ID: 1079175512

View in Genome Browser
Species Human (GRCh38)
Location 11:18136801-18136823
Sequence GACACCCTCATGACCAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079175512_1079175517 29 Left 1079175512 11:18136801-18136823 CCAGTCCTGGTCATGAGGGTGTC 0: 1
1: 1
2: 0
3: 11
4: 105
Right 1079175517 11:18136853-18136875 TCCACCTGAGAGAAAATTTCAGG 0: 2
1: 2
2: 1
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079175512 Original CRISPR GACACCCTCATGACCAGGAC TGG (reversed) Intronic
901500183 1:9647805-9647827 GAGTCCCTCAGAACCAGGACAGG + Intergenic
902658483 1:17885648-17885670 GACACCCACATGATCTGGACAGG - Intergenic
904825959 1:33273949-33273971 GATACCCAGATGAACAGGACAGG + Intronic
905264233 1:36740022-36740044 GAGATCCTCAGGGCCAGGACAGG - Intergenic
905911928 1:41661492-41661514 CACACCCTCCTGACCATGCCAGG + Intronic
913474362 1:119222905-119222927 GAGGCATTCATGACCAGGACTGG + Intergenic
917124145 1:171670931-171670953 GACAACATCATGACCATGGCCGG - Intergenic
923002595 1:230019972-230019994 GACACCCACATTCTCAGGACAGG - Intergenic
1063461244 10:6216223-6216245 GACACCCTCATGGGTGGGACTGG - Intronic
1066211215 10:33240644-33240666 GAAACTCTCATTACCAGGAGAGG - Intronic
1067756855 10:49011928-49011950 GACACGCTCATGCCCAGCACAGG + Intergenic
1069956343 10:72054223-72054245 GATACCCTCAGGATAAGGACTGG + Intergenic
1078860289 11:15240408-15240430 GAGAGCCTCAGGCCCAGGACAGG - Intronic
1079175512 11:18136801-18136823 GACACCCTCATGACCAGGACTGG - Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079181309 11:18196152-18196174 GACACCCCCATGACTAGGAGTGG - Intronic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079269771 11:18973082-18973104 GACACCCTCATGACTAGGACTGG + Intergenic
1080447834 11:32353540-32353562 GACAACTGCATGAGCAGGACTGG - Intergenic
1085246623 11:75107190-75107212 GTCACCCCCATGAGCAGTACAGG + Intronic
1091226900 11:133962705-133962727 CACACACAAATGACCAGGACAGG - Intergenic
1099729540 12:86483181-86483203 ACTACCCTCATGAACAGGACTGG - Intronic
1102278182 12:111598775-111598797 GACACCCACCTGCCCAGGCCGGG + Exonic
1103890552 12:124235620-124235642 GACAGCCACATGACCAAGGCTGG + Intronic
1104545442 12:129708453-129708475 GACGCCCCCATGACCAAGGCTGG - Intronic
1105784732 13:23737267-23737289 GGGACACTCATGACCAGGACAGG + Intronic
1105796295 13:23856720-23856742 CACAACCTCCTGACCAGAACAGG - Intronic
1106182384 13:27380732-27380754 GGCTCCCTGAAGACCAGGACAGG - Intergenic
1109730525 13:66407470-66407492 GACTCCCCCATGACTAGGATGGG - Intronic
1116023718 14:39491283-39491305 AAGACCCTCATTATCAGGACTGG - Intergenic
1121020966 14:90579939-90579961 GACAGGCTCATGGCCAGGGCAGG - Intronic
1122830209 14:104392293-104392315 GACCCCCTCATGGGCAGGTCCGG + Intergenic
1126792147 15:52231164-52231186 GGCACCCTCCTGACCAGCTCAGG - Intronic
1132017708 15:98333390-98333412 GTCAAGCTCATCACCAGGACTGG + Intergenic
1132157311 15:99504687-99504709 GAAACACTCGTGGCCAGGACCGG + Intergenic
