ID: 1079182308

View in Genome Browser
Species Human (GRCh38)
Location 11:18204540-18204562
Sequence GGGAAAAGCCTGTCTTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079182308_1079182318 30 Left 1079182308 11:18204540-18204562 CCCTGAGAAGACAGGCTTTTCCC 0: 1
1: 0
2: 0
3: 19
4: 204
Right 1079182318 11:18204593-18204615 AGCACACCATCGAGAACTTGAGG 0: 1
1: 0
2: 1
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079182308 Original CRISPR GGGAAAAGCCTGTCTTCTCA GGG (reversed) Intronic
900264907 1:1752488-1752510 GGGAAAAGCATGGCAGCTCAAGG + Exonic
900331721 1:2138201-2138223 CGGAAAAGTCTCTCTTCTCCTGG - Intronic
900808107 1:4781184-4781206 GGGACATGCCTGCCTTCTGAGGG - Intronic
902139381 1:14339856-14339878 GGGGAAAGGCTGTATTTTCAGGG - Intergenic
902180893 1:14687510-14687532 GGGAAAAGCGTGTGTGCTCTGGG + Intronic
903061401 1:20671186-20671208 GTAGAAAACCTGTCTTCTCAGGG + Intronic
903590163 1:24449390-24449412 AGGAGAAGCCTGTTTTTTCATGG + Intronic
907173082 1:52490135-52490157 AAAAAAAGCCTCTCTTCTCAAGG - Intronic
909979491 1:82081769-82081791 TGTAAAAGGCTGACTTCTCATGG - Intergenic
911149188 1:94580576-94580598 GGGAAAAGCATGGTTTCCCAGGG + Intergenic
912714179 1:111970604-111970626 GAGAAATGCCTGTGTTCACAGGG - Intronic
914453960 1:147818062-147818084 AGGGAGAGCCTGTCTTCTTAGGG - Intergenic
922966630 1:229696222-229696244 GAGAGATGCCTGACTTCTCAGGG - Intergenic
922987995 1:229881062-229881084 GGGATCAGCCTGTCTTCTAGGGG + Intergenic
923519815 1:234726669-234726691 AGGAACAGGCTGTTTTCTCAGGG + Intergenic
924683398 1:246260977-246260999 GGGAAAAGCCTTCCTTCTAAGGG - Intronic
1064319336 10:14288074-14288096 GGCATAAGTCTTTCTTCTCAGGG - Intronic
1065425229 10:25595984-25596006 GATAAAATCCTGTATTCTCATGG + Intronic
1067995047 10:51262731-51262753 AAGCAAAGCATGTCTTCTCATGG + Intronic
1069949564 10:72009659-72009681 GGGAGAAGGCGGGCTTCTCAGGG - Exonic
1074237106 10:111596423-111596445 GGTAAAAGCCTGACCTTTCATGG + Intergenic
1074398720 10:113123308-113123330 GGCCAGAGCCTGTCTTTTCAGGG - Intronic
1076040728 10:127245974-127245996 GGGAAAAGCTCCTCCTCTCAAGG + Intronic
1077018076 11:405756-405778 GGGAAAAGGCTGTGGCCTCAGGG - Exonic
1079182308 11:18204540-18204562 GGGAAAAGCCTGTCTTCTCAGGG - Intronic
1079361056 11:19770590-19770612 GGGAATAGCATGTCTGCTCTTGG + Intronic
1081300116 11:41441013-41441035 GAGCCAAGCCAGTCTTCTCAAGG + Intronic
1084443418 11:69189430-69189452 GGGAAAATGCTGTCTCCTGATGG - Intergenic
1085440190 11:76554688-76554710 GGGAAAAGCCTCTATTGTCATGG + Intergenic
1085750917 11:79160451-79160473 GGGGAGAGCCTCTCTTCTCCAGG + Intronic
1085919407 11:80934043-80934065 GGGAAAAACCTGTTTTATTAGGG + Intergenic
1088918285 11:114243402-114243424 GGGAAGAGCTTTACTTCTCATGG + Intronic
