ID: 1079173135

View in Genome Browser
Species Human (GRCh38)
Location 11:18115146-18115168
Sequence TACCTTGATGGTGGTTCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079173135_1079173139 -2 Left 1079173135 11:18115146-18115168 CCAGTAGAACCACCATCAAGGTA 0: 1
1: 0
2: 1
3: 6
4: 110
Right 1079173139 11:18115167-18115189 TAATTCACTGTAGGTTTTACTGG 0: 1
1: 0
2: 0
3: 14
4: 254
1079173135_1079173140 -1 Left 1079173135 11:18115146-18115168 CCAGTAGAACCACCATCAAGGTA 0: 1
1: 0
2: 1
3: 6
4: 110
Right 1079173140 11:18115168-18115190 AATTCACTGTAGGTTTTACTGGG 0: 1
1: 0
2: 0
3: 16
4: 199
1079173135_1079173141 7 Left 1079173135 11:18115146-18115168 CCAGTAGAACCACCATCAAGGTA 0: 1
1: 0
2: 1
3: 6
4: 110
Right 1079173141 11:18115176-18115198 GTAGGTTTTACTGGGATAAGTGG 0: 1
1: 0
2: 2
3: 7
4: 109
1079173135_1079173142 29 Left 1079173135 11:18115146-18115168 CCAGTAGAACCACCATCAAGGTA 0: 1
1: 0
2: 1
3: 6
4: 110
Right 1079173142 11:18115198-18115220 GAGCTAGACTTACCTTCCAAAGG 0: 1
1: 0
2: 1
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079173135 Original CRISPR TACCTTGATGGTGGTTCTAC TGG (reversed) Intronic
900902952 1:5529111-5529133 TAAGTAGATGATGGTTCTACAGG - Intergenic
902872684 1:19324072-19324094 TACCTTGATAGTGGAGCTCCAGG + Intronic
908218330 1:61977995-61978017 TACCTGGATGGTGGTTACATGGG - Intronic
913356089 1:117923665-117923687 GACTTTGGTGGTGGTTCTAGGGG - Intronic
918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG + Intergenic
919365249 1:196651356-196651378 GACCTTGGTGGTGGTTTCACAGG + Intergenic
924065576 1:240218449-240218471 CACCTTGTAGGTGGGTCTACAGG - Intronic
1063432358 10:6001655-6001677 TATCTTGATTGTGGTTTTAGGGG - Intergenic
1063635371 10:7777399-7777421 TATCTGGGTGGTGGTTCCACAGG + Intronic
1064713881 10:18155131-18155153 TACCTGGGTGGTGGCTCCACAGG - Intronic
1067340999 10:45403526-45403548 TACCTGGATGGTGTTCGTACAGG + Intronic
1067967720 10:50932323-50932345 GGCCATGATGGTGTTTCTACAGG - Intergenic
1070047923 10:72857757-72857779 TATTTTGATAGTTGTTCTACTGG + Intronic
1072614733 10:97042098-97042120 TACCCTGATGGTGTTTCTTGGGG + Intronic
1074156034 10:110800574-110800596 GACTTTGGTGGTGGTTTTACGGG - Intronic
1075787716 10:125061366-125061388 TCCCTTGACGGTGGCTCCACTGG + Intronic
1076006370 10:126950850-126950872 TACCATGATGATGGTGGTACTGG + Intronic
1077617328 11:3686665-3686687 GATCGTGATGGTGGTTTTACAGG - Intronic
1079173135 11:18115146-18115168 TACCTTGATGGTGGTTCTACTGG - Intronic
1079350455 11:19687452-19687474 GACCTGGATGGTGGTTACACAGG - Intronic
1081361066 11:42178934-42178956 TACCTTGAGGGTTCTTCTAAAGG + Intergenic
1088128172 11:106453710-106453732 TTCCTTAATGGTTGTTCTAGAGG + Intergenic
1089423748 11:118352427-118352449 TTCCTTGAAGGTGGCTGTACTGG - Exonic
1096108134 12:49010794-49010816 TTCCTTTATGGTGGTTTTAGGGG + Intronic
1097747887 12:63319123-63319145 TAGCTTGAAGGTGGTTTCACCGG + Intergenic
1098565278 12:71928133-71928155 TACCTTGATGGCTCTCCTACTGG - Intergenic
1102535209 12:113576009-113576031 AACCTGGATGGTGGATCTTCAGG + Intergenic
1103600298 12:122050529-122050551 TCCCTGGAAGGTGGTTCTGCAGG + Intronic
