGATAATGG - Exonic
1012709246 6:102578388-102578410 GCTTAAATATCATGTCATAATGG - Intergenic
1015544244 6:134345846-134345868 GCTTAAATATCAGTTCCTGTAGG - Intergenic
1015693187 6:135949916-135949938 TCTTAAATATAAGCTCCTCAAGG - Intronic
1017405881 6:154117554-154117576 GCTTAAGTCTCAGCACCTGGGGG + Intronic
1018740867 6:166727696-166727718 CCTAAAATATCAGCACCTTAAGG + Intronic
1019533175 7:1513772-1513794 TCTTGAATATCAGCCCCAAAAGG - Intergenic
1022443054 7:30449403-30449425 GCTTAGATTTCAGAACTTAATGG - Intronic
1022761701 7:33362421-33362443 ACATAAATATCAGCACAAAATGG - Intronic
1025726092 7:64062625-64062647 ACTTAAATATGACCACCTGAAGG - Intronic
1028835461 7:95369882-95369904 GCTTAAATATCATCTTCTCAGGG - Intronic
1035006685 7:155668429-155668451 CATAAAATATCAGCAGCTAAGGG - Intronic
1038688754 8:29742321-29742343 GCTTAAAGACCTGCACCTATGGG + Intergenic
1043609282 8:82042253-82042275 GCTTTAATTTCAGCACCTAAGGG + Intergenic
1044337821 8:91008527-91008549 GCTTGATTATCATCATCTAAAGG - Intronic
1047395050 8:124489871-124489893 TCTTAAATGTTAACACCTAAAGG + Intronic
1051328985 9:16003823-16003845 GTTGAAATATGAGCACCAAAGGG - Intronic
1051564062 9:18476426-18476448 GCCTAAATATCTGCAACAAAGGG - Intronic
1054732098 9:68711909-68711931 GCTTAAATATCACCTCCTCCTGG + Intronic
1055935585 9:81601522-81601544 CCTTATATATTAGCACCTAGAGG - Intronic
1057425957 9:94949980-94950002 GCTTAAAGACCAGCCCTTAAAGG + Intronic
1187674611 X:21703217-21703239 GCCTTAACATCATCACCTAAAGG - Intergenic
1191878237 X:65818395-65818417 TCTTAAATAGCAGGACTTAATGG + Intergenic
1194681200 X:96855696-96855718 GCTTAAATATCACTTCCTCAGGG - Intronic
1201675594 Y:16580250-16580272 GATTAAATATTGGCAACTAATGG - Intergenic