ID: 1079186392

View in Genome Browser
Species Human (GRCh38)
Location 11:18241736-18241758
Sequence CTGGAGACTCAGAAAGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 1, 2: 28, 3: 87, 4: 546}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079186392 Original CRISPR CTGGAGACTCAGAAAGATGG AGG Intronic
900137204 1:1122606-1122628 CTGGCGACTCAGCGAGGTGGGGG + Intergenic
902137413 1:14321846-14321868 CAGAAGACTTAGAAAGAAGGTGG + Intergenic
902409586 1:16205256-16205278 CCGGAGACTCTGACAGCTGGGGG + Intronic
903670316 1:25031431-25031453 CTGGAGAGATGGAAAGATGGAGG + Intergenic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905477546 1:38239495-38239517 CTGGAGCCTCAGAACCAAGGTGG - Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906933813 1:50194639-50194661 CTGGAGACCAAGAAAGAAGCAGG + Intronic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
907841164 1:58158785-58158807 CTGCAGAGCCAGAAAGATGCAGG + Intronic
907944922 1:59127115-59127137 CTGAAGACACAGAAAGGTGTGGG + Intergenic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
909101564 1:71355672-71355694 CTGGAGATACAAAAAGATAGAGG - Intergenic
909416265 1:75409168-75409190 CTGGAGACTCTAAAAGATGGGGG + Intronic
909872202 1:80755732-80755754 TTGGAGACTCAGGAGGTTGGGGG - Intergenic
911268444 1:95772066-95772088 TAGAAGACTCAGAAAGCTGGTGG - Intergenic
911382646 1:97135060-97135082 AGGGAAACTCAGAAAAATGGTGG - Intronic
911595332 1:99793289-99793311 ATGAAGACACAGCAAGATGGTGG - Intergenic
911775038 1:101798629-101798651 CTCCAGACTCAGATAGATGTAGG + Intergenic
913237356 1:116796493-116796515 CTGGAGACACAGGGACATGGAGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915447424 1:155981885-155981907 CTGGAGAATCTGAAAGCTGATGG - Intronic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
918386423 1:184012929-184012951 CTGGAGATTCAAAAAGAAGAGGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919711255 1:200731604-200731626 ATGGAGGCTCAGAAAGACTGAGG - Intergenic
919894641 1:202001823-202001845 ATTGACACTCGGAAAGATGGTGG + Intronic
920268121 1:204742208-204742230 AAGGAGACTCTGAAAGGTGGAGG - Intergenic
920894667 1:210034596-210034618 CTGAAGATTCAGAAAAGTGGAGG - Intronic
921240287 1:213173637-213173659 CTGTGGTCTCAGAAAGATGTGGG - Intronic
921536262 1:216352306-216352328 CTAGAAACTCAGAGAGATGATGG + Intronic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922880282 1:228975467-228975489 CTGGGGCCTCAGGAACATGGGGG - Intergenic
924001720 1:239561049-239561071 CTGCAGAGTCACAAAGAAGGAGG - Intronic
924028883 1:239867011-239867033 CTGAAGAGTCAGACAGATGCAGG - Intronic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1070168145 10:73913267-73913289 CTGGCAACACAGAAAGATAGGGG - Intronic
1070434474 10:76376154-76376176 CTGGAGGCTCCAAAAGGTGGAGG - Intronic
1071205943 10:83277751-83277773 CTGGCGTCTCAGATAGATGCTGG - Intergenic
1071260329 10:83913767-83913789 CTTGAGAGTCAGAGAGATGTGGG - Intergenic
1071390686 10:85172305-85172327 CTGGAGTCTCCAAAAGAGGGAGG + Intergenic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1071822354 10:89291363-89291385 CTGGAGACTGGGAAATAGGGTGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1073688975 10:105786486-105786508 ATGGAGACACAGAGAGAAGGTGG - Intergenic
1074271647 10:111959427-111959449 CAGGAGACTTAGGGAGATGGTGG + Intergenic
1074370547 10:112897736-112897758 ATGGGGACTCAGAGAGGTGGAGG + Intergenic
1074409959 10:113219829-113219851 CTGGAGTGTGAGAAAGATGGAGG - Intergenic
1074766105 10:116701060-116701082 CTCGGGAGTCAGCAAGATGGTGG + Exonic
1075393733 10:122112570-122112592 CAGGAGCCTCAGAAAGAAGCTGG - Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076514107 10:131033533-131033555 CTGGATACGCAGAAAGATGGAGG + Intergenic
1076520926 10:131080800-131080822 CTGGAGATTCAGAAATGTGGAGG + Intergenic
1076739584 10:132476688-132476710 CTGGGGTCTCAGACAGCTGGTGG - Intergenic
1077671500 11:4161832-4161854 CTGAAGATGAAGAAAGATGGGGG + Intergenic
1077854712 11:6111951-6111973 CAGAAGACTCAGACAGCTGGAGG - Intergenic
1077985530 11:7347624-7347646 CTGGGGAGTCAGGAAGATTGTGG + Intronic
1078548890 11:12267065-12267087 CTGGGGAATCAGAAACCTGGAGG - Intergenic
1079123647 11:17702982-17703004 ATGGAGGCTCAGAGAGATTGAGG + Intergenic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080730512 11:34946933-34946955 CTGGAAACTCAAAAATATGGAGG - Intronic
1080851522 11:36074382-36074404 CAAGAGACTGAGTAAGATGGAGG + Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1084912532 11:72402537-72402559 ATGGAAACTAAGAAAGATGGGGG - Intronic
1