1089331702 11:117693591-117693613 GGGAAAAGCCTGTGTCAGCATGG + Intronic
1090678483 11:129027955-129027977 CGGAAAAGCCTCTTTACTCAGGG + Intronic
1091074839 11:132605767-132605789 TGGACAAACCTGTGTTCTCAAGG - Intronic
1091586465 12:1819789-1819811 GGGACGAGCTTGGCTTCTCAGGG - Intronic
1094328928 12:29271683-29271705 TGGAAAAGCCTCACATCTCATGG + Intronic
1095628835 12:44350137-44350159 GGGAACAGCCTGTCTTCACTAGG + Intronic
1095971391 12:47904244-47904266 GGGAACAGCCTGTGGTCTCCAGG - Intronic
1096624810 12:52888082-52888104 GGGAAATCCCTGCCTTCTCTGGG - Intergenic
1096877747 12:54643905-54643927 GGGAGATGCCTGTCTCCTCCTGG + Intergenic
1097222107 12:57457058-57457080 GGGTAAAGCGTTTCTTCTAAAGG + Exonic
1098128253 12:67322386-67322408 GGGAGAAGCCTGGGTTCCCAGGG - Intergenic
1098617277 12:72543498-72543520 GGGAAAATCTTTTTTTCTCAAGG + Intronic
1099307187 12:80971787-80971809 GGGAAAAGCCAGTCTTTTCCAGG + Intronic
1104322762 12:127767322-127767344 CTGAAAAGCCTGTGTTCTCTGGG - Intergenic
1104435477 12:128752934-128752956 GGTCAGAGCCTGTCTACTCAGGG - Intergenic
1104747426 12:131219279-131219301 GGGAGAGGCCTCTCTCCTCACGG + Intergenic
1105927623 13:25021558-25021580 TGAAAAAGTCTCTCTTCTCAGGG + Intergenic
1107205557 13:37781806-37781828 GGGAAAAGCCTGTGTTTTTATGG - Intronic
1107264271 13:38533745-38533767 GGAAAAAGCCTGTGTCCCCAAGG - Intergenic
1107295798 13:38906000-38906022 AAGAAAAGCCTGTCACCTCAGGG - Intergenic
1112868512 13:103938853-103938875 CGGAAATGTCTGTCTCCTCATGG + Intergenic
1117494019 14:56283889-56283911 GAAACAAGCCTGTCTTTTCAAGG - Intronic
1119139045 14:72248330-72248352 GTAAAAAGAATGTCTTCTCATGG + Intronic
1119605793 14:76015277-76015299 GGGAAATGCCTATCTCCTGAGGG - Intronic
1119942622 14:78657189-78657211 GAGAAATGCATGTCCTCTCAGGG - Intronic
1120190280 14:81434476-81434498 AGGAAATGCTTATCTTCTCAGGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122238971 14:100349324-100349346 GTGTAAAGCCTCTCTTCTAATGG - Intronic
1122637031 14:103134965-103134987 GGGAAGAGGCGGTCATCTCAGGG + Intronic
1125479966 15:40073101-40073123 GGGAAGAGCCTGGCATCCCAGGG + Intergenic
1126185478 15:45827327-45827349 GGGAGTAGACTGGCTTCTCATGG + Intergenic
1128501142 15:68228623-68228645 TGGAACAGCCTGTCTTCCCTGGG + Intronic
1128893197 15:71349557-71349579 GGGAAAATACAGGCTTCTCAAGG - Intronic
1129243119 15:74263385-74263407 AGGCAAAGCCTGTCCTCTCAGGG - Intronic
1129514850 15:76151115-76151137 GGGAAACGCCTGCCCTCTCGTGG + Intronic
1130017536 15:80199513-80199535 CAGAAATGCCTGGCTTCTCAAGG + Intergenic
1131603794 15:93879181-93879203 GGGCAAAGACTGCTTTCTCAAGG + Intergenic
1132028561 15:98422180-98422202 AGGAAAAAACTGTGTTCTCAGGG + Intergenic