1133752711 16:8737013-8737035 GACACCATGATGACAAGCACAGG - Intronic
1137238329 16:46633609-46633631 CACACCCTCCGGCCCAGGACAGG - Intergenic
1137344057 16:47637984-47638006 GGAACCCTCATGAGCAGGATTGG - Intronic
1137598722 16:49742102-49742124 CACAGCTCCATGACCAGGACAGG + Intronic
1140103082 16:71935357-71935379 GATACCGCGATGACCAGGACAGG - Exonic
1140455915 16:75105457-75105479 GGCACCCTCTTGCCCAAGACAGG + Intronic
1142522465 17:514743-514765 GAGACCAGCATGACCAGTACAGG - Exonic
1144464933 17:15489582-15489604 GACACCATCATAGCCAGGCCAGG - Intronic
1145170876 17:20655500-20655522 GACAAGCTAATGTCCAGGACAGG - Intergenic
1151148453 17:72063589-72063611 GACACGCTCAGAACCAGGACTGG - Intergenic
1152417493 17:80171986-80172008 GATATCCTGAGGACCAGGACTGG - Intronic
1153343658 18:4003301-4003323 GACATCCTCAGGCACAGGACTGG + Intronic
1154021725 18:10669091-10669113 GACACCCACATGCCCATGGCTGG + Intronic
1157680935 18:49605520-49605542 GCCACCTGCATGTCCAGGACAGG + Intergenic
1159345620 18:67199739-67199761 AACTCCCTCAAGACCAGCACAGG - Intergenic
1160080923 18:75726514-75726536 TACACTCTCATGACCATGTCTGG + Intergenic
1160345400 18:78128150-78128172 GCCACCCTTATGCCCAGAACAGG + Intergenic
1161452997 19:4357124-4357146 GACACAGTGATGACCAAGACAGG - Intronic
1165070589 19:33253059-33253081 GTCACACTCATGGCCAGGATGGG + Intergenic
928934045 2:36656059-36656081 GACACCGTCATTATCAGGAAGGG - Intergenic
934238883 2:90251450-90251472 GACAGCATCAGGACCAGGGCTGG - Intergenic
938343317 2:130549514-130549536 CACACCCTCATTTCCAGGATGGG - Intronic
938346516 2:130571208-130571230 CACACCCTCATTTCCAGGATGGG + Intronic
944530079 2:200659060-200659082 GATACCCTCATACCCATGACAGG - Intronic
947960746 2:234235057-234235079 GACACCCTGGTGACAAGAACTGG + Intergenic
948474516 2:238208396-238208418 GACACCTTCCAGAACAGGACTGG - Intergenic
1174514741 20:51083130-51083152 GATACCGTGATGAACAGGACAGG - Intergenic
1176037117 20:63044947-63044969 GACACCCTGCTAACCAGGAGTGG + Intergenic
1176213026 20:63934478-63934500 GACCCCCTCGTGAACCGGACGGG - Exonic
1178710223 21:34910529-34910551 CTCACCCTCATGTCCAGGGCTGG - Intronic
1180998190 22:19975856-19975878 GGCACCCCCATGTCCAGGCCTGG + Intronic
1181158588 22:20941953-20941975 GTCAGCCTAATGACCAGGATGGG - Intronic
1182259658 22:29064267-29064289 GAAAGTCTCATGACAAGGACAGG - Intergenic
1182267273 22:29127214-29127236 GACAGCCACATGACATGGACAGG + Intronic
1182295918 22:29311229-29311251 GACACCCCCCTTCCCAGGACGGG - Intronic
1183685588 22:39359707-39359729 GACACTCCAATGACCAGGACTGG - Intronic
1184666010 22:45989481-45989503 GACACCCCCAGGACAGGGACCGG + Intergenic
950102941 3:10369213-10369235 GCCACCCTCCAAACCAGGACAGG - Intronic
953884740 3:46708852-46708874 AAGACCCTCAGGACCAGGACTGG + Intronic
955475656 3:59333498-59333520 GTCACCCTCATCACCTGGAATGG - Intergenic
956613337 3:71146353-71146375 GACATTCTCATGAAAAGGACTGG - Intronic
961433448 3:126899695-126899717 GGCACTCTCAAGACCAGGAAAGG - Intronic