1105557963 13:21463740-21463762 TTCCTGGATGGTGGTTATAATGG - Intergenic
1110111141 13:71747725-71747747 TACCTTGAGAGTGTCTCTACTGG + Intronic
1120007939 14:79381033-79381055 TGCCTGGATGGTGCTGCTACTGG + Intronic
1120272091 14:82326181-82326203 TACATGCATGGTGGTTCTCCTGG + Intergenic
1120424575 14:84330628-84330650 TTACTTGATGTTGGTTCTAAGGG - Intergenic
1124023009 15:25941057-25941079 CACCTTGATGTTGAATCTACAGG - Intergenic
1125909989 15:43427831-43427853 TCCCTTGCAGTTGGTTCTACAGG - Intronic
1126706002 15:51405667-51405689 TACTTTGATAGTGGATCCACAGG - Exonic
1129088071 15:73118317-73118339 TACCTTGATGGTGTTACTGGAGG - Intronic
1131233665 15:90678173-90678195 TACCTTGTTGATGATGCTACAGG - Intergenic
1132653603 16:1032366-1032388 GACCTGGGGGGTGGTTCTACAGG - Intergenic
1134013683 16:10873746-10873768 AACCTTAATGATGGTTCTGCTGG + Intergenic
1139499842 16:67353739-67353761 AACCTTGAAGGTGGTTCTACAGG + Intronic
1141162321 16:81637836-81637858 TACCTTGATGGTGGACTTCCTGG - Intronic
1144187205 17:12807895-12807917 TAACTTGATTTTGGTTTTACAGG - Intronic
1145354515 17:22129538-22129560 TACCTTGAAGTTTATTCTACTGG - Intergenic
1149810589 17:59666458-59666480 TGCCTTGTTTGTGGTTTTACAGG + Exonic
1158401149 18:57122471-57122493 TATCTGGGTGGTGGTTCTATAGG - Intergenic
1162551552 19:11361055-11361077 TACCTTCATGGTGGTCTTAAAGG + Intronic
926158618 2:10472576-10472598 TACCTTTAGGATGGTTCTAAGGG + Intergenic
927254511 2:21028492-21028514 TTCCTTGATGATGCTTCTCCGGG - Exonic
928919625 2:36513088-36513110 CACCTTAATGGTGTTTCTAAGGG + Intronic
929334644 2:40726260-40726282 CACCTTCATGGTGCTCCTACTGG + Intergenic
930547814 2:52792216-52792238 TAACTGGCTCGTGGTTCTACAGG + Intergenic
932533257 2:72561878-72561900 TAACTGGATGGTGGTTCCAGTGG - Intronic
935332246 2:101985743-101985765 TGCCTTTATGGTGTTTCTGCTGG + Intergenic
939708286 2:145482108-145482130 TCCCTTCATGGTGCTTCTCCGGG - Intergenic
947400841 2:229730154-229730176 TACATAGATTGTGGTTCTATGGG + Intergenic
1173417421 20:42869256-42869278 TTGCGTGATGGTGGCTCTACAGG - Intronic
1175059863 20:56232120-56232142 TACCTGGATGGTGGTTTTGGAGG + Intergenic
1177032673 21:16001534-16001556 TACCTTGATGTTGGGTTGACAGG + Intergenic
1177463400 21:21442531-21442553 TGCCTTCATGGTATTTCTACGGG - Intronic
1178951034 21:36985927-36985949 AACCTTTATAGTGGTTCTTCTGG - Intronic
1183930818 22:41235166-41235188 TCCTTTGATGGGGGTTCTCCTGG + Exonic
1184686873 22:46100251-46100273 TGCCTTGCTGGTGGTCCTAACGG - Intronic
950132297 3:10555526-10555548 CACCTTGATGTTGGTGCTAAGGG + Intronic
951196154 3:19826040-19826062 TACCTGGGTGGTGGTTATGCAGG - Intergenic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
953940642 3:47092798-47092820 TACCTGGATGGTGGCTGTATGGG - Intronic
959144171 3:102523887-102523909 TACCTTGATTGTGGTATTACTGG + Intergenic
959460986 3:106625289-106625311 TGCTTTTATGGTGGTTCCACTGG - Intergenic
963332889 3:143935536-143935558 TCCCTTGATAATGGTTCTTCAGG - Intergenic
963445790 3:145405968-145405990 TGCTTTGATGGTGGTTCTGGAGG - Intergenic
963647582 3:147935275-147935297 AGCCTTGATCCTGGTTCTACAGG + Intergenic
964966087 3:162495584-162495606 TAACTTGATTTTGGTTTTACAGG - Intergenic