1133106918 16:3517637-3517659 GGGAAAAGAGTCACTTCTCAGGG + Intronic
1134838624 16:17383090-17383112 GAGAAAAGCCAGGCTTCCCATGG + Intronic
1135245978 16:20857520-20857542 GGGAAAAGCCAGGCTGCTCTTGG - Exonic
1135461818 16:22651006-22651028 GGGATATGCATGTCTTGTCAAGG + Intergenic
1135734516 16:24920115-24920137 GGGAAAGGGCTTTCTTCACAGGG + Exonic
1136016366 16:27403571-27403593 GAGAAAACCATGGCTTCTCAAGG - Intronic
1139246703 16:65451893-65451915 AGGAAAGGCCTGTGCTCTCATGG - Intergenic
1139946809 16:70647398-70647420 GGGAACAGGCTGCCTTCTCCAGG - Intronic
1141123755 16:81385279-81385301 GGAATAAGCCTTTGTTCTCATGG - Exonic
1141274822 16:82577812-82577834 GGGTAAGGGATGTCTTCTCAAGG + Intergenic
1141729122 16:85810024-85810046 AGGAAGAGCCGGACTTCTCAAGG - Intergenic
1143755662 17:9065449-9065471 AGGAAAAGCCTGTCTCAGCAAGG - Intronic
1143781316 17:9231028-9231050 GGGAAAGGCTAGTCTTCTCCTGG + Intronic
1147266410 17:39237391-39237413 GGGAGAAGCCTGTCCACTCTAGG - Intergenic
1150868374 17:68878254-68878276 AGAAAGAGCCTGTCTTCTGAGGG + Intronic
1155656877 18:28203019-28203041 GGGAACTGCCTGTCTTCTGAGGG + Intergenic
1157448915 18:47771165-47771187 GGGAAAGGCCTTTCTTTTCGTGG - Intergenic
1158046080 18:53157066-53157088 GGGAAAAAAATGTCTGCTCAGGG - Intronic
1159806533 18:72964057-72964079 GGGACCAGCATGTCTTCTTAGGG - Intergenic
1160375286 18:78406813-78406835 GGTAAAAGCCTGTCCCCTCTAGG - Intergenic
1160891139 19:1379364-1379386 GGGTCAAGCCTGTCTTCCCGGGG - Intergenic
1162310752 19:9905783-9905805 AGGTAAAGCTTTTCTTCTCAAGG - Intronic
1162443376 19:10707232-10707254 GGGGAAAGCCTGCCGTCACATGG - Intronic
1163774587 19:19210571-19210593 GGGCAAAGCCTGCCCTCTCTGGG + Intergenic
1166707073 19:44913954-44913976 AGGACAAGGCTGTCTTCTTAAGG + Intergenic
1166802476 19:45467134-45467156 GAGAGAAGCCTCTCTTCTGATGG - Intronic
1168101169 19:54141874-54141896 GGCATAAGCCTCTCTTCCCAGGG + Exonic
925529009 2:4838887-4838909 GCCATGAGCCTGTCTTCTCATGG + Intergenic
926530394 2:14037938-14037960 AGGAAAAGACTGGCTTCTTATGG + Intergenic
932745807 2:74332638-74332660 GGAAAAAGCCTGTCTTCAGTGGG + Intronic
932749835 2:74364383-74364405 GCAAAAAGCCTGTCTTCTGGAGG + Intronic
934847244 2:97669741-97669763 TGGAGAAGCCAGTCTTCTGATGG - Intergenic
937024200 2:118683744-118683766 GGGACAGGCCTGTCTTCTAGCGG + Intergenic
937182822 2:120011795-120011817 GGGACAGGTCTGTCTTTTCAAGG - Intergenic
937608968 2:123837441-123837463 TGGAAAAGACTCTCTTCTCATGG + Intergenic
937943441 2:127309147-127309169 GAGAAAAGGCTGACTTCTCAGGG - Intronic
938369935 2:130762613-130762635 GGGAAAAGCCTGCCCTCCCCAGG + Exonic
942082654 2:172416019-172416041 TCGATAAGCCTGTCTGCTCATGG + Intergenic
944709183 2:202320381-202320403 GGTTCAAGCCTGTATTCTCAGGG - Intergenic
