ID: 1079185048

View in Genome Browser
Species Human (GRCh38)
Location 11:18229147-18229169
Sequence TGCAAGAGTGAAGAGTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079185048 Original CRISPR TGCAAGAGTGAAGAGTAATG TGG Intronic
901327724 1:8378933-8378955 TGCCAAAGGGTAGAGTAATGTGG + Intronic
901496614 1:9626040-9626062 TGCTAGGGAGAAGAGTAAAGTGG - Intergenic
902907343 1:19568170-19568192 TGCAATTGTGAGGAGTAATGAGG - Intergenic
903990996 1:27269450-27269472 TGGAAGAGGGATGAGAAATGAGG + Intronic
904763543 1:32822897-32822919 TGCAAGAGTAAAGACCAAAGAGG - Intronic
906983360 1:50655922-50655944 TGGAATAGTGAAGGGTAGTGGGG + Intronic
907235288 1:53040741-53040763 GGCAATAGGGAATAGTAATGGGG - Intronic
908453628 1:64280772-64280794 GGCAAGAGATAAGAGAAATGAGG + Intergenic
909876379 1:80809628-80809650 AGCAAGAGTGGAGAGCAAGGAGG - Intergenic
910330603 1:86068732-86068754 GAGAAGAGTGAAGAGTAAAGAGG + Intronic
910435922 1:87205772-87205794 TGCAAGAGTTTATAGAAATGTGG + Intergenic
910901530 1:92126498-92126520 TGCATGAGTGAAGAGGATTGAGG - Intronic
911401799 1:97384630-97384652 AGTAAGAGTGAAGAGTGATTAGG + Intronic
913222207 1:116668134-116668156 TCCAAGAGTGAAGTGCAATATGG - Intergenic
913683477 1:121209118-121209140 TGGAAAAGAGAAGAGGAATGAGG - Intronic
914035317 1:143996742-143996764 TGGAAAAGAGAAGAGGAATGAGG - Intergenic
914154135 1:145071228-145071250 TGGAAAAGAGAAGAGGAATGAGG + Intronic
915673224 1:157508097-157508119 TGCAAGCGAGAGGAGTAATGGGG + Intergenic
916448032 1:164891865-164891887 TGCAAGAGTGAAGTTTAATAGGG - Intronic
916619033 1:166475515-166475537 TCCATGAGTGTAGAGAAATGAGG - Intergenic
917851038 1:179064180-179064202 TCCAAGAGTGAAAAGAACTGTGG + Intronic
918074831 1:181162021-181162043 TGACAGAATTAAGAGTAATGAGG - Intergenic
918139038 1:181704661-181704683 TGCAAGTGTGTACAGTAGTGTGG + Intronic
919494085 1:198242327-198242349 AGCAAGAGTAAGGAGTAAGGGGG - Intronic
919728569 1:200899096-200899118 TGCAAGAGAGAGGGGTAGTGGGG + Intronic
920470785 1:206227627-206227649 TGGAAAAGAGAAGAGGAATGAGG - Intronic
920969331 1:210729496-210729518 TTCTTGAGTGAAGAGAAATGTGG - Intronic
923933146 1:238726569-238726591 AGCATGAGTGAAGAATAATGAGG - Intergenic
1063881912 10:10540323-10540345 TGCATGAGATAAGGGTAATGAGG - Intergenic
1065357944 10:24860667-24860689 TGAAAGAGTGGAGGGTAACGTGG - Intronic
1067282108 10:44880606-44880628 GGCAAGAGTGAAGAGAAGGGAGG + Intergenic
1071412836 10:85413652-85413674 TGCAGGAGTGGAGAGTGAGGAGG - Intergenic
1071619043 10:87102072-87102094 TGCAACATTGAAAACTAATGAGG - Intronic
1072253939 10:93602530-93602552 TGCAAGAGTGAAGGGGAAGGTGG - Intronic
1073578677 10:104644552-104644574 AGCCAGGGTGAAGAGTGATGGGG + Intronic
1075120541 10:119661351-119661373 TGCAAGAGTTAAGTGAAATAAGG - Intronic
1076234046 10:128850055-128850077 GGCAGGAGTGCAGAGCAATGGGG + Intergenic
1078934247 11:15938183-15938205 AGCAAGAGCGCAGAGTTATGGGG - Intergenic
1079185048 11:18229147-18229169 TGCAAGAGTGAAGAGTAATGTGG + Intronic
1080717945 11:34822351-34822373 TGCAAGAGTGTAGAGAAATTTGG + Intergenic
1085414914 11:76313459-76313481 AGCAAGAGTGAAGAGGAAGTGGG + Intergenic
1085560759 11:77471589-77471611 TGCAAGAGTGAAGATGAGAGTGG + Intronic
1088108444 11:106231382-106231404 TCCAAGAATGAAGACTAGTGTGG + Intergenic
1088615652 11:111625034-111625056 AGCAAGAGAGAAGAGCAAGGAGG + Intronic
1089830715 11:121325520-121325542 TGCAAGCCAGAAGAGTGATGAGG + Intergenic
1090159437 11:124477149-124477171 TACAATGGTGAATAGTAATGAGG - Intergenic
1093017252 12:14167000-14167022 TGCTAGAGCCAAGAGTTATGTGG - Intergenic
1093527769 12:20122665-20122687 TGGAAGAGTGAAGAATGAGGAGG - Intergenic
1094291721 12:28858105-28858127 GCTAAGAGAGAAGAGTAATGAGG - Intergenic
1094563670 12:31579810-31579832 GAGAAGAGAGAAGAGTAATGGGG + Intronic
1094678319 12:32644630-32644652 AGCAAGAATGAAGAGAGATGTGG + Exonic
1098123889 12:67269945-67269967 TGCAAGAGGGGAGAGGAAAGGGG - Intronic
1098801097 12:74959189-74959211 TGCAGCAGTCAAGAGTAATAGGG + Intergenic
1098924212 12:76331258-76331280 TGAATGAATGAAGAGAAATGTGG + Intergenic
1101455435 12:104826073-104826095 TGAAAGAGGGAAGGGAAATGAGG + Intronic
1101897471 12:108767460-108767482 TGAAAGAGTGAGAAGAAATGGGG - Intergenic
1103600158 12:122049772-122049794 GGCAAAAGTGAAGAGAGATGAGG - Intronic
1103768721 12:123302620-123302642 AGCATCAGTGAAGAGTAAGGAGG + Intronic
1104422669 12:128650165-128650187 TGCAGTAGGGAAGAGGAATGAGG + Intronic
1105790097 13:23790217-23790239 TGCAGTAGTGAAGGGTAAAGAGG - Intronic
1106449453 13:29866826-29866848 TGCAAGAGTTGAGAGCTATGAGG - Intergenic
1107248573 13:38327781-38327803 TGCAAAACTGAAGAGTACTTTGG - Intergenic
1108023238 13:46150882-46150904 TGCAGGAGTGAAGGGGAATTTGG - Intronic
1108189566 13:47923786-47923808 TGCAGGAGTCAGGAGTAAGGTGG - Intergenic
1110856594 13:80303583-80303605 TGCAAGAGTGAAAGGAGATGAGG - Intergenic
1111056972 13:82963759-82963781 TGAAAGAATGATGAGTAATATGG - Intergenic
1112139289 13:96620602-96620624 TCAAAAAGTGAAGCGTAATGAGG - Intronic
1112199253 13:97259384-97259406 TGCAGGGGTGAAGAGGACTGGGG - Intronic
1113299575 13:109003160-109003182 TCCAACAGTGGAGAGTGATGTGG - Intronic
1113475607 13:110578618-110578640 TGAAAGAAGGAAGAGCAATGTGG + Intergenic
1114661037 14:24344990-24345012 TTTGAGAGAGAAGAGTAATGGGG + Intergenic
1114931374 14:27472147-27472169 TGAAAGAGTGAAAAGGAAAGTGG + Intergenic
1115661009 14:35494380-35494402 TAAGAGAGGGAAGAGTAATGGGG + Intergenic
1115783352 14:36795879-36795901 TGCAAGAGGCAAGAGGATTGCGG + Intronic
1116804646 14:49481113-49481135 TTCAAGAGTGAGCAGAAATGTGG - Intergenic
1118154756 14:63228504-63228526 TGCAATTGTTAAGAATAATGAGG + Intronic
1118504069 14:66391606-66391628 GGCAAAAGTGAAGAGTAGGGAGG + Intergenic
1119747907 14:77057470-77057492 TGCAAGAGTTAAAAAGAATGAGG - Intergenic
1119943996 14:78672650-78672672 TGCTAGAGGGAAGAGTCCTGTGG - Intronic
1120731170 14:88002901-88002923 GGCTAGAGTGAAAAGAAATGTGG + Intergenic
1121950223 14:98165091-98165113 TGCAATCGTGAAGAAAAATGAGG + Intergenic
1121963834 14:98286189-98286211 TGCAAGAGAGAACAGAAAAGGGG + Intergenic
1123832235 15:24152212-24152234 TGCATGTGTAAAGAGGAATGGGG - Intergenic
1125644177 15:41257285-41257307 TGCAAAAGTTAAAAGTAATTCGG + Intronic
1127686295 15:61348816-61348838 TGCAAGATTGAACACTAATAAGG + Intergenic
1128514962 15:68336244-68336266 TCCAAGAGTGAAGATTGGTGGGG - Intronic
1128844590 15:70879686-70879708 TGCCAGAGTGAAAAGTGATGGGG - Intronic
1132211803 15:100029450-100029472 TGCCAGAGAGAGGAGAAATGGGG + Intronic
1134264452 16:12681336-12681358 GGCAAGAGTGAGGAGGAAAGGGG - Intronic
1137528260 16:49256579-49256601 TCCAAGAGTGAAGAGAAAAATGG + Intergenic
1138311231 16:56025474-56025496 TGCATGAATGGAGAGGAATGAGG - Intergenic
1140876663 16:79158977-79158999 AGGCAGAGTGAAGAGCAATGTGG - Intronic
1141797029 16:86281956-86281978 AAGAAGAGTGAAGAGTATTGTGG - Intergenic
1151088016 17:71403458-71403480 TGAAAGAGTAAAGGGAAATGTGG + Intergenic
1151246083 17:72795948-72795970 TGAAAGAGGGAAGAATACTGGGG + Intronic
1153158267 18:2173956-2173978 TGCAAGAGAGAAAATTAAAGAGG + Intergenic
1156035633 18:32764429-32764451 TGGAAGGATGAAGACTAATGGGG + Intronic
1157141174 18:45108311-45108333 TGCTAGAGTGAAAAATAAAGTGG - Intergenic
1157893135 18:51437901-51437923 TGCTACAGGGAAGAGTGATGAGG - Intergenic
1158428276 18:57359427-57359449 TGCAAGAGAGAAGAAAAATAAGG + Intronic
1159810804 18:73016164-73016186 TGCAAGAGGGAGGAGACATGAGG - Intergenic
1161489056 19:4551888-4551910 TGGAAGAGTGAAGAGCAAGAGGG - Intronic
1166911344 19:46160484-46160506 GGCAAGAGTGAAGAGGAAGGAGG + Intronic
1167688503 19:50970832-50970854 TGGCAGAGTGGAGAGAAATGAGG + Intergenic
927265089 2:21137626-21137648 TCCAAAAGTGAAAAATAATGTGG + Exonic
928819608 2:35343801-35343823 TGAAAGAAGGAAGAGAAATGAGG + Intergenic
932737724 2:74266115-74266137 TTCAAAAATGAAGAGAAATGGGG + Intronic
933225308 2:79741702-79741724 TACAAGAGTGAAGAGCAAGGTGG - Intronic
935160280 2:100523869-100523891 TGCAGGAGTGAAGAGTCGAGTGG - Intergenic
935799682 2:106681653-106681675 TGCCAGAGTTAGGAATAATGGGG - Intergenic
936898318 2:117454762-117454784 TGCAAGAGTGAAGAATGCTTGGG + Intergenic
937078885 2:119126354-119126376 TGCAACAGGGGAGAGAAATGGGG - Intergenic
939619937 2:144406629-144406651 TGTAAGGGTGGAGAGTAAGGCGG + Intronic
940148420 2:150572807-150572829 TGCAAGGATGAAGATTAATTGGG + Intergenic
940339080 2:152560892-152560914 TGAAAGTGTGGAGAGTACTGTGG + Exonic
941864846 2:170324133-170324155 TGAAAAAGTGAAGAGTCAGGTGG - Intronic
942739936 2:179164705-179164727 TGGAGGAGTGAATAGTAAGGAGG + Intronic
943012388 2:182466174-182466196 TACAAGAGTAAAGAGGACTGAGG - Intronic
943192693 2:184699987-184700009 TGCAAGAGAGAAGAGATATGTGG + Intronic
945476497 2:210287880-210287902 TGCAAAAGGGAAGGGTGATGAGG - Intergenic
945617608 2:212092513-212092535 TCGAAGAGTGAAGACTCATGAGG + Intronic
946941520 2:224774647-224774669 TGTAAGTGTGAAGGGTGATGGGG - Intronic
947709486 2:232303763-232303785 TGCAACAGAGAAGAAGAATGTGG + Intronic
1168945076 20:1747523-1747545 CTCAAGAGGGAAGAATAATGAGG - Intergenic
1169675289 20:8146171-8146193 TGCAATATTGAAGTGTCATGGGG + Intronic
1170004731 20:11653608-11653630 TGCCATAGTCAACAGTAATGTGG - Intergenic
1174729066 20:52896691-52896713 TGCAAGAGTGAAACGGGATGTGG + Intergenic
1179146922 21:38776129-38776151 TTCAAGAATAAAGAGTGATGGGG - Intergenic
1179475256 21:41639150-41639172 TGTAAGTCTGAGGAGTAATGGGG - Intergenic
1180985180 22:19899935-19899957 TCAAAGACTGAAGGGTAATGTGG - Intronic
1182870211 22:33639767-33639789 TGCATGAGTGAAGATCAAAGGGG + Intronic
1183903750 22:41024411-41024433 TCCAGGAGTGAAGAGGAGTGAGG + Intergenic
951531230 3:23699953-23699975 TGCAATGGGGAAGAGCAATGGGG + Intergenic
953532201 3:43748752-43748774 TGCAGGAGAGAAGAGGGATGGGG + Intergenic
953555996 3:43947517-43947539 TTCCACAGTGAAGAGTAATGTGG - Intergenic
954208656 3:49080611-49080633 TACAAGAGTGAGGAGAAATAGGG - Intronic
955016560 3:55076425-55076447 TGGAAGAGAGGAGACTAATGAGG - Intergenic
955744974 3:62131432-62131454 TGTAAGAGTAAAAAGGAATGTGG + Intronic
956077447 3:65520470-65520492 TGCAAATGGGAAGAGTAATGGGG + Intronic
958047243 3:88300783-88300805 TGCAAGAATGATAAATAATGAGG - Intergenic
960987053 3:123287534-123287556 GGCAAGAGTGAGGCCTAATGAGG - Intronic
961025296 3:123550418-123550440 GGCAAGAGGGAAGAGAAAAGGGG + Intronic
961093995 3:124139193-124139215 TGCAAAAGACCAGAGTAATGAGG + Intronic
961374469 3:126454617-126454639 TGTCACAGTGAAGTGTAATGAGG - Intronic
962767530 3:138579474-138579496 GACAAGAGGGAAGAGTAAAGAGG + Intronic
963024639 3:140907123-140907145 TGCCAGGCTGAAGAGGAATGTGG - Intergenic
967892114 3:194370906-194370928 TGCCACAGTGAGGAGGAATGTGG - Intergenic
969566606 4:7982340-7982362 TGCTAGAGTGAAGGGTCTTGAGG - Intronic
969668804 4:8578090-8578112 TGCATGGGTGATGAGTAAAGGGG + Intronic
970125237 4:12802287-12802309 TGAATGAATGATGAGTAATGGGG - Intergenic
970658096 4:18254134-18254156 TGGAGGAGTGATGAGAAATGAGG + Intergenic
970918278 4:21362056-21362078 TGCAAGAATGAAGAGGAGAGGGG + Intronic
971881141 4:32374491-32374513 TGGAAGAGTGGCAAGTAATGAGG + Intergenic
974920678 4:68235439-68235461 TGTATGGGGGAAGAGTAATGAGG - Intronic
976028677 4:80723823-80723845 TGTAAAAGTAAAGATTAATGAGG + Intronic
976335775 4:83884411-83884433 TGCAAAGATAAAGAGTAATGGGG + Intergenic
978361536 4:107935601-107935623 TTCAAGAGTGAAGAATAAAAAGG + Intronic
978744539 4:112177034-112177056 GGCAAGAATGAAGAGATATGTGG - Intronic
979111339 4:116761601-116761623 GACAAGAGAGAAGAGTAAAGAGG + Intergenic
980094441 4:128474829-128474851 TGGAAGAATGAAGAGAAAAGTGG + Intergenic
980160868 4:129160864-129160886 GACTAGAGTGAGGAGTAATGGGG - Intergenic
980752962 4:137116176-137116198 GAGAAGAGTGAAGAGTAAAGAGG + Intergenic
980867102 4:138564635-138564657 AGCAAGGGAGAAGAGTGATGAGG + Intergenic
980877605 4:138677642-138677664 AGAAAGAGAGAAGAGGAATGAGG - Intergenic
981260315 4:142711063-142711085 GGCAAGAGACAATAGTAATGGGG - Intronic
982043778 4:151421405-151421427 TGCAGGAGAGCAGAGTAAGGGGG - Intronic
983004755 4:162470209-162470231 GGCAAGAGTGAAGTATTATGGGG + Intergenic
983591079 4:169412084-169412106 TGCTAGAGTTAACAGTAGTGAGG - Intronic
986333826 5:6738069-6738091 TGCAAGAGTGGTGTGTGATGAGG - Intronic
986567488 5:9129179-9129201 TGAAAGAATGAAGAGGAAAGAGG + Intronic
986804081 5:11291870-11291892 TGCAAATCTGAAGAGAAATGTGG - Intronic
987004650 5:13697778-13697800 GGCAAGAGTGGAAAGTCATGAGG - Intronic
991443050 5:66671368-66671390 TACAAGAGTGAAGGGTAAAAGGG + Intronic
992683098 5:79172469-79172491 AGCAATAGTGAAGAGAAATCTGG - Intronic
992894715 5:81236003-81236025 TGCCAGTGTGAAGAGGAAGGTGG - Intronic
994402776 5:99302597-99302619 TACAAAAGTGGAGAGTAAAGTGG + Intergenic
994581420 5:101647655-101647677 TGCAAGAGTAGAGAGAACTGAGG + Intergenic
994746107 5:103680348-103680370 TTTAAGAGGGAAGAGTTATGTGG - Intergenic
994852528 5:105074266-105074288 TGCAAGAGTGTAGAATGATATGG + Intergenic
994857342 5:105140442-105140464 TGTAAAAGTGGAGAGTAATTGGG + Intergenic
996312817 5:122126104-122126126 TGCATCAGTGAAGAGTCTTGAGG + Intergenic
996857012 5:128019655-128019677 TCCTAGATTGAAGAGGAATGGGG - Intergenic
997440717 5:133907009-133907031 TGGAAGAGGGAAGAGTACAGAGG - Intergenic
997845868 5:137285365-137285387 TGAAAGATTCAAGAATAATGTGG - Intronic
998354518 5:141523900-141523922 TTCAAGAGTGGGGAGAAATGCGG + Intronic
1001336503 5:170801837-170801859 TACAACAATGAAAAGTAATGGGG + Intronic
1009401487 6:63261641-63261663 TCCAAGAGTGAAGAAGAATAGGG - Intergenic
1009626722 6:66145195-66145217 TGAAAGAGGGAAGGGAAATGTGG - Intergenic
1011398356 6:86934400-86934422 TGGTAGAGGGAAGAGTAACGGGG - Intergenic
1012467131 6:99528629-99528651 TGAAAGTGTGATGAGAAATGAGG - Intergenic
1013134551 6:107268703-107268725 TGCAACTGTGAAGAATATTGCGG - Intronic
1015616107 6:135076993-135077015 TGGAGGAGTGAAGAGGGATGTGG - Intronic
1016768303 6:147819805-147819827 TGCTAGAGTTAAGAAGAATGTGG + Intergenic
1018042072 6:159933679-159933701 TGCAAGAGCTAAGAGTAGTTTGG + Intergenic
1018394706 6:163369418-163369440 TGTTAGAGGGAAGAGAAATGTGG - Intergenic
1021828677 7:24580510-24580532 TGCAAGAGAGTAAAGCAATGGGG - Intronic
1022800736 7:33774914-33774936 TGCAAGGGTGAAGAGTATGAGGG - Intergenic
1024134681 7:46394191-46394213 TGCAGTAGAGAAGAGTAAAGGGG + Intergenic
1027467615 7:78535437-78535459 AGCAAGAGTGAAAAGTCTTGAGG + Intronic
1027921345 7:84399528-84399550 TGAAAGAGTGAAGAATACAGAGG + Intronic
1028696503 7:93719385-93719407 TGGAAGAGTTAAGAGGAGTGAGG + Intronic
1030850752 7:114483321-114483343 TGCAAGATTGAAGAGTAGGAAGG - Intronic
1032185062 7:129717691-129717713 GGCAGGAGTGAAGAATGATGCGG - Intronic
1032450600 7:132027092-132027114 TGGAAGAGTGAGAAGGAATGGGG + Intergenic
1033601583 7:142892530-142892552 TGGTAGAGTGAAGAGGATTGGGG - Intergenic
1034904460 7:154932202-154932224 AGCAGGAGTGAAGACTAAGGTGG - Intronic
1035522909 8:289823-289845 TGAAAGAGGGAGGAGAAATGAGG - Intergenic
1035782142 8:2236150-2236172 TGAAAGAGCGAATAGTCATGAGG + Intergenic
1035809979 8:2483269-2483291 TGAAAGAGCGAATAGTCATGAGG - Intergenic
1035875219 8:3181562-3181584 TTCAACAGCCAAGAGTAATGAGG + Intronic
1039444053 8:37616198-37616220 TGCAAAGATGAGGAGTAATGGGG + Intergenic
1041625880 8:60025975-60025997 GGGTAGAGTGAAGAGTGATGAGG - Intergenic
1042364137 8:67917216-67917238 GGCAAGACTGAAGATTAATTTGG - Intergenic
1042504259 8:69542802-69542824 AGCAGGAGTGAAGAGGAAGGTGG + Intronic
1042599270 8:70481999-70482021 TGAAAGAGAGAAGGGTAATGTGG - Intergenic
1043290129 8:78588568-78588590 TGCAAGAGTGAATAATTATTTGG + Intronic
1043600281 8:81929033-81929055 GAAGAGAGTGAAGAGTAATGAGG + Intergenic
1044080947 8:87883016-87883038 TGCAAAAATGAGGAGGAATGTGG - Intergenic
1044828085 8:96217861-96217883 TGAAAAACTGAAGAGAAATGGGG + Intergenic
1045005812 8:97915607-97915629 TGCAAGAGAGGAGAGGAAGGAGG - Intronic
1045411785 8:101927483-101927505 TGCAGGAGTGAAGGGTAAGGAGG + Intronic
1047192076 8:122687259-122687281 TGCAAGAATAGAGAGTGATGTGG - Intergenic
1047577805 8:126177310-126177332 GGCCAGAAAGAAGAGTAATGAGG + Intergenic
1048181690 8:132201185-132201207 TGCAACAGTGTTGAGAAATGTGG - Intronic
1048369413 8:133764632-133764654 AGCAAGAATGAAGAATAGTGTGG - Intergenic
1050176946 9:2878071-2878093 TTCAGGAGTGAAGACTAAAGGGG - Intergenic
1050789848 9:9453871-9453893 TGATGGATTGAAGAGTAATGTGG - Intronic
1051481224 9:17563603-17563625 TGCAATAGTGTTGAGTAATGAGG + Intergenic
1053586185 9:39461705-39461727 TGGAAGAGTGTAGAGGACTGTGG + Intergenic
1054580122 9:66903526-66903548 TGGAAGAGTGTAGAGGACTGTGG - Exonic
1055106993 9:72523274-72523296 AGGAAGAGTGAGGAGTAATAGGG + Intronic
1055375770 9:75647342-75647364 TGAAAGAGGGAAGGGAAATGAGG - Intergenic
1055375779 9:75647403-75647425 TGAAAGAGGGAAGGGAAATGAGG - Intergenic
1055613848 9:78051095-78051117 TAGAAGAGTCAAGAGTGATGTGG + Intergenic
1055957065 9:81784105-81784127 ATCAACAGTGAAGAGAAATGAGG + Intergenic
1056834942 9:89946813-89946835 TGCAAGAGCAAAGAGGAATTAGG + Intergenic
1058828377 9:108794616-108794638 TGAAAGAGGGAAGAGAAATGAGG + Intergenic
1059409645 9:114124047-114124069 TGGAAGAGTGAAGGGGAAGGGGG - Intergenic
1059446424 9:114341076-114341098 TGCAGGAGTGAGGAGGATTGTGG + Intronic
1059933260 9:119282525-119282547 TGTAAAAGAGAAGAGTAATAAGG + Intronic
1059982310 9:119786459-119786481 CACAAGATTGAAGAGGAATGTGG - Intergenic
1060512499 9:124244065-124244087 TGCAAGAGTGTAGTGAAGTGGGG - Intergenic
1186717125 X:12264002-12264024 TGCAACAGTGTTGAGCAATGGGG - Intronic
1187362718 X:18643102-18643124 TGCCAGAGTAAAGAGAAAGGGGG + Intronic
1187799279 X:23042400-23042422 TGCAAAAGTGAATGGTATTGAGG - Intergenic
1187807341 X:23135486-23135508 AGCAAGAAGGAAGAGAAATGGGG + Intergenic
1188269908 X:28126578-28126600 TAGAAGAGTGAAGATGAATGAGG - Intergenic
1188386666 X:29569100-29569122 TGCTAGACTGTAGAGAAATGAGG - Intronic
1188464832 X:30467883-30467905 TGCAAGAGAGATGAGTAAAAAGG - Intergenic
1189638470 X:43039879-43039901 TGCAAGTGTGAAGGATTATGTGG - Intergenic
1192213922 X:69144807-69144829 TGCAAGAAAAAAGAGAAATGGGG - Intergenic
1193731116 X:85105061-85105083 TTCAAAAAAGAAGAGTAATGAGG - Intronic
1193756777 X:85418617-85418639 AACAAGAGGGAAGAGTAAGGGGG - Intergenic
1194446606 X:93995106-93995128 TGTAAGAGGGAAGAGTAATAAGG + Intergenic
1197154465 X:123255240-123255262 TGCAAGAGAGAAGGGAGATGGGG + Intronic
1197720165 X:129739532-129739554 TGCAATAGAGGAGAGAAATGGGG + Intronic
1197783603 X:130179458-130179480 GGCAAGAGTGAAGACTCCTGGGG + Intronic
1198770626 X:140126479-140126501 GAGAAGAGTGAAGAGTAAAGAGG - Intergenic
1199007115 X:142713449-142713471 TACAAGAATGAAGAACAATGAGG + Intergenic