ID: 1079184278

View in Genome Browser
Species Human (GRCh38)
Location 11:18221937-18221959
Sequence CAAGTGTCACACTGCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079184275_1079184278 30 Left 1079184275 11:18221884-18221906 CCGTGTATATCAACAGAGTGATA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1079184278 11:18221937-18221959 CAAGTGTCACACTGCTCTCCAGG 0: 1
1: 0
2: 1
3: 15
4: 196
1079184276_1079184278 -1 Left 1079184276 11:18221915-18221937 CCATATGTCTTTCTTTTACTTCC 0: 1
1: 1
2: 1
3: 99
4: 1086
Right 1079184278 11:18221937-18221959 CAAGTGTCACACTGCTCTCCAGG 0: 1
1: 0
2: 1
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079184278 Original CRISPR CAAGTGTCACACTGCTCTCC AGG Intronic
900744930 1:4354557-4354579 CAAGAGTCACACAGCTCTCATGG - Intergenic
901108484 1:6776371-6776393 CAAGTCTCACTCTGATGTCCAGG - Intergenic
901109735 1:6785333-6785355 CAGGGGTCTCACTACTCTCCGGG - Exonic
901220797 1:7582789-7582811 GAAGTGTCACACAGCTGTCCAGG + Intronic
901684270 1:10935021-10935043 CAAGTGTCCCCCTGCAGTCCTGG + Intergenic
903452341 1:23462731-23462753 GGAGTCTCACACTGCCCTCCTGG - Intronic
903545844 1:24123021-24123043 CAAGTCCCACACTACCCTCCTGG + Intronic
904991061 1:34593077-34593099 CAAGTGAGACACTGCCTTCCTGG - Intergenic
907951088 1:59184753-59184775 CAAGTGAGAGACTGCTCTGCAGG + Intergenic
908079980 1:60566547-60566569 CAAGTGTCTCACCTCTCCCCAGG + Intergenic
908827708 1:68149434-68149456 CTGCTCTCACACTGCTCTCCTGG + Intronic
913184265 1:116354048-116354070 CAAGTCTCACTCTGCTACCCAGG - Intergenic
913999223 1:143678660-143678682 CAATTATCACCCTGGTCTCCTGG - Intergenic
914194282 1:145437093-145437115 CAATTATCACCCTGGTCTCCTGG + Intergenic
914475608 1:148019969-148019991 CAATTATCACCCTGGTCTCCTGG + Intergenic
914504394 1:148276090-148276112 CAATTATCACCCTGGTCTCCTGG - Intergenic
914730668 1:150367065-150367087 CAACTGACACACTGCCCTCCTGG - Intronic
915075657 1:153306533-153306555 CAAGTGGGACACTGCTTCCCAGG + Intronic
915321194 1:155057330-155057352 CCACAGTCACACTGCTCGCCCGG - Exonic
916070124 1:161165216-161165238 CACCTGGCACTCTGCTCTCCTGG - Intronic
917766786 1:178228530-178228552 CAAGCGTGCCACTGCACTCCTGG + Intronic
921558991 1:216634354-216634376 CAAGAGTTACAGTGTTCTCCTGG + Intronic
922697019 1:227735814-227735836 CAAGTGCCACCGTCCTCTCCAGG - Intronic
922697071 1:227735965-227735987 CAAGTGCCACCGTCCTCTCCAGG - Intronic
1063331410 10:5163473-5163495 AAAGTGTCACACTGGTCACAGGG - Intergenic
1064091805 10:12391947-12391969 CAAGTCTCGCTCTGCTATCCAGG - Intronic
1070636712 10:78134446-78134468 CAGGTGTCTCCCTGCTTTCCTGG + Intergenic
