ID: 1079181927

View in Genome Browser
Species Human (GRCh38)
Location 11:18201401-18201423
Sequence CCCAATAGGTACTCTGTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2717
Summary {0: 1, 1: 1, 2: 45, 3: 834, 4: 1836}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079181920_1079181927 6 Left 1079181920 11:18201372-18201394 CCGCTTCTCACAGCTCCACTAGG 0: 1581
1: 2034
2: 1486
3: 837
4: 562
Right 1079181927 11:18201401-18201423 CCCAATAGGTACTCTGTGTCGGG 0: 1
1: 1
2: 45
3: 834
4: 1836
1079181919_1079181927 7 Left 1079181919 11:18201371-18201393 CCCGCTTCTCACAGCTCCACTAG 0: 11
1: 1752
2: 2112
3: 1409
4: 948
Right 1079181927 11:18201401-18201423 CCCAATAGGTACTCTGTGTCGGG 0: 1
1: 1
2: 45
3: 834
4: 1836
1079181922_1079181927 -9 Left 1079181922 11:18201387-18201409 CCACTAGGCAGTGCCCCAATAGG 0: 16
1: 436
2: 1380
3: 1763
4: 1630
Right 1079181927 11:18201401-18201423 CCCAATAGGTACTCTGTGTCGGG 0: 1
1: 1
2: 45
3: 834
4: 1836
1079181918_1079181927 22 Left 1079181918 11:18201356-18201378 CCTGGAGGACGGTGTCCCGCTTC 0: 1
1: 0
2: 10
3: 54
4: 163
Right 1079181927 11:18201401-18201423 CCCAATAGGTACTCTGTGTCGGG 0: 1
1: 1
2: 45
3: 834
4: 1836

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079181927 Original CRISPR CCCAATAGGTACTCTGTGTC GGG Intronic
Too many off-targets to display for this crispr