ID: 1079179076

View in Genome Browser
Species Human (GRCh38)
Location 11:18172855-18172877
Sequence GACACACTCGTGACTAGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 41}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079179076 Original CRISPR GACACACTCGTGACTAGGAC TGG (reversed) Exonic
901380019 1:8866852-8866874 GAAACACTTGTGACTATGTCAGG + Intronic
901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG + Intronic
913117697 1:115712022-115712044 GACACAAGGGTGAATAGGACAGG + Intronic
914412190 1:147440600-147440622 GACAAAATGGTGACTTGGACTGG + Intergenic
1064242949 10:13647136-13647158 GAAAGACTCGTGATTAGCACAGG - Intronic
1079175512 11:18136801-18136823 GACACCCTCATGACCAGGACTGG - Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079181309 11:18196152-18196174 GACACCCCCATGACTAGGAGTGG - Intronic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079269771 11:18973082-18973104 GACACCCTCATGACTAGGACTGG + Intergenic
1096236643 12:49932851-49932873 GACACAGTGGTGACTAAGGCAGG - Intergenic
1105784732 13:23737267-23737289 GGGACACTCATGACCAGGACAGG + Intronic
1108873639 13:55018256-55018278 GACACACTCTTTACATGGACTGG - Intergenic
1119206646 14:72799335-72799357 GACAGGCTTGTGACTAGGCCTGG + Intronic
1128584102 15:68832459-68832481 TACTCAATCGTGACTAGAACTGG - Intronic
1128632697 15:69282021-69282043 AACACACCCGTGGCTAGGAATGG - Intergenic
1132157311 15:99504687-99504709 GAAACACTCGTGGCCAGGACCGG + Intergenic
1136608072 16:31349736-31349758 GCCGCAATCGTGACTGGGACTGG + Intergenic
1143971146 17:10796847-10796869 GAAACATACGTGACTAGGCCAGG + Intergenic
1152536069 17:80951022-80951044 GACACACCCGTGGCTAGCCCCGG + Intronic
1160150013 18:76391618-76391640 CCCAGACACGTGACTAGGACAGG + Intronic
1162456175 19:10786383-10786405 GACACACTCATGTCTGGGAACGG - Intronic
1165182066 19:33979925-33979947 GACCCACTCTGGACTAGGAGAGG - Intergenic
1165330518 19:35139108-35139130 GACACACACGTGTGTAGGGCTGG + Exonic
1167708548 19:51096599-51096621 GGCACACTTGGCACTAGGACTGG + Intergenic
937171466 2:119874907-119874929 GACACACACGTGAGAAGAACAGG - Intronic
937213546 2:120295001-120295023 TACCCACTCTTGACTAGAACTGG - Intergenic
947960746 2:234235057-234235079 GACACCCTGGTGACAAGAACTGG + Intergenic
1173961144 20:47073600-47073622 GATACAATAGTGACCAGGACAGG + Intronic
1177130894 21:17253706-17253728 GATACACTCGTGAATGGAACAGG - Intergenic
1179968502 21:44820126-44820148 GACCCACATGTGACTAGGAGAGG + Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
955221332 3:57025785-57025807 GATACATTGGTGAGTAGGACAGG - Intronic
965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG + Intronic
970889497 4:21026847-21026869 CACACTCACGTGACTATGACTGG - Intronic
978365698 4:107979137-107979159 GGCACACTAGTGACTATGCCAGG + Intergenic
985775666 5:1840529-1840551 GACACACTCGTCCCAAGGCCTGG - Intergenic
990494438 5:56333466-56333488 AACACACTCATGACTGGGAGTGG - Intergenic
991403821 5:66282013-66282035 GACATACTGGAGACTTGGACAGG - Intergenic
1010231169 6:73536612-73536634 GTCACACTTATAACTAGGACTGG + Intergenic
1019106498 6:169671852-169671874 GACACAGTGGTGAATAGGAAGGG - Intronic
1028751000 7:94382884-94382906 GACACAGTAGTGAATAAGACAGG + Intergenic
1029135899 7:98370954-98370976 GACACACTTGTGAATAGAAAGGG + Intronic
1047802268 8:128322402-128322424 GATACACTGGTGACCAGGACAGG - Intergenic
1051522961 9:18011440-18011462 CACACACTCATGCCTAGGAGAGG + Intergenic
1053356485 9:37450221-37450243 GACACACTCGAGTTTAGGAATGG - Intronic
1059750170 9:117240167-117240189 GTCACACTGGTGACTAAGATGGG + Intronic
1195283593 X:103360388-103360410 GCCACACTCCTGTCTAGGATAGG + Intergenic