1072731821 10:97851348-97851370 TTAATGTCACACTGCTCACCAGG - Intronic
1075726251 10:124612377-124612399 CAAGTGTCACTCTGTTGCCCAGG - Intronic
1076242227 10:128917072-128917094 CACCTGTGACCCTGCTCTCCAGG - Intergenic
1079184278 11:18221937-18221959 CAAGTGTCACACTGCTCTCCAGG + Intronic
1083213801 11:61205969-61205991 CAAGTCTCACTCTGTTGTCCAGG - Intronic
1083216686 11:61224798-61224820 CAAGTCTCACTCTGTTGTCCAGG - Intronic
1083219568 11:61243624-61243646 CAAGTCTCACTCTGTTGTCCAGG - Intronic
1083703488 11:64496882-64496904 CAAGTCTCACTCTGTTGTCCAGG + Intergenic
1083889926 11:65590611-65590633 TAAGAGTCCCTCTGCTCTCCTGG - Intronic
1084977176 11:72807979-72808001 AGAGTCTCACTCTGCTCTCCAGG - Intergenic
1087936783 11:104043530-104043552 CAATTGTCAAACTGTACTCCAGG - Intronic
1088423189 11:109670959-109670981 CAAGTCTCACTCTGTTGTCCAGG - Intergenic
1090058775 11:123445791-123445813 CAAGTGTCACTCTGTTCCCCAGG - Intergenic
1091225140 11:133952440-133952462 CAAGGGTCTCTCTGCTCTCAGGG + Intronic
1091815280 12:3433020-3433042 GAAATGCCATACTGCTCTCCAGG + Intronic
1096276096 12:50209518-50209540 AAATTGTGCCACTGCTCTCCAGG + Intronic
1100816893 12:98395421-98395443 CAAGTCTCACTCTGCTGCCCAGG - Intergenic
1104892691 12:132148065-132148087 CAGGTGTCCCACAGCTCTGCAGG - Exonic
1104974346 12:132545767-132545789 CAAGTGTCAGGCTGCTCTCGAGG + Intronic
1106185199 13:27403895-27403917 CTCCTGCCACACTGCTCTCCAGG + Intergenic
1106277164 13:28221764-28221786 CAATTCTGACACTGCTCTCTAGG - Intronic
1107070873 13:36267039-36267061 TTACTGTCAGACTGCTCTCCTGG - Intronic
1108251603 13:48573280-48573302 GAACTGTCACACTGCGCACCTGG - Intergenic
1108679296 13:52765543-52765565 CAAGTGTCACACTGCCCTACTGG + Intergenic
1109938157 13:69321495-69321517 GAAGTGTCACTATGCTCCCCTGG - Intergenic
1110116938 13:71829716-71829738 CATGTACCATACTGCTCTCCGGG - Intronic
1111593968 13:90388030-90388052 CAGGTGTCACACTGTTGCCCAGG - Intergenic
1114281260 14:21194073-21194095 CAAGTCTCACTCTGTTCCCCAGG - Intergenic
1115096118 14:29637672-29637694 CAAGTGTGACAATGTTTTCCTGG + Intronic
1116269133 14:42738339-42738361 CAAGTAGCACAATGCTCTCATGG + Intergenic
1117780739 14:59229265-59229287 CAAATGACACACTGGTCTCAAGG - Intronic
1118914600 14:70092298-70092320 CAAGTGTCCCTCAGCTCTCCTGG + Intronic
1122407250 14:101507954-101507976 CAAGGCTCCCGCTGCTCTCCAGG - Intergenic
1202900753 14_GL000194v1_random:35783-35805 CAAGTGCCACCCTCCTCACCTGG + Intergenic
1124052233 15:26208085-26208107 AAAGATTCACAGTGCTCTCCGGG - Intergenic
1125973709 15:43933102-43933124 CAGCTGTCTCACTCCTCTCCTGG - Intronic
1128144622 15:65325982-65326004 CAATTTACCCACTGCTCTCCTGG + Intergenic
1130413781 15:83670805-83670827 CTATTGTAACTCTGCTCTCCTGG + Intronic
1130903582 15:88224907-88224929 CTAGTGACACCCTGCTCCCCAGG - Intronic
1131285692 15:91055257-91055279 TAAATGTCACACTGATTTCCTGG - Intergenic
1131289933 15:91098904-91098926 GAAGTCTCACTCTGTTCTCCAGG - Intergenic
1131396963 15:92093876-92093898 CATCTCTCACCCTGCTCTCCAGG + Intronic
1132748317 16:1446059-1446081 CCAGTGTGAAGCTGCTCTCCGGG + Exonic
1133895500 16:9924083-9924105 CAAGTCTCACTCTGCTGCCCAGG - Intronic
1134046795 16:11107077-11107099 CAGGTGCCACACTGATGTCCGGG - Intronic
1136445795 16:30317380-30317402 CGAGTCTCACTCTGTTCTCCAGG - Intergenic
1138429052 16:56956469-56956491 AGAGTCTCACACTGCTGTCCAGG + Intergenic
1143239702 17:5433613-5433635 CAAGGGACACACTGTTCCCCAGG + Intronic
1143971301 17:10797959-10797981 CTAGTGTCAGACTCCTCACCTGG + Intergenic
1144360050 17:14483715-14483737 CAAGGGTTACTCTGCTCTACAGG + Intergenic
1146307503 17:31741931-31741953 CAAAGGTCACACAGCTCTACAGG + Intergenic
1146606799 17:34266772-34266794 AAGGTCTCACAGTGCTCTCCAGG + Intergenic
1148373534 17:47120979-47121001 CATCTGTCATGCTGCTCTCCTGG + Exonic
1148518475 17:48245077-48245099 CAAGTGTAAAACTGTTCCCCAGG - Intronic
1149141757 17:53439793-53439815 AAAGTCTCACTCTGCTGTCCAGG + Intergenic
1151509758 17:74550996-74551018 CAAGAGTCAACCTGCTCTCTAGG + Intergenic
1152305006 17:79515241-79515263 CAAGCCTCCCACTGCTCCCCAGG + Intronic
1153837327 18:8975832-8975854 CAAGTCTCACACTAATCACCTGG + Intergenic
1156227424 18:35123076-35123098 TGCGTGTCTCACTGCTCTCCTGG + Intronic
1156298207 18:35811713-35811735 CAAGTGTCAGACTGGTTCCCAGG + Intergenic
1157827659 18:50826753-50826775 AGAGTGTCACTCTGTTCTCCAGG - Intergenic
1158546135 18:58398931-58398953 CAGCAGTCACACTGCTCTGCAGG + Intronic
1159005093 18:63004257-63004279 AAAGTGCCACACTGATCCCCAGG + Intergenic
1159991497 18:74914139-74914161 CAAGCTTCACACTCCTCACCAGG - Intronic
1161393678 19:4033848-4033870 CAAGTGTGACCCTGAGCTCCAGG + Intronic
1161727772 19:5940135-5940157 CAAGAGACACTCAGCTCTCCAGG - Intronic
1162441782 19:10696895-10696917 CAGGTGGCACAGTGATCTCCAGG + Intergenic
1162791641 19:13066097-13066119 GAAGTGTGAGACTGCTCTGCTGG + Intronic
1165358676 19:35319996-35320018 CAAGTCTCACTCTGTTGTCCAGG - Intronic
1166058145 19:40306426-40306448 CAAGTCTCACTCTGCTGCCCAGG + Intergenic
1167615981 19:50534087-50534109 CAAGTGTCATACTGGGCTCTGGG + Intronic
1168118490 19:54239515-54239537 CTAGTGTCCCAGAGCTCTCCTGG + Intronic
927075183 2:19570620-19570642 ATTGTGCCACACTGCTCTCCTGG + Intergenic
927927379 2:27023502-27023524 CCAGGGTCACACTGCTCCTCAGG - Intronic