944941460 2:204632699-204632721 GGGAGAAGCCTGGCTTCCCAGGG + Intronic
946567168 2:220979543-220979565 GGGAAAATCCCATCTTCTTAAGG + Intergenic
946596359 2:221309932-221309954 GGGAAGGGGCTGTGTTCTCAAGG - Intergenic
948413281 2:237781461-237781483 GGGAAAACGCCATCTTCTCAGGG - Intronic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1169266194 20:4168500-4168522 GGGAATAGCCTGTGTTCGGAGGG + Intronic
1170076697 20:12427499-12427521 GGGAAAAGCCTCTATTCTGATGG + Intergenic
1170519416 20:17168633-17168655 GGGCAAAGCCTCTCCTCTCTGGG + Intergenic
1170737076 20:19021778-19021800 GGGCACAGCCTGACTTCCCATGG + Intergenic
1173145609 20:40521651-40521673 GAAAAAAGCCTGTCTCATCATGG + Intergenic
1173617260 20:44411255-44411277 GTGATGAGCCTGTCTTCCCAGGG - Intronic
1174400403 20:50272907-50272929 GGGAACAGCCTGTCATCCCCAGG + Intergenic
1175062824 20:56259225-56259247 AGGTAAAGCCTGCCTCCTCATGG - Intergenic
1175093165 20:56521212-56521234 GGGAAAAGAATGCATTCTCAGGG - Intronic
1175135452 20:56820221-56820243 GGAAACAGCCTGTCACCTCATGG + Intergenic
1175422501 20:58843340-58843362 AGCAAAATCCTGTCTTCTCAGGG - Intronic
1177281746 21:18989980-18990002 GATCAAAACCTGTCTTCTCATGG - Intergenic
1177434628 21:21035021-21035043 GGTAAATTCCTCTCTTCTCAAGG + Intronic
1179033280 21:37738577-37738599 GGGTAAAACATGACTTCTCAAGG - Intronic
1179596097 21:42444083-42444105 GGGACAAGCGTGTCTCCTGAGGG + Intronic
1184703031 22:46190192-46190214 GAGAAAAATCTGTCTTCTGATGG + Intronic
951489549 3:23254493-23254515 TGAAAAAGCCTGTGTTCTCAAGG + Intronic
952561011 3:34593415-34593437 AGCAAAAGCATTTCTTCTCAAGG - Intergenic
953537665 3:43788400-43788422 GGGAGATGTCTGTATTCTCATGG + Intergenic
953700668 3:45193233-45193255 AAGCAAAGCCTGTCTTCTCCGGG + Intergenic
954751547 3:52817009-52817031 GGGAGAAGGCTGGGTTCTCATGG - Exonic
955087409 3:55716718-55716740 GAGATAAGCCTGTTTGCTCAGGG - Intronic
956131027 3:66054065-66054087 GGGCAAAGGCGTTCTTCTCATGG + Intergenic
956174380 3:66459274-66459296 GGTAAAAGCCTGTCTAGGCAAGG + Intronic
956798680 3:72738220-72738242 GGGAAAAGCCTGAGCTCTCTCGG + Intergenic
956884385 3:73544409-73544431 GGGAAAAGCCACTCTTTTAAAGG - Intronic
959256071 3:104016202-104016224 TGGTAAGGCCTGTGTTCTCATGG + Intergenic
960254489 3:115497658-115497680 AGTAAAAGACTGTCTTCTTATGG + Intergenic
960913928 3:122678763-122678785 GGGAAGCACGTGTCTTCTCAGGG - Intergenic
962491953 3:135903176-135903198 AGGATAAGCCTGGCTTCTCTTGG - Intergenic
971575601 4:28269342-28269364 AGGATAAGCCTTTCTTGTCAAGG - Intergenic
972258586 4:37385186-37385208 AGGAAAAGCCTCTCTACTCTTGG + Intronic
975106393 4:70572720-70572742 GGGAAAAACGTGGGTTCTCAGGG + Intergenic
977074491 4:92435610-92435632 GTGAAAAGCTTTTCTTCTCTAGG - Intronic
977316760 4:95459643-95459665 GGCAAAAGACTGTTTTATCAAGG + Intronic
981234188 4:142395474-142395496 GGGAAAAGTCTGTCAACTCTCGG - Intronic
982009279 4:151091278-151091300 GGGAACAGCCTCTATCCTCAGGG - Intergenic
982979802 4:162118045-162118067 GGGAAAAACCTCCCTTGTCAAGG + Intronic
983395800 4:167194750-167194772 GAGACAATCCAGTCTTCTCAGGG - Intronic
983863535 4:172736296-172736318 GGGAAAATATTGTATTCTCAGGG - Intronic
986281587 5:6327529-6327551 GGGTAAAGACTGTCTCCTCAGGG + Intergenic
991488181 5:67159601-67159623 GGGAGAAACCTGTCCTTTCAAGG - Intronic
991607156 5:68414195-68414217 GGGCTAAGCCTGGCATCTCAAGG + Intergenic
993466753 5:88257007-88257029 GGCTAAAGCCTGTAATCTCAGGG + Intronic
993870816 5:93252285-93252307 AGGATAATCCTGTGTTCTCATGG + Intergenic
995812998 5:116130256-116130278 GGCAAAATCCTTTGTTCTCAAGG + Intronic
997145234 5:131426076-131426098 TGGAAAAGTATGTCCTCTCAAGG + Exonic
999539746 5:152558483-152558505 GGGAAAGGGCTGTCGTCACATGG - Intergenic
1003313803 6:4993145-4993167 GGAAAATGCCTGCCTTCTGAAGG - Intergenic
1005152257 6:22765645-22765667 GGGAAAATTCTGCCTTCTCCTGG - Intergenic
1006036716 6:31219254-31219276 GGTAAATTTCTGTCTTCTCAAGG + Intergenic
1009563612 6:65279514-65279536 AGAAAAAGCCTGTCTTCTTTTGG - Intronic
1011074047 6:83418982-83419004 CAGAAAAGCTTGGCTTCTCAGGG + Intronic
1011746464 6:90412168-90412190 GGGAAAAGAATGTATTCCCAGGG - Intergenic
1012906133 6:105068546-105068568 GGGATCAGCCTGTGGTCTCATGG - Intronic
1013388766 6:109661330-109661352 AGGAATGGCTTGTCTTCTCATGG + Intronic
1014649355 6:124017120-124017142 AGCAAAAGCCTGTCTTAACATGG + Intronic
1018066393 6:160127539-160127561 GGGCCCAGCCTATCTTCTCAAGG + Intronic
1018546817 6:164946390-164946412 GGGAAAAGCCTGTCCAGTTAAGG - Intergenic
1019496892 7:1345009-1345031 GGGTCAGGCCTGCCTTCTCAGGG - Intergenic
1020435575 7:8158895-8158917 GTTAAAATCCTTTCTTCTCAAGG + Intronic
1020464924 7:8466643-8466665 GGGAAAATCCTTTCATCTGATGG + Intronic
1020857780 7:13451092-13451114 AGGCAAGGCATGTCTTCTCATGG + Intergenic
1023955462 7:44883887-44883909 TGTAAAGGCCTCTCTTCTCAAGG + Exonic
1023993458 7:45144673-45144695 GGAGAAAGCCTGTGTTCTTAGGG + Intergenic
1024085872 7:45890819-45890841 GGGAAAAGCATTTCTTTCCAGGG - Intronic
1024144712 7:46501683-46501705 GGGAAAAGCATGTCATTTGAAGG - Intergenic
1025089810 7:56052342-56052364 GGGAAAAGCCCGTTTTCTAATGG + Intronic
1025901962 7:65751633-65751655 GGGAAAAGCCCGTTTTCTAATGG + Intergenic
1026574425 7:71560407-71560429 GATCAAAGCCTGTGTTCTCATGG - Intronic
1028536231 7:91890971-91890993 GAGAAAAGTCTGTGTCCTCAAGG - Intergenic
1030098580 7:105923746-105923768 GAGGAAACCATGTCTTCTCAGGG - Intronic
1030628047 7:111865402-111865424 GGGCAAACCCTGTCTTCTAGAGG - Intronic
1033145266 7:138865787-138865809 GGGAGGAACCTGTCTTCTCCTGG - Intronic
1033549496 7:142433867-142433889 GGGACATCCCTGTCCTCTCATGG - Intergenic
1039028904 8:33288149-33288171 GAGAATAGCATTTCTTCTCAAGG - Intergenic
1039935292 8:42038317-42038339 GGGAAAAGACTGCTTTCTTATGG - Intronic
1040859979 8:51989127-51989149 AGGGAAAGCCTGTCCTCTCTTGG + Intergenic
1040976237 8:53197369-53197391 GGGGCAGGCCTGGCTTCTCAGGG + Intergenic
1041969068 8:63715947-63715969 GGGAAAAGCTGGTCTTCTTGTGG + Intergenic
1043700853 8:83287378-83287400 TGGAAAAGCCAGTGTTTTCAGGG - Intergenic
1044814669 8:96099322-96099344 GGGAAATGCTTGACTTCTCATGG + Intergenic
1046013925 8:108583431-108583453 GGGAAGATCCTGTCCACTCAGGG - Intergenic
1046589327 8:116187130-116187152 GGAAGAAGCATCTCTTCTCATGG + Intergenic
1047254341 8:123204778-123204800 AGGAAACGCCTCTCTGCTCATGG + Intronic
1048177059 8:132162428-132162450 GGGATGAGCCTGTCCTCTCCAGG + Intronic
1048544277 8:135371749-135371771 GTTAAAAGACTTTCTTCTCAAGG - Intergenic
1049725422 8:144143443-144143465 GAGGAAAGCCTGTCTTACCATGG + Intergenic
1050944719 9:11501794-11501816 GGGAAAACCCTGTCTTGTGCTGG + Intergenic
1051208213 9:14712700-14712722 AGGAAAATTCTGTCTTCTCTAGG + Intergenic
1051934397 9:22428022-22428044 GGGAAAGGCCTTGATTCTCAAGG - Intergenic
1055629944 9:78213199-78213221 GGGAAAAGACTTGATTCTCAAGG + Intergenic
1055727771 9:79250059-79250081 GGGAAATGTATGTCTTCACATGG + Intergenic
1057272940 9:93660781-93660803 GGGCAAAGCCTGTCCACTCTGGG - Intronic
1057974944 9:99595475-99595497 GGGAGAAGCCTTCCTCCTCAGGG + Intergenic
1059447925 9:114350555-114350577 GAGAAAAGCCTGTCCTTTCTAGG - Intronic
1059453232 9:114383790-114383812 CGGGAAAGGCTGACTTCTCAAGG + Intronic
1059690774 9:116684090-116684112 GGTAAATTCCTCTCTTCTCAAGG - Intronic
1062364497 9:136202413-136202435 GGAAAAAGCCTCTCTTCTCCAGG - Intronic
1186352734 X:8756777-8756799 GCCAAGAGCCTGTCTTCCCAAGG - Intergenic
1187507762 X:19890369-19890391 TGGAGAAGACAGTCTTCTCATGG + Intergenic
1188582705 X:31734828-31734850 GGCCAAAGACTGTCTTCTGAAGG + Intronic
1191898635 X:66019114-66019136 GGGAAAAGTGTGGCATCTCAGGG + Intergenic
1192818767 X:74620883-74620905 GGGCAAAGCCTCAGTTCTCACGG - Intergenic
1193762959 X:85489516-85489538 GGGAAAAGCATGGTTTCCCAAGG + Intergenic
1194045025 X:88991926-88991948 GGGAACACTCTCTCTTCTCATGG + Intergenic
1196290772 X:113938287-113938309 AGACAAAGCCTGTGTTCTCATGG + Intergenic
1196311165 X:114167515-114167537 GGGAAAAGAATGTATTCCCAAGG - Intergenic
1198027463 X:132721476-132721498 AGGAAAAACCTGTCTTCAAAGGG + Intronic
1199928726 X:152496258-152496280 GGAGAGAGCCTGTCTTCTCAAGG - Intergenic