970462110 4:16284787-16284809 TAACTTGATTTTGGTTTTACAGG + Intergenic
971169587 4:24219500-24219522 TATCTTGATGGTGGCTCTCATGG - Intergenic
971861344 4:32109583-32109605 TACCTAGATGATGGTTCGATAGG - Intergenic
972739406 4:41876455-41876477 TAACTTGTTTGTGGTACTACGGG - Intergenic
973655947 4:53048016-53048038 TACCTTGCTGGTGATGCTGCTGG - Intronic
974529443 4:63088891-63088913 TACATTGAGGTTGGTTCCACGGG + Intergenic
976782190 4:88773401-88773423 TACCTTGATGGGAGCTCTATTGG - Intronic
991116767 5:62963875-62963897 TAGCTTGATTTTGTTTCTACAGG - Intergenic
992639791 5:78759371-78759393 TGCCTTAATGGGGGTTCAACTGG - Intronic
995169588 5:109091583-109091605 TTCCATGTTGGTGGCTCTACAGG - Intronic
995591515 5:113705208-113705230 TAACTTGTTGTTGGTTTTACAGG - Intergenic
995915482 5:117240672-117240694 TAATTTGCTGATGGTTCTACAGG - Intergenic
996010422 5:118476256-118476278 TAAATTAATGGTGGTTATACAGG + Intergenic
996837820 5:127813283-127813305 TTCCTTGAGGGTGCTTCTAGAGG - Intergenic
999717279 5:154371430-154371452 GACTCTGATGATGGTTCTACCGG - Intronic
1000120266 5:158190713-158190735 TACCTTGAAGAGGGTTCCACTGG - Intergenic
1000654718 5:163862534-163862556 TCCATTGAAAGTGGTTCTACAGG + Intergenic
1003144587 6:3499134-3499156 AGCCTTCATGGTGGTTCTGCAGG + Intergenic
1003623144 6:7720098-7720120 TACCTGGGTGGTGGTTATACAGG - Intergenic
1005228636 6:23672694-23672716 TAACTGGATTGTGGTTCTGCAGG + Intergenic
1005381495 6:25239246-25239268 TACTTTGATGCTGGTTCCAAGGG + Intergenic
1008532347 6:52474926-52474948 AACCTGGATGGTGGTTATATGGG + Intronic
1009409016 6:63343958-63343980 TTCCTTGCTGGTGGTTCTCTGGG - Intergenic
1014141972 6:117954185-117954207 TACACTGATGGTTGTTCAACTGG - Intronic
1016895614 6:149049020-149049042 TACCTTGATTGTGGTAGTAGGGG + Intronic
1017599651 6:156066903-156066925 TACATTCATGGTGGTCCTACTGG - Intergenic
1019223413 6:170492870-170492892 TACCTGGCTACTGGTTCTACTGG + Intergenic
1021606721 7:22415632-22415654 TACTTAGCTCGTGGTTCTACAGG - Intergenic
1021826275 7:24555397-24555419 CACCTTGCTGGTGGTTACACAGG + Intergenic
1029698646 7:102231434-102231456 TTCCTTGATGTTGGTTTTACTGG + Intronic
1031050875 7:116944121-116944143 AAACTAGATAGTGGTTCTACTGG + Intergenic
1033180421 7:139172436-139172458 TACCTTGATAGTTGTTCATCTGG + Intronic
1037727306 8:21493562-21493584 TGCCTTGTTGATGATTCTACAGG - Intergenic
1040764133 8:50886319-50886341 TAGCTTGTTTGTGGTTCTGCTGG - Intergenic
1042152843 8:65807595-65807617 TACCTTGTTCCTGGTCCTACAGG + Intronic
1042757607 8:72234292-72234314 TATCTTCATGGTGATTTTACAGG - Intergenic
1044593254 8:93934360-93934382 TATTTTGATGGTGGTTATACAGG - Intergenic
1050953633 9:11627897-11627919 TAACTTGATTTTGGTTTTACAGG + Intergenic
1057737635 9:97679429-97679451 TACCTTGAAGGGGATTCTACTGG + Intronic
1186358955 X:8818825-8818847 TGCCCTGATGATGGTTGTACAGG + Intergenic
1188922676 X:35997093-35997115 CACATTTATGGTGGTTCTAAGGG + Intergenic
1192705697 X:73527262-73527284 TAACTTGATTTTGATTCTACAGG + Intergenic
1194560757 X:95416901-95416923 TCTGTTGATGGTGGTTCTATAGG + Intergenic
1196656479 X:118223248-118223270 TTCCTATATGGTGGTTCCACAGG - Intergenic
1196969623 X:121094835-121094857 TTCCTTAATGGAGGTTCTAGGGG + Intergenic