928700004 2:33888910-33888932 CAAGTCTCACTCTGTTGTCCAGG - Intergenic
931518983 2:63074509-63074531 AAAGTCTCACTCTGCTATCCAGG + Intergenic
934708057 2:96498419-96498441 CAGATGGCACACTCCTCTCCTGG + Exonic
940471385 2:154104698-154104720 CAGGTATCCCACAGCTCTCCGGG + Intronic
940914181 2:159236681-159236703 CAAGTCTCACACTGTTGCCCAGG + Intronic
941360081 2:164540581-164540603 CGAGTCTCACTCTGCTCCCCAGG - Intronic
941564408 2:167088418-167088440 GAAGTGTCACACAGCTGTCCAGG - Intronic
941754334 2:169168438-169168460 CAATTGTACAACTGCTCTCCAGG + Intronic
942525087 2:176844414-176844436 AATGTGTTACACTCCTCTCCAGG + Intergenic
942650550 2:178162643-178162665 CGACTGCAACACTGCTCTCCAGG + Intergenic
942689582 2:178571366-178571388 CAGTTGTCACACTGTCCTCCAGG - Exonic
943666903 2:190618603-190618625 CAAGTCTCACTCTGTTCTTCAGG + Intergenic
945281212 2:208037036-208037058 CAAGTCTCACTCTGTTGTCCAGG + Intergenic
947235394 2:227936144-227936166 AAAGTCTCACGCTGTTCTCCAGG - Intergenic
948758349 2:240172620-240172642 GAATTTTCACACTTCTCTCCTGG + Intergenic
948930078 2:241126454-241126476 CATGTCCCACACAGCTCTCCCGG + Exonic
949008606 2:241665735-241665757 CAGGAGTCACACAGCTCACCAGG - Intronic
1170799976 20:19582943-19582965 CAAATGTCCCACTGCTGTCCTGG - Intronic
1171003819 20:21443106-21443128 CAAATGTCAAACTGCTTTCCAGG + Intergenic
1171234178 20:23510865-23510887 CAAATGTGACAGAGCTCTCCAGG + Intergenic
1172284484 20:33731533-33731555 CAACTGTCACAGGGATCTCCAGG - Intergenic
1173726920 20:45304771-45304793 CAGGTGTCACACTGGGCCCCTGG - Exonic
1174735314 20:52960444-52960466 CAAGGGTGACTTTGCTCTCCCGG - Intergenic
1175169573 20:57070545-57070567 CAAGGGTCACTCTTCTCCCCAGG + Intergenic
1175930442 20:62491427-62491449 TCAGAGTCACACAGCTCTCCAGG - Intergenic
1176620127 21:9050561-9050583 CAAGTGCCACCCTCCTCACCTGG + Intergenic
1179978424 21:44883994-44884016 CAAGAGTCACACAGCACACCTGG - Intergenic
1180051413 21:45333186-45333208 CAAGTCTGTCAATGCTCTCCAGG - Intergenic
1183076092 22:35428044-35428066 CAAGTCTCACTCTGTTGTCCAGG + Intergenic
1185360888 22:50405976-50405998 CAGGTCTCTCACTTCTCTCCAGG - Intronic
950832374 3:15887553-15887575 CAAGTGACAGACAGCTCTCATGG - Intergenic
951093979 3:18607212-18607234 CTTGTGACACACTGATCTCCAGG + Intergenic
951313503 3:21159684-21159706 TAAGTGTCACACAACTCTCCAGG + Intergenic
952018320 3:28986210-28986232 CAAATGTCATACTGCCCTCTGGG + Intergenic
952258710 3:31718151-31718173 AAAGTCTCACTCTGCTGTCCAGG + Intronic
952576014 3:34775223-34775245 CAAGTGTCAAATTCATCTCCTGG - Intergenic
953062013 3:39435168-39435190 CAACTGTCACACTCATCTCCAGG + Intergenic
953909687 3:46885545-46885567 CCAGAGCCCCACTGCTCTCCAGG + Intronic
953995335 3:47514771-47514793 GAAGTCTCACACTGCTGCCCAGG - Intergenic
954257877 3:49418918-49418940 CAAGGGTCACCCTGACCTCCAGG + Intronic
959082520 3:101817138-101817160 AAACTGTCACACATCTCTCCAGG - Intronic
959499432 3:107088492-107088514 AAAGTCTCACTCTGCTCCCCAGG - Intergenic
961119882 3:124364845-124364867 GAAGTGTCTAACAGCTCTCCAGG - Intronic
961183320 3:124893380-124893402 AAAGTGTCACTCTGTTGTCCAGG - Intronic
962347145 3:134626452-134626474 TTAGCGTCACACTGCTCTCTGGG + Intronic
962355980 3:134694573-134694595 CAAGTGTGTCACTGTCCTCCAGG + Intronic
968645160 4:1736995-1737017 GAAGCGTCACCGTGCTCTCCCGG + Intronic
969458254 4:7313412-7313434 CAAATGTCAGGCTGCTCTCTGGG + Intronic
975715949 4:77206022-77206044 GAAGTCTCTCACTGCTTTCCCGG + Intronic
977563534 4:98558363-98558385 CAAGTCTCACACTGTCCCCCTGG + Intronic
978205420 4:106074839-106074861 GAAGGGTAACACTTCTCTCCAGG - Intronic
980030888 4:127828815-127828837 CTAGTGTCACAGTGCTCCCCAGG + Intronic
983754678 4:171320172-171320194 TCTGTGTCACACTGGTCTCCAGG - Intergenic
983873917 4:172853982-172854004 CAATTGCCAAACTGCTCTCCAGG + Intronic
984405893 4:179329249-179329271 TAAGTGTCACTGTGCTCCCCTGG + Intergenic
985026866 4:185747055-185747077 CAAGTCTCACACTGTTGCCCAGG - Intronic
985074998 4:186205530-186205552 CAAGGGTCTCACTGCTACCCAGG + Intronic
987893117 5:23909302-23909324 TAAGTGTCACACAGCTAGCCAGG - Intergenic
990535083 5:56713485-56713507 CAATTGTTAAATTGCTCTCCTGG - Intergenic
991332490 5:65506757-65506779 CAAGTGTCGCTCTGCTGCCCAGG - Intergenic
991379083 5:65999776-65999798 CAAATTTCACACTGCCCTCAAGG - Intronic
993649340 5:90499326-90499348 CTTGTGTAACTCTGCTCTCCTGG - Intronic
994342086 5:98642317-98642339 CAAGTCTCACTCTGCTGCCCAGG + Intergenic
994514341 5:100752016-100752038 GAAGTCTCACACTGCTGCCCAGG + Intergenic
997778539 5:136633796-136633818 CCTGTCTCACTCTGCTCTCCAGG + Intergenic
997823831 5:137089024-137089046 CAATAGTCCCAGTGCTCTCCTGG - Intronic
1001546938 5:172576059-172576081 CAAGTGTCCCAATGCGTTCCTGG - Intergenic
1002207230 5:177571397-177571419 CAAGTCTCACTCTGTTGTCCAGG - Intergenic
1004943121 6:20582438-20582460 CAAATGTAACTCTTCTCTCCTGG + Intronic
1005903539 6:30240530-30240552 AAAGTCTCACACTGCTGCCCAGG - Intergenic
1007558971 6:42790203-42790225 CAATTGTACCACTGCACTCCAGG - Intronic
1010721898 6:79292192-79292214 CTTTTGTCACACTGCTCTGCAGG - Intergenic
1012793432 6:103730542-103730564 TAAATGTCACAGTTCTCTCCTGG - Intergenic
1013356270 6:109348444-109348466 CCAGCTTCACACTGCGCTCCTGG - Intergenic
1017507372 6:155080884-155080906 CAACTGTCACGCTGCCCTCTGGG - Intronic
1019259227 7:71361-71383 GAAGTTTCAAAATGCTCTCCAGG - Intergenic
1021405208 7:20259335-20259357 AAACTGTCAAACTGTTCTCCAGG + Intergenic
1023128228 7:36975819-36975841 CAAGTGTCACTCTGTTGCCCAGG - Intronic
1024054805 7:45653194-45653216 CCAGGGTCACACAGCTCTTCAGG - Intronic
1024063225 7:45714087-45714109 CAAGTGGCTCCCTGCTCTGCTGG - Exonic
1024616956 7:51123893-51123915 CAAGTGTTACACAACTCTCTTGG + Intronic
1025926373 7:65963569-65963591 CAAGTCTCACTCTGTTGTCCAGG + Intronic
1026283068 7:68938796-68938818 AAAGTGTCTATCTGCTCTCCAGG - Intergenic
1027137424 7:75634890-75634912 CAATTGTGCCACTGCACTCCAGG + Intronic
1030259695 7:107550085-107550107 CAAAAATCACACTTCTCTCCAGG + Intronic
1030866539 7:114707093-114707115 AAAGTGCCAGAATGCTCTCCAGG + Intergenic
1032859546 7:135864178-135864200 CCAGTGTCACACTGCACTCAGGG - Intergenic
1035179702 7:157080329-157080351 CTCGTGTCACACTGCTCCACGGG + Intergenic
1036475439 8:9088930-9088952 CTAACGTCACGCTGCTCTCCAGG - Intronic
1039486819 8:37916613-37916635 CAAGTCTCACTCTGCTGCCCAGG + Intergenic
1042996895 8:74710478-74710500 CAAGTGTCACCCTTCTCTTACGG - Intronic
1045640821 8:104248479-104248501 CACCTGTCACACTGCACTGCAGG - Intronic
1046089545 8:109484312-109484334 CAAGTGTCACACAGTTTTCTAGG + Intronic
1048358608 8:133674944-133674966 CAAGTGACAGGCTTCTCTCCTGG + Intergenic
1051797314 9:20887258-20887280 GAAGTCTCACTCTGCTGTCCAGG + Intronic
1051877553 9:21807619-21807641 TAAATGTCAAACAGCTCTCCTGG - Intronic
1053857474 9:42353162-42353184 CAAGTGCGCCACTGCACTCCTGG + Intergenic
1057143539 9:92743111-92743133 CAATTTTCCCACTCCTCTCCAGG + Intronic
1058153321 9:101486109-101486131 CTAGTGTCGCACTGCGCTCGCGG - Intronic
1061775733 9:132962413-132962435 CAAGTGTGAGCCTCCTCTCCTGG + Intronic
1062086573 9:134652330-134652352 CCAGTGTAACACGGCTCTGCTGG + Intronic
1203566773 Un_KI270744v1:98496-98518 CAAGTGCCACCCTCCTCACCTGG - Intergenic
1187969360 X:24644608-24644630 CAAGGGTCACACTGCTTTGAAGG - Intronic
1188913917 X:35887071-35887093 CAAGAATCAGATTGCTCTCCGGG - Intergenic
1192183236 X:68929394-68929416 CAGCTGTCACACAGCTCTGCAGG + Intergenic
1193617055 X:83702152-83702174 GAAGTGTCACACTGTTGCCCAGG + Intergenic
1195687626 X:107600877-107600899 CAGGGGTCACACTGCTCTTTGGG - Exonic
1197838712 X:130722622-130722644 CAAAGGTCAGGCTGCTCTCCTGG - Intronic
1199753788 X:150845843-150845865 CAAGTGGCACATTGCTCTCAGGG + Intronic
1200113275 X:153755082-153755104 GAAGTGTCACTCTGTTGTCCAGG - Intergenic
1200208808 X:154336429-154336451 CAAGAGGCACTCTGCTCTCGGGG - Intergenic
1200222070 X:154395705-154395727 CAAGAGGCACTCTGCTCTCGGGG + Intronic