964059572 3:152505255-152505277 GGCTCCCTCTTGCCCAGGACAGG + Intergenic
965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG + Intronic
968059316 3:195714957-195714979 GACAGACTCATCCCCAGGACAGG - Intergenic
968620993 4:1603453-1603475 GACACCCTGCTGACCAAGGCTGG + Intergenic
968667983 4:1831635-1831657 GACACCATCACCACCAGGGCTGG + Intronic
970974647 4:22029459-22029481 GAAGCCCTCATGATCAGGAGAGG - Intergenic
975651684 4:76599597-76599619 GACACCGTCATGATGAGCACAGG - Intronic
976087133 4:81418119-81418141 GACACCCCCATAACAAAGACAGG - Intergenic
981005752 4:139873412-139873434 GACACCATAATGACCATGAATGG - Intronic
982718193 4:158830817-158830839 GACACAATGATGAACAGGACAGG - Intronic
985646240 5:1086002-1086024 AGCTCCCTCAAGACCAGGACAGG + Intronic
990176950 5:53118602-53118624 TACTCCATCATGACCAGAACTGG - Intergenic
993014754 5:82522644-82522666 GCCACCCTCAGAACCAGGAGAGG - Intergenic
995556184 5:113331392-113331414 GACATCCTCTAGACCAGGACAGG + Intronic
998153813 5:139772577-139772599 GCCACACTCATGCCCAGCACAGG + Intergenic
1002410224 5:179068917-179068939 GACACGCTCATGCGCAGGAGAGG - Intronic
1012038854 6:94177874-94177896 GCCACATTCATGCCCAGGACAGG + Intergenic
1015129690 6:129795294-129795316 GCCACCATCATGACCACGAGTGG + Intergenic
1015441460 6:133251714-133251736 GACACCATCATTACCAGGGGAGG - Intronic
1016443258 6:144106625-144106647 GAAACCCTCATGTGCAGAACGGG + Intergenic
1017439188 6:154447168-154447190 CACACCCTCTCGACCAGTACTGG + Intronic
1019101804 6:169637145-169637167 GATAACCTTATGACTAGGACAGG - Intronic
1019656218 7:2197565-2197587 GACACAGGCACGACCAGGACTGG + Intronic
1021888595 7:25165149-25165171 GATAGCCTCATGACCAGGTGTGG + Intronic
1024657392 7:51463001-51463023 GACAGCCTGAAGACCACGACAGG - Intergenic
1025041290 7:55647835-55647857 GACAACCTCTTGATCAGGATAGG - Intergenic
1025991758 7:66502883-66502905 GACACCCTCATGTCAGGGAAGGG - Intergenic
1027534828 7:79385323-79385345 TACACCTTCAGGACCAGGAATGG + Intronic
1030501455 7:110364502-110364524 GAGACCCTCATCACCACCACAGG - Intergenic
1036667533 8:10757228-10757250 GCTACCCTCCTGACCAGGACTGG + Intronic
1037935244 8:22911205-22911227 GACACCCACATGGCCATGATTGG + Intronic
1044582705 8:93838008-93838030 GGATCCCTCATGACCAGGTCAGG + Intergenic
1045047250 8:98291298-98291320 GCAGCCCTCATGGCCAGGACTGG - Intronic
1045863183 8:106836093-106836115 GACACCCTCATGCTCAGAGCAGG + Intergenic
1047308910 8:123676134-123676156 GACACCCCCATGGGAAGGACGGG + Intergenic
1047802268 8:128322402-128322424 GATACACTGGTGACCAGGACAGG - Intergenic
1049058063 8:140254548-140254570 GAAACCCTCCTGACCAACACAGG + Intronic
1049319340 8:141987699-141987721 GACACCTTGCTGACCAGGAGAGG + Intergenic
1049361686 8:142215075-142215097 GACACCTCCATGGACAGGACAGG - Intronic
1188496294 X:30786632-30786654 GACACCCTCATGATCAGCTTTGG - Intergenic
1191083425 X:56538155-56538177 GATCCCCTCAGGCCCAGGACAGG - Intergenic