ID: 1079183579

View in Genome Browser
Species Human (GRCh38)
Location 11:18215546-18215568
Sequence CAGGTTCCAGGTGGGTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 2, 2: 2, 3: 44, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079183579_1079183589 11 Left 1079183579 11:18215546-18215568 CCTCTAGACCCACCTGGAACCTG 0: 1
1: 2
2: 2
3: 44
4: 243
Right 1079183589 11:18215580-18215602 CACCCTGAAGGGAAGGACACAGG 0: 19
1: 80
2: 115
3: 191
4: 398
1079183579_1079183585 -1 Left 1079183579 11:18215546-18215568 CCTCTAGACCCACCTGGAACCTG 0: 1
1: 2
2: 2
3: 44
4: 243
Right 1079183585 11:18215568-18215590 GAGGATACTCACCACCCTGAAGG 0: 1
1: 1
2: 6
3: 36
4: 228
1079183579_1079183592 20 Left 1079183579 11:18215546-18215568 CCTCTAGACCCACCTGGAACCTG 0: 1
1: 2
2: 2
3: 44
4: 243
Right 1079183592 11:18215589-18215611 GGGAAGGACACAGGCCTGACTGG 0: 6
1: 63
2: 203
3: 452
4: 936
1079183579_1079183587 4 Left 1079183579 11:18215546-18215568 CCTCTAGACCCACCTGGAACCTG 0: 1
1: 2
2: 2
3: 44
4: 243
Right 1079183587 11:18215573-18215595 TACTCACCACCCTGAAGGGAAGG 0: 1
1: 27
2: 70
3: 166
4: 510
1079183579_1079183586 0 Left 1079183579 11:18215546-18215568 CCTCTAGACCCACCTGGAACCTG 0: 1
1: 2
2: 2
3: 44
4: 243
Right 1079183586 11:18215569-18215591 AGGATACTCACCACCCTGAAGGG 0: 1
1: 2
2: 13
3: 69
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079183579 Original CRISPR CAGGTTCCAGGTGGGTCTAG AGG (reversed) Intronic
900159085 1:1215072-1215094 CAGGTTCCAGGTTTGCCCAGAGG + Intergenic
900555943 1:3280566-3280588 CAGGCTCCAGGTGGGAGTCGAGG - Intronic
903018829 1:20379496-20379518 CAGCTTCCAGGAGTGTCCAGGGG + Intergenic
903288266 1:22290667-22290689 CCAGCGCCAGGTGGGTCTAGGGG - Intergenic
906157484 1:43622232-43622254 CGGGCTCCAGGTGGGTCTGGTGG - Exonic
906526185 1:46494568-46494590 CAGGGTCCCGGTGGGTCTCAGGG - Intergenic
906743327 1:48204157-48204179 GAGGCCCCAGGTGGGGCTAGGGG - Intergenic
906878018 1:49558982-49559004 CAGGCCCCAGGAGGGTCCAGAGG - Intronic
907194639 1:52676579-52676601 CAGGTTCCAGGAGGCCCCAGTGG - Intergenic
908870691 1:68608236-68608258 CAGGGCCCACGAGGGTCTAGAGG - Intergenic
910733199 1:90421304-90421326 CAGGCCCCAGGTGGGTCCAAAGG - Intergenic
911214495 1:95177605-95177627 CAGGTTCCCAGGTGGTCTAGCGG - Intronic
912036524 1:105324076-105324098 CAGACCCCAGGTAGGTCTAGAGG + Intergenic
912242729 1:107927823-107927845 CAGGCCCCAGGTGGGTCCAGAGG - Intronic
913706987 1:121434903-121434925 CAGATCCCAGATGGGTCCAGAGG - Intergenic
914316863 1:146521505-146521527 CAGAGTCCAGATGTGTCTAGGGG + Intergenic
914497492 1:148211855-148211877 CAGAGTCCAGATGTGTCTAGGGG - Intergenic
915498043 1:156295004-156295026 CATGTTCCAGGTGTCTCTGGAGG - Exonic
915587761 1:156853499-156853521 CAGGTTCAAGGTGGGCATGGGGG - Intronic
