ID: 1079172580

View in Genome Browser
Species Human (GRCh38)
Location 11:18110351-18110373
Sequence CAATCCTTCCCCCCTAATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079172580_1079172589 -1 Left 1079172580 11:18110351-18110373 CCCCGATTAGGGGGGAAGGATTG No data
Right 1079172589 11:18110373-18110395 GGAAGTGAGAGGGGAGGGAAAGG No data
1079172580_1079172587 -7 Left 1079172580 11:18110351-18110373 CCCCGATTAGGGGGGAAGGATTG No data
Right 1079172587 11:18110367-18110389 AGGATTGGAAGTGAGAGGGGAGG No data
1079172580_1079172586 -10 Left 1079172580 11:18110351-18110373 CCCCGATTAGGGGGGAAGGATTG No data
Right 1079172586 11:18110364-18110386 GGAAGGATTGGAAGTGAGAGGGG No data
1079172580_1079172590 18 Left 1079172580 11:18110351-18110373 CCCCGATTAGGGGGGAAGGATTG No data
Right 1079172590 11:18110392-18110414 AAGGAAAATTCTTACTTGACTGG No data
1079172580_1079172588 -6 Left 1079172580 11:18110351-18110373 CCCCGATTAGGGGGGAAGGATTG No data
Right 1079172588 11:18110368-18110390 GGATTGGAAGTGAGAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079172580 Original CRISPR CAATCCTTCCCCCCTAATCG GGG (reversed) Intergenic
No off target data available for this crispr