ID: 1079181309

View in Genome Browser
Species Human (GRCh38)
Location 11:18196152-18196174
Sequence GACACCCCCATGACTAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079181309_1079181312 17 Left 1079181309 11:18196152-18196174 CCACTCCTAGTCATGGGGGTGTC 0: 1
1: 0
2: 3
3: 6
4: 99
Right 1079181312 11:18196192-18196214 TTTCTGAATTCCTGCACCTGAGG 0: 1
1: 1
2: 3
3: 26
4: 244
1079181309_1079181313 18 Left 1079181309 11:18196152-18196174 CCACTCCTAGTCATGGGGGTGTC 0: 1
1: 0
2: 3
3: 6
4: 99
Right 1079181313 11:18196193-18196215 TTCTGAATTCCTGCACCTGAGGG 0: 1
1: 0
2: 0
3: 23
4: 160
1079181309_1079181315 29 Left 1079181309 11:18196152-18196174 CCACTCCTAGTCATGGGGGTGTC 0: 1
1: 0
2: 3
3: 6
4: 99
Right 1079181315 11:18196204-18196226 TGCACCTGAGGGAAAATTTCTGG 0: 1
1: 0
2: 2
3: 18
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079181309 Original CRISPR GACACCCCCATGACTAGGAG TGG (reversed) Intronic
902636827 1:17740169-17740191 GACAAGCCCATGAGTAGGGGAGG - Intergenic
910091669 1:83471777-83471799 CACACACACATGACTAGAAGAGG + Intergenic
915626601 1:157117774-157117796 GACTCCCCCATGACTGACAGTGG - Intergenic
916070880 1:161169097-161169119 GAAACCCACCTGACTAGTAGGGG + Exonic
916446888 1:164880959-164880981 AAAACCCCTCTGACTAGGAGCGG + Intronic
919415561 1:197304375-197304397 GACACATCTATGACTAGCAGTGG + Intronic
921776651 1:219108605-219108627 AACACCCTCAAGACTAGTAGTGG - Intergenic
923881449 1:238108453-238108475 GACACTTCCAGGACTAGGATGGG + Intergenic
1064338312 10:14463853-14463875 GCCACCCACATGACTGGCAGAGG + Intergenic
1069685101 10:70312844-70312866 GGCACCCCCATCAATAGGATGGG + Intronic
1071946497 10:90651895-90651917 GACACCCCCATGAATAAGAGTGG + Intergenic
1073473246 10:103736844-103736866 GACACCACAAGGACTGGGAGTGG - Intronic
1075529585 10:123218246-123218268 GAAACCACCATGGCTAGGAGGGG + Intergenic
1076517673 10:131057299-131057321 GATACCCCGATGCCTGGGAGAGG - Intergenic
1079175512 11:18136801-18136823 GACACCCTCATGACCAGGACTGG - Intronic
1079177146 11:18152882-18152904 GACACCTCCATGACTAACAGTGG - Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079181309 11:18196152-18196174 GACACCCCCATGACTAGGAGTGG - Intronic
1079261682 11:18888300-18888322 GACACCCTCATGATTTAGAGTGG + Intergenic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079269771 11:18973082-18973104 GACACCCTCATGACTAGGACTGG + Intergenic
1081452063 11:43180660-43180682 GGCTCACCCCTGACTAGGAGAGG + Intergenic
1084801036 11:71544142-71544164 GACACCCCCTTGGCCAAGAGGGG - Intronic
1091154582 11:133361411-133361433 GACACCGCCAGGACCTGGAGGGG - Intronic
1094162333 12:27404842-27404864 GTCACCCCTTTGACTAGGAAAGG - Intronic
1096219757 12:49821590-49821612 GCCACCCCCAACACTAGGTGGGG + Intronic
1097693451 12:62755602-62755624 GACACCCCCATGTCTGTGATGGG + Intronic
1098731496 12:74040951-74040973 GGCACCACCATGGCTGGGAGAGG - Intergenic