915908869 1:159899995-159900017 GAGGTCACAGTTGGGTCTAGGGG - Intronic
916490883 1:165301257-165301279 CAGTTGCCAGGTGGGACGAGAGG - Intronic
917003291 1:170385042-170385064 CAGGCCTCAGGTGGGTCCAGAGG + Intergenic
917226343 1:172788078-172788100 CAGGCCCCAGGTAGGTCCAGAGG + Intergenic
919796048 1:201322209-201322231 CAGGCTCCAGGAGGGCCCAGAGG - Intronic
920185191 1:204155094-204155116 CAGGGCCCAGGTGGGTCCAGTGG + Exonic
920744988 1:208617696-208617718 CAGGCCCCAGGTGGGTCCAGAGG - Intergenic
921545765 1:216473183-216473205 CCTGTTCCAGGTGGTCCTAGAGG - Intergenic
922471440 1:225879680-225879702 CAGGGACCTGCTGGGTCTAGGGG + Intronic
923237814 1:232051473-232051495 CACATTCCAGGTGGGTCTTCAGG - Intergenic
924490744 1:244535358-244535380 CAGGCCCCATGTGGGTCCAGAGG + Intronic
1068422083 10:56807732-56807754 CATGCCCCAGGTGGTTCTAGAGG + Intergenic
1068778440 10:60892838-60892860 CAGCTTCCAGGTCGGCATAGCGG + Exonic
1069194736 10:65536879-65536901 CAGTTTCTTGGTGAGTCTAGAGG - Intergenic
1070164959 10:73890365-73890387 CAGGTTTCAGCTGGGCATAGTGG + Intergenic
1071018133 10:81021770-81021792 TAGGCCCCAGGTGGGTCCAGAGG - Intergenic
1071899300 10:90101745-90101767 CTGGTACCAGGTGGGTCCAGAGG - Intergenic
1072066337 10:91875124-91875146 TAGGTTTCAGGGGGGACTAGAGG - Intergenic
1072348986 10:94539565-94539587 GAGGTTCCAGCTGGGTGCAGTGG + Intronic
1073038398 10:100580519-100580541 CAGGTCCATGGTGGGTCTTGCGG - Intergenic
1074638039 10:115344230-115344252 CAGGCCCCTGGTGGGTCCAGAGG + Intronic
1076357982 10:129866785-129866807 CTGGCTCCATGTGGGGCTAGGGG - Intronic
1076401780 10:130189790-130189812 CAGGGTCCAGGTGGTGCTACTGG + Intergenic
1076421526 10:130335525-130335547 CAGGCTCCAGGTGGCTCTGCCGG - Intergenic
1077981624 11:7306905-7306927 CATGTGCCAGGTGGTGCTAGGGG - Intronic
1079183579 11:18215546-18215568 CAGGTTCCAGGTGGGTCTAGAGG - Intronic
1079993869 11:27274756-27274778 CAGCTTCCAGGTGGGACAGGAGG + Intergenic
1079993982 11:27275787-27275809 CAGCTTCCAGGTGGGACAGGAGG - Intergenic
1083653741 11:64219356-64219378 CAGGTACCAGGCGGGCCTGGGGG + Exonic
1086068832 11:82776401-82776423 GAGGCTCCAGGTGGGTCCAGAGG - Intergenic
1088360666 11:108985759-108985781 CTGGGACCAGGTGGGGCTAGAGG + Intergenic
1090239913 11:125174728-125174750 CAGCTTCCAGGAGGGTCAGGGGG + Intronic
1090255734 11:125282685-125282707 AAGCTTCCAAGTGGGTGTAGAGG + Intronic
1091344736 11:134845055-134845077 CAGGTTCCAGGCGTGGCTAGAGG - Intergenic
1091967132 12:4754299-4754321 CAGGTCCCAAGTGGGTCCAGAGG + Intronic
1093123959 12:15306555-15306577 CAGGCCCCAGGTGGGTCCAGAGG + Intronic
1096773808 12:53952173-53952195 TAGGTTCCCGGTGGGTCTCAGGG + Intergenic
1097725073 12:63066109-63066131 CAGGTTCCACCTGGGTCTCTTGG + Intergenic
1099564849 12:84230253-84230275 CAGGACCCAAGTGGGTCCAGAGG + Intergenic
1100308436 12:93372503-93372525 AAGGTCCCAGGTGGGCATAGTGG + Intergenic
1100360727 12:93877430-93877452 CAGACACCAGGTGGGTCCAGAGG + Intronic
1102440908 12:112963330-112963352 CACGTTCCAGGTGGGATCAGCGG - Exonic
1103142470 12:118560984-118561006 CAGCAGCCAGGTGGGACTAGTGG - Intergenic
1103361330 12:120356104-120356126 CAACCTCCAGGTGGGTTTAGGGG + Intronic
1104773604 12:131379889-131379911 CAGCTTCCTGGTGGGTCCACAGG - Intergenic
1105716009 13:23065585-23065607 CACTTTCCAGGGGTGTCTAGGGG + Intergenic
1108141839 13:47431696-47431718 AATGTTGCAGGTGGGCCTAGTGG + Intergenic
1108631618 13:52289213-52289235 CAGGCTCCGGGTGGGTCCAAAGG + Intergenic
1108655077 13:52523382-52523404 CAGGCTCCGGGTGGGTCCAAAGG - Intergenic
1112618805 13:101034282-101034304 CAGGCCCCTGGAGGGTCTAGAGG + Intergenic
1113607527 13:111620968-111620990 GAGGTTGGAGGTGTGTCTAGGGG + Intronic
1113889129 13:113726745-113726767 AAGGCTCTGGGTGGGTCTAGAGG + Intronic
1116481150 14:45392542-45392564 CAGGCCCCAGGGAGGTCTAGAGG - Intergenic
1117725341 14:58667767-58667789 CAGGAGCCAGGTGGGTGTGGTGG + Intergenic
1118103316 14:62629796-62629818 CATGTTGGAGGTGGGCCTAGTGG + Intergenic
1118125212 14:62894588-62894610 CAGCTTCCAGGTTGTTCTAGGGG - Intronic
1119159051 14:72438080-72438102 CAGGTTCCAGGAGGGCCTGGTGG + Intronic
1119282629 14:73422813-73422835 CAGGTTGGAGGTGGGGCCAGGGG - Intronic
1119691146 14:76673737-76673759 CAGGGTACAAGTGGGTCAAGAGG - Intergenic
1121376014 14:93411341-93411363 CAGGTCCTGGGTGGGTCCAGAGG - Intronic
1121431072 14:93888838-93888860 GAGGGTCGGGGTGGGTCTAGGGG + Intergenic
1122587702 14:102820920-102820942 CAGGTACCAGGAGGGTGTGGTGG - Intronic
1123508565 15:20971953-20971975 CAGGCCCCAGGTAGGTCTAGAGG + Intergenic
1123565787 15:21545702-21545724 CAGGCCCCAGGTAGGTCTAGAGG + Intergenic
1123602049 15:21982989-21983011 CAGGCCCCAGGTAGGTCTAGAGG + Intergenic
1124435664 15:29647004-29647026 CCTGTTCCAGGTGGGTGGAGAGG - Intergenic
1125274813 15:37978922-37978944 CAGGACCAAGGTGGGTCGAGGGG + Intergenic
1125794101 15:42391829-42391851 TATGTTCCAGGTGGGTGTGGAGG + Intronic
1127028568 15:54835322-54835344 AAGGTTGGAGGTGGGCCTAGAGG + Intergenic
1127768416 15:62210385-62210407 CATGTTGGAGGTGGGTCTGGTGG + Intergenic
1127945197 15:63744446-63744468 CAAGCCTCAGGTGGGTCTAGAGG + Intronic
1129932220 15:79421450-79421472 CAGGTTTCAGGTAGGTGCAGTGG - Intronic
1202974156 15_KI270727v1_random:272795-272817 CAGGCCCCAGGTAGGTCTAGAGG + Intergenic
1132498551 16:274963-274985 CAGGTTCCAGGTCAGGCTCGGGG - Exonic
1133482819 16:6187634-6187656 CAGGATACAGGTGGTTCCAGTGG + Intronic
1134360789 16:13529422-13529444 CAGGTCATAGGTGGGTTTAGAGG - Intergenic
1135498404 16:22972669-22972691 CAGTTTCCAGCTGGGTATGGTGG + Intergenic
1135735671 16:24930161-24930183 CAGGTTCCCACTGGGTCTACAGG + Intronic
1136077717 16:27828320-27828342 CAGGGTCCAGCTGGGATTAGAGG - Intronic
1136568693 16:31084450-31084472 CAGGTGGGAGGTGGGTCCAGAGG + Intronic
1137272707 16:46912808-46912830 CATGTTGGAGGTGGGTCTAGTGG - Intronic
1138381614 16:56606905-56606927 CAGGTTCCAGGGTGGTCAAGAGG + Intergenic
1138525016 16:57600226-57600248 CAGGTCTCAGGTGGGCCTGGTGG - Intergenic
1138547072 16:57726274-57726296 CAGCTTCGAGGTGGGCCTGGGGG + Exonic
1141079081 16:81035449-81035471 TGGGTACCAGGTGGGTCTGGTGG - Intergenic
1141261565 16:82459043-82459065 CAAGTTTCAAGTGGGTCTTGAGG + Intergenic
1141448355 16:84078982-84079004 CATGTTGGAGGTGGGCCTAGTGG + Intronic
1143389652 17:6552717-6552739 CGGCTTCCAGGTGGGGGTAGTGG - Intronic
1144155422 17:12495806-12495828 CATTTTCCATGTGGGGCTAGTGG + Intergenic
1148893718 17:50827464-50827486 CATGTTCCAGCTGGGTGCAGTGG - Intergenic
1149150802 17:53561792-53561814 AAAGTTATAGGTGGGTCTAGTGG + Intergenic
1150738998 17:67764614-67764636 CAGGGTCCAGGTGGGCCTGATGG + Intergenic
1151794369 17:76333395-76333417 TAAGTTCCAGCTGGGTATAGTGG - Intronic
1153752199 18:8244257-8244279 AAGATTCCAGGTGGTACTAGGGG + Intronic
1156802108 18:41128495-41128517 CAGGATCCAGGTTGGGCTACAGG + Intergenic
1158411661 18:57210984-57211006 CAGGCTCCAGGAGGGTGTGGTGG - Intergenic
1159648137 18:70943679-70943701 CTGGTCCCAGGTGGGTCCAGAGG - Intergenic
1160714573 19:570558-570580 CAAGGTCCAGGTGGTTCTATAGG + Intergenic
1161043048 19:2120349-2120371 CAGGTTCCAGGTGGGCCGCAGGG - Intronic
1161759287 19:6159439-6159461 CAGCAGCCAGGTGGGTGTAGAGG - Intronic
1164457059 19:28417698-28417720 CAGTTTCCAGGCTGGTCCAGAGG + Intergenic
1164491146 19:28715219-28715241 CAGGCTCCAGGTGGATCCAGAGG - Intergenic
1166108215 19:40607964-40607986 CAGGGTCCGGTTGGGTCTACAGG - Intronic
1166697856 19:44864221-44864243 CAGGTTCAAGCTGGGACTACAGG - Intronic
926120784 2:10240261-10240283 CAGGTACTAGGTGGTTCTCGTGG - Intergenic
926143191 2:10380731-10380753 CAGATTCCAGGTGGGGCTGGAGG + Intronic
929168903 2:38911515-38911537 CACGTTCTAGGTCAGTCTAGGGG + Intronic
930492432 2:52092802-52092824 CAGGCCCCAGGTGGATCTAGAGG + Intergenic
931085900 2:58830534-58830556 CAGGCTCCAGGCAGGTCCAGAGG + Intergenic
931634629 2:64330231-64330253 GAGGTTCCAGGAGGTTCTTGAGG - Intergenic
931989874 2:67779326-67779348 TAGGTTCCAGGTGGGTCTAGAGG - Intergenic
933299031 2:80522078-80522100 CAGGATCCAGGTTGGCCTTGTGG - Intronic
933387919 2:81634775-81634797 CAGGTGCTGGGTGGGTCCAGAGG - Intergenic
934870647 2:97861771-97861793 CAGGTCCCAGGTGGGTCTGTAGG - Intronic
937043626 2:118839038-118839060 CAGGTGACAGATGGGTGTAGGGG + Intergenic
937552119 2:123107428-123107450 CAGGGCCCAGGTGGTTCTGGAGG + Intergenic
937557821 2:123180843-123180865 CAGGCTTCAGATGGGTCCAGAGG - Intergenic
938082530 2:128377821-128377843 CAGGTTCCAGGCGGTGCCAGAGG - Intergenic
938806775 2:134813484-134813506 CAGGTTCTATGTGGGTCTCTTGG - Intergenic
939965944 2:148610438-148610460 CAGGTTCAAGGGGGGTGGAGGGG + Intergenic
940429699 2:153575470-153575492 AAGGTCCCATGTGGGTCCAGAGG + Intergenic
940582669 2:155601180-155601202 CAGTTTCCAGATGGGCCTAAGGG + Intergenic
941227740 2:162869089-162869111 CAGGCCCCAGATGGGTCCAGAGG - Intergenic
941795427 2:169593768-169593790 CAGCCTCCAGGTGGGACTACAGG + Intronic
942059131 2:172211768-172211790 CATGTTGGAGGTGGGCCTAGTGG - Intergenic
943208131 2:184927580-184927602 CAGGCCCCAGGTGGGTCCAGAGG + Intronic
943893702 2:193324969-193324991 CTGGGTCCAGGTGTGTATAGAGG - Intergenic
944602179 2:201313903-201313925 CAGGTTCCAGGCTGGTATTGGGG - Intronic
944898603 2:204191388-204191410 CAGGTCCCAAGTGGGGCTTGGGG - Intergenic
947009822 2:225553202-225553224 CAGTTTCCAGGTTCTTCTAGTGG - Intronic
947312275 2:228817783-228817805 CAGGTCCCAGGCAGGTCCAGAGG + Intergenic
948844518 2:240676758-240676780 CAGGTCCCAGGTGGGCCGCGGGG + Intronic
948849342 2:240698121-240698143 CAGGTCCCAGGTGGGCCGCGGGG - Intronic
948981527 2:241497150-241497172 CAGGCTCCAGGTGGGGCTCCTGG + Intronic
1170429518 20:16263596-16263618 CAGCTTCCAGATGGGTCTCCTGG + Intergenic
1170708453 20:18767209-18767231 CAGGTGACAGGAGGGTATAGAGG + Intergenic
1173198936 20:40939481-40939503 CAGGGTCCAGGTCAGTCCAGTGG + Intergenic
1174275039 20:49397614-49397636 CAGGTCCCTGGTAGGTCTTGAGG + Intronic
1174454194 20:50638133-50638155 CTGGCTCCAGGTGGTTCTGGAGG - Intronic
1174472644 20:50771912-50771934 CTGGCTCCAGGTGGTTCTGGAGG + Intergenic
1174557944 20:51409578-51409600 CAGGAGGCAGGTGGGTCTGGTGG - Intronic
1175300016 20:57936095-57936117 CTGGTTCCAGGTGGGGCCATAGG - Intergenic
1175875580 20:62227816-62227838 CAGGGGCCTGGTGGATCTAGTGG + Intergenic
1176195047 20:63832829-63832851 CGGCTTCCAGGAGGGTCTGGCGG + Intergenic
1179404740 21:41116047-41116069 GAGGTTCCAGCTGGGTGCAGTGG + Intergenic
1179634970 21:42703073-42703095 CAGGTTCCAGCAGGTTCTAAAGG + Intronic
1181064324 22:20298612-20298634 CAGGTTCCGAGGGGGCCTAGTGG + Intergenic
1184072570 22:42155026-42155048 GAGGTGCCAGGTGTGTCCAGAGG - Intergenic
1184259406 22:43306011-43306033 CAGGTTCCAGCTGTTTATAGTGG - Intronic
1185119138 22:48955357-48955379 CAGGCTCCAGGTGGGTCTCCTGG + Intergenic
949517095 3:4817772-4817794 TAGGTTCCAGGAGTGTTTAGGGG - Intronic
950018360 3:9769641-9769663 CAGGTGCCAGGCGGGCCTATGGG - Intronic
950378352 3:12590611-12590633 CAGGTTCCAGCTGGGTGGGGTGG - Intronic
951423192 3:22511303-22511325 CAGGCCCCAGGTAGGTCCAGAGG - Intergenic
951819291 3:26790737-26790759 CAGGCCCCAGGTGGATCCAGAGG + Intergenic
953098279 3:39800464-39800486 CAGGTTCAAGGTGGGAGTTGAGG - Intergenic
954453295 3:50583319-50583341 CAGGGTCCAGGTGGGGGTAAAGG - Exonic
954574498 3:51668253-51668275 GAGGGTCCAGGTGGGTTAAGGGG + Exonic
954942488 3:54387362-54387384 GAGGTTCCAGCTGGGTGTGGTGG + Intronic
955565626 3:60241583-60241605 CAGATTGCAGGTGGGGATAGAGG + Intronic
961674441 3:128555942-128555964 CAGTTTCCAGGCGGCTCCAGGGG - Intergenic
962193661 3:133337098-133337120 CAGGCCCCAGGTGGGTCCAGAGG - Intronic
962830561 3:139135641-139135663 CAGGCTCCTGTTGGTTCTAGAGG + Intronic
962862557 3:139418463-139418485 CAGGCCCCAGATGGGTCTAGAGG + Intergenic
963365107 3:144324129-144324151 CAGCTCCCCGGTGGGTCCAGAGG - Intergenic
963976119 3:151481971-151481993 CTGGTTCCATGTGGATATAGTGG - Intergenic
964209233 3:154209851-154209873 CAGGCCCCAGGTGGGTCGAGAGG + Intronic
964313702 3:155421076-155421098 CAGTTCCAGGGTGGGTCTAGGGG - Intronic
964904357 3:161700964-161700986 CAGGCCCCAGGTGGGTCCAGAGG - Intergenic
966348636 3:179005394-179005416 CAGGCCCCAGGTGGGTCCAGAGG - Intergenic
967457737 3:189708673-189708695 TGAGTTCCAGGTGGGTTTAGGGG - Intronic
967537599 3:190624915-190624937 CAGTTGCCAGGCGGGTCAAGTGG + Intronic
967972673 3:195011033-195011055 CAGGTGACATGTGGGTCTTGAGG + Intergenic
971117312 4:23663612-23663634 CAGGTTACAGGTGGATTCAGAGG + Intergenic
971385839 4:26139903-26139925 GAGGCTCCAGGTGGGTCTGTGGG - Intergenic
971693394 4:29866973-29866995 CATGTTGGAGGTGGGCCTAGTGG + Intergenic
972885088 4:43475959-43475981 CAGGCCCCAGGTGGGTCCAGAGG + Intergenic
973340053 4:48994676-48994698 CAGCAGCCAGTTGGGTCTAGAGG - Exonic
975503975 4:75117782-75117804 CAGGCCCCAGATGGGTCAAGAGG - Intergenic
975789488 4:77933230-77933252 CAGGTTCTAGCTGGGTGTGGTGG - Intronic
976254124 4:83083088-83083110 CAGGCCCCAGGTGAGTCCAGAGG + Intergenic
977812533 4:101373887-101373909 CAAGCTCCTGGTGGGTCAAGAGG - Intergenic
978116238 4:105023040-105023062 CAGGCTCCTGGTGGGTCCCGAGG - Intergenic
979219060 4:118200150-118200172 CAAGCTCCAGGAGGGTCCAGAGG + Intronic
979311670 4:119211129-119211151 TAGGTTCCAGATGGGTGAAGAGG + Intronic
979714971 4:123826857-123826879 CAGGTTCCAGGTGTGGCATGTGG - Intergenic
983456349 4:167969172-167969194 CAGGCCCCAGGTGGGTACAGAGG - Intergenic
984807415 4:183764377-183764399 CAGGTTCCAGTTTGTTCTTGTGG - Intergenic
986346400 5:6839339-6839361 CATGTTCCTCGTGGGTCTGGTGG - Intergenic
987039329 5:14046944-14046966 CAGGTTCCAGGGACGTCTTGGGG + Intergenic
987637797 5:20568070-20568092 CAGGTTCAATGAGGTTCTAGAGG - Intronic
989504765 5:42215101-42215123 CAGGACCCAGATGGGTCCAGAGG + Intergenic
989629039 5:43461832-43461854 CAGGCCCTGGGTGGGTCTAGAGG - Intronic
989970680 5:50520995-50521017 CAGATCCCAGATGGGTCCAGAGG + Intergenic
994877927 5:105449261-105449283 CAGGTTACAGATAGGTCTAAGGG + Intergenic
995703336 5:114959499-114959521 GATTTTCCAGGTGGGTATAGTGG - Intergenic
995777908 5:115745519-115745541 CATGCCCCAGGTGGGTCCAGAGG + Intergenic
996549291 5:124712810-124712832 AAGGTTCCAGGTTGGTGTAGGGG - Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
999976389 5:156916023-156916045 CTGCTTCTAGGTAGGTCTAGGGG + Intergenic
1000199816 5:158997229-158997251 CAGTTTCCAGGTGGCCCCAGGGG + Intronic
1002061279 5:176627408-176627430 CAGGCTCAGGGTGGGTCTAAAGG + Intronic
1002466565 5:179411711-179411733 CAGGTCACAGGGGGCTCTAGAGG - Intergenic
1006581691 6:35081149-35081171 CAGGATCCAGGTGGGGCAGGGGG + Exonic
1006747211 6:36351570-36351592 CAGGTTCTAGCTTGGGCTAGAGG - Intergenic
1008433972 6:51453968-51453990 CAAGTGCCAGGTGGCTCTTGAGG + Intergenic
1010483506 6:76382182-76382204 CAGATCCCAGGTGGGTCCAGAGG + Intergenic
1011898496 6:92262142-92262164 CATGTTGTAGGTTGGTCTAGCGG + Intergenic
1013547113 6:111169198-111169220 CAGATTAGAGGTGGGCCTAGCGG + Intronic
1017778380 6:157697247-157697269 AAGGTTTCAGCTGGGTCTTGAGG - Intergenic
1020409627 7:7876455-7876477 TAGGTTCCAGGTGCTTGTAGTGG + Intronic
1020924399 7:14306867-14306889 CAGGTTCCTGGTGGGGCAAGAGG - Intronic
1021382334 7:19983401-19983423 CAGACTCCAGGTGAGTCTAGGGG + Intergenic
1022385375 7:29893831-29893853 CAGGGGCCAGGTGGGTGTAAGGG - Intronic
1027270947 7:76518427-76518449 CAAGTTCCAGGTGGCTCCTGAGG - Intergenic
1027414957 7:77964646-77964668 CAGGTTGCAGGTGTGCCTAATGG - Intergenic
1028264391 7:88705240-88705262 CAGGCTCCAGCTGGGTCCAGAGG + Intergenic
1029205248 7:98865929-98865951 CAGGTTCCTGGGGGGACTTGTGG - Intronic
1029240024 7:99153679-99153701 AAGGTTCCAGATGGGTGCAGTGG + Intergenic
1030724368 7:112908360-112908382 CAGACTCGAAGTGGGTCTAGAGG + Intronic
1031070625 7:117157380-117157402 CAGATTCCAGGAGGGTTCAGTGG + Intronic
1033254114 7:139784796-139784818 CAGTTGCCAGGTGGGTGTACAGG + Intronic
1034144906 7:148861012-148861034 CAGTATCCATGGGGGTCTAGGGG + Intronic
1039073547 8:33667804-33667826 CAAGTACCAGCTGGGTGTAGTGG - Intergenic
1040365245 8:46708821-46708843 AATGTTGAAGGTGGGTCTAGTGG + Intergenic
1041276848 8:56169216-56169238 CAGGTTGCAGGTGTGTCCAAAGG - Intronic
1042898448 8:73695914-73695936 TGGGTTCCAGGTGTGTCCAGAGG - Intronic
1045207165 8:100055049-100055071 CAGGCCCTAGGTGGGTCCAGAGG - Intronic
1045590023 8:103582832-103582854 CAGGCCCCAGGTGGGTCCAGAGG - Intronic
1045768992 8:105711942-105711964 CAAGTTTCAGGTGGGTTAAGAGG - Intronic
1045777382 8:105821760-105821782 CAGGCCCCAGGTGGGTCCAAAGG + Intergenic
1046268123 8:111858417-111858439 CAGGCTCCAGGTGGGTCCAGAGG + Intergenic
1046540604 8:115576729-115576751 GAGGTTCCAGCTGGGTTTGGAGG - Intronic
1048112817 8:131487024-131487046 CAGCTTCCAGGGAGGTGTAGAGG + Intergenic
1049178299 8:141207096-141207118 CTGGAGCCTGGTGGGTCTAGTGG - Intergenic
1049435132 8:142583075-142583097 CAGGCTCCAGGTGGCTGTGGAGG + Intergenic
1051048305 9:12901688-12901710 CAGATTCCAGGTGGGGACAGAGG - Intergenic
1053289641 9:36871463-36871485 CAGGGTCAAGGTGGGCCTGGAGG - Intronic
1054357588 9:64077043-64077065 CAGGTTCAAGCTGGGACTACAGG - Intergenic
1055118572 9:72632332-72632354 CATGTTGGAGGTGGGCCTAGTGG - Intronic
1056623145 9:88232034-88232056 AATGTTGGAGGTGGGTCTAGTGG + Intergenic
1057037135 9:91819067-91819089 CAGAAGCCTGGTGGGTCTAGGGG + Intronic
1060964278 9:127703868-127703890 CACGCTCCAGGTGGGCCTTGTGG + Intronic
1062024180 9:134332817-134332839 CTGGTTTCAGGTGGGCCTTGGGG + Intronic
1062137783 9:134938796-134938818 CAAGTTCCAGGAGCTTCTAGGGG - Intergenic
1185767572 X:2738045-2738067 CATGTTCCCAGTGGGTCTCGGGG + Intronic
1186343056 X:8663581-8663603 CAGGCTCCAGTTGGATCTATTGG - Intronic
1188715691 X:33456884-33456906 CAGGCCCCAGGTGGATCCAGAGG - Intergenic
1188742910 X:33808646-33808668 GAGGTCCCAGGTTGGTCCAGTGG + Intergenic
1188924552 X:36023557-36023579 CAGGCCCCGGGTGGGTCCAGAGG + Intergenic
1188930103 X:36098459-36098481 CAGACCCCAGGTGGGTCCAGAGG + Intronic
1188931990 X:36123387-36123409 CAGGTCCCAAGTGTGTCCAGGGG + Intronic
1189003683 X:36972553-36972575 GAGGTTCCAGGTGTCTCTGGTGG - Intergenic
1189657929 X:43266825-43266847 CATGTCCCAGGTGGGTCCAGAGG + Intergenic
1190919489 X:54838883-54838905 CAGGCCCTAGGTGGGTCTAGAGG + Intergenic
1191800991 X:65079265-65079287 CGGGTCCCAGGTGGGTCCAGAGG - Intergenic
1191829642 X:65402360-65402382 CAGGTCCCAGGTGGGTCCCTAGG - Intronic
1191984027 X:66959422-66959444 CATGCCCCAGGTGGGTCCAGAGG + Intergenic
1192077944 X:68018936-68018958 AAGGCCCCAGGTGGGTCCAGAGG - Intergenic
1192148855 X:68699493-68699515 CAGGGTCCAGGTGGTCCCAGAGG - Intronic
1193670357 X:84376793-84376815 CAGGCCCCAGGTGGGTCCAGAGG - Intronic
1193683660 X:84552290-84552312 CAGGCCCCAGGTGGGTCCAGAGG + Intergenic
1194389243 X:93295360-93295382 CAGGCCCCAGGTGGGTCCAGAGG - Intergenic
1194530795 X:95045743-95045765 CAGACTCCAGGTGGGTCCACAGG - Intergenic
1194591582 X:95805913-95805935 CAGGCCCCAGGTGGGTCCGGAGG - Intergenic
1194787557 X:98105909-98105931 CATGCCCCAGGTGGGTCCAGAGG + Intergenic
1194791866 X:98160353-98160375 CAGGCCCCAGGTGGGTCCAGAGG - Intergenic
1195048882 X:101079220-101079242 GAGGGTCCAGGTGGGGATAGGGG - Intronic
1196233435 X:113252573-113252595 CCAGTTCCAGGTGTGTCCAGAGG + Intergenic
1196910753 X:120482208-120482230 CAGGTTTCTGGAGGCTCTAGGGG - Intergenic
1197581439 X:128288693-128288715 CAGGTTCCAGGTGGGTCCAGTGG - Intergenic
1198785393 X:140282945-140282967 CAGGTCCCAGATGGGTCCAGAGG + Intergenic
1199058841 X:143329269-143329291 CAGGCCCCAGGTGGGTCTAGAGG - Intergenic