1102474025 12:113176995-113177017 TACACCCCCACCACTAGGAAGGG + Intronic
1109730525 13:66407470-66407492 GACTCCCCCATGACTAGGATGGG - Intronic
1110406862 13:75160593-75160615 GACACTCCCATGCAGAGGAGTGG + Intergenic
1110919881 13:81069990-81070012 GTCACCCCTTTGACTAGGAAAGG + Intergenic
1111946059 13:94667260-94667282 GACTCCCCCATGTCTCTGAGTGG + Intergenic
1125540418 15:40466759-40466781 GCCACACCCATGACTGTGAGAGG - Exonic
1129206905 15:74042749-74042771 TACACCCTCATGAGTAGGGGAGG - Intronic
1132593331 16:736216-736238 GACGCCCCCTTGATTTGGAGCGG + Intronic
1133334053 16:4995275-4995297 GCCACCCTCATGGCTAAGAGTGG + Intronic
1133430329 16:5731487-5731509 CACACCCAGATGAGTAGGAGGGG + Intergenic
1144327257 17:14193989-14194011 GACACCCCCATCCCTGGCAGGGG + Intronic
1145097362 17:20042289-20042311 GATACCTCCCTGGCTAGGAGGGG + Intronic
1151047773 17:70941712-70941734 GATACCCACCTTACTAGGAGAGG + Intergenic
1151472141 17:74325274-74325296 GGCAGCCCCAAGACTGGGAGAGG - Intergenic
1151665958 17:75545239-75545261 GCCACCCCCAGGCCTGGGAGTGG - Intronic
1151749553 17:76028766-76028788 GACACCCCCATTCCTAGAGGTGG + Intergenic
1158182117 18:54728296-54728318 GCCACCCCCATGAGAGGGAGGGG - Intronic
1159025721 18:63180708-63180730 GAGAGCCCCATCACTAGTAGGGG - Intronic
1162503299 19:11066956-11066978 GACACGGCCTGGACTAGGAGGGG + Intergenic
1162567375 19:11451761-11451783 GCCACCCCCAAGACTGGGAGGGG - Exonic
1164028037 19:21371307-21371329 GACACCCAGGTGATTAGGAGAGG - Intronic
1166381994 19:42359524-42359546 AACACCCCCATGTCTAATAGTGG - Intronic
1166641687 19:44499578-44499600 GACACCCCCAGGACGTGCAGGGG + Intronic
925154628 2:1639917-1639939 AACACCTCCCTGCCTAGGAGTGG + Intronic
932878698 2:75479017-75479039 CACAGCCCCATGACTGTGAGAGG - Intronic
934884627 2:98013832-98013854 GACACAACCATGATTACGAGAGG + Intergenic
936529910 2:113268937-113268959 GACAGCCCCATGGCCAGCAGTGG + Intronic
936920986 2:117687948-117687970 GACACTACCTTGCCTAGGAGAGG - Intergenic
946160147 2:217830876-217830898 GAGAAACCCATGACTAGCAGTGG - Intronic
1175189938 20:57204675-57204697 CACCCTCCCATGGCTAGGAGTGG - Intronic
1176522974 21:7838591-7838613 GAGACCCCCATGAGAAGGGGTGG + Intergenic
1178656994 21:34468603-34468625 GAGACCCCCATGAGAAGGGGTGG + Intergenic
1180782849 22:18530295-18530317 GACAGCCCCAGGAAGAGGAGCGG - Exonic
1181126412 22:20704326-20704348 GACAGCCCCAGGAAGAGGAGCGG - Intergenic
1181239747 22:21469657-21469679 GACAGCCCCAGGAAGAGGAGCGG - Intergenic
1182413142 22:30204116-30204138 GTCTCCTCCATGACAAGGAGGGG + Intergenic
1183685588 22:39359707-39359729 GACACTCCAATGACCAGGACTGG - Intronic
1184666010 22:45989481-45989503 GACACCCCCAGGACAGGGACCGG + Intergenic
1184880333 22:47300497-47300519 GAGACCCCCATGCCTCGGATGGG + Intergenic
950835227 3:15913130-15913152 GCCACCCCTTTGACTAGGAAAGG + Intergenic
951442937 3:22743510-22743532 GTCACCCCATTGACTAGGAAAGG + Intergenic
952274802 3:31866721-31866743 GACAGCCCCAAGAGTAGGTGAGG - Intronic
952553668 3:34507521-34507543 CACATACCCATGACTTGGAGTGG - Intergenic
965317252 3:167208117-167208139 GACTCCCCCATGCCTAGGGCTGG - Intergenic
965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG + Intronic
967336775 3:188352774-188352796 GACACTGCCGTGCCTAGGAGTGG + Intronic
972015301 4:34235874-34235896 GAAACCCCCAATACTAGGTGAGG + Intergenic
972130053 4:35821475-35821497 GACCCTCCCATGAGTAAGAGGGG + Intergenic
976087133 4:81418119-81418141 GACACCCCCATAACAAAGACAGG - Intergenic
977084420 4:92575916-92575938 GACCCTCCCATGAGAAGGAGTGG + Intronic
985197972 4:187452322-187452344 GCCATCCACATGACAAGGAGAGG - Intergenic
988984444 5:36603115-36603137 GGCTCCCCATTGACTAGGAGTGG + Intergenic
990494438 5:56333466-56333488 AACACACTCATGACTGGGAGTGG - Intergenic
997626009 5:135330970-135330992 ACCACCCCCAGGACTGGGAGGGG + Intronic
1001570444 5:172727306-172727328 ACCACCCCCATGGCCAGGAGGGG - Intergenic
1003141109 6:3472094-3472116 AACCCCCCCATTTCTAGGAGAGG + Intergenic
1019645593 7:2127193-2127215 GGCACTCCCATGACTAGCAAAGG - Intronic
1023178696 7:37459107-37459129 GACATCCCCAAGACTGGGAGCGG - Intergenic
1023966318 7:44964831-44964853 GACAACCCCAGGCCTGGGAGAGG + Intronic
1024228091 7:47343564-47343586 GTCACCTCCATGAGGAGGAGGGG + Intronic
1024646829 7:51377927-51377949 GAAACCCCCACTGCTAGGAGGGG - Intergenic
1027308520 7:76928229-76928251 CACACACACATGACTAGAAGAGG + Intergenic
1030434724 7:109502172-109502194 GACACCTTCCTGGCTAGGAGAGG + Intergenic
1030633260 7:111918622-111918644 GAGACACCCATGATTAGGTGGGG - Intronic
1032459762 7:132102001-132102023 CACACCACCATGTCTTGGAGGGG + Intergenic
1037937620 8:22925800-22925822 AACACCCCCGTAACCAGGAGAGG - Intronic
1042487028 8:69357169-69357191 GTCACCCCTTTGACTAGGAAAGG + Intergenic
1045510570 8:102809476-102809498 CACACCCCCAGGATTAGGCGCGG - Intergenic
1047308910 8:123676134-123676156 GACACCCCCATGGGAAGGACGGG + Intergenic
1051522961 9:18011440-18011462 CACACACTCATGCCTAGGAGAGG + Intergenic
1056678301 9:88695454-88695476 GACAGCCCCATGACAACGTGGGG + Intergenic
1057079456 9:92161386-92161408 GATACCCCGATGCCTGGGAGAGG - Intergenic
1057542708 9:95990408-95990430 GATAGCCCCAAGACTCGGAGGGG + Intronic
1058902553 9:109454980-109455002 AACACCACCATGACTATGAGTGG + Intronic
1059378876 9:113907893-113907915 GACACCCCCATGATTCTGAAGGG - Intronic
1061257759 9:129462535-129462557 CACAGCACCATGACCAGGAGAGG + Intergenic
1061257768 9:129462584-129462606 CACAGCACCATGACTGGGAGAGG + Intergenic
1190243786 X:48677178-48677200 GACACCCCCAGGGCTGGGACAGG - Intronic
1194494394 X:94594147-94594169 GACCCCACCAGGACTAGAAGCGG + Intergenic
1199607971 X:149591915-149591937 GGCACCGCCATGACAAGGAATGG + Intergenic
1199631149 X:149777441-149777463 GGCACCGCCATGACAAGGAATGG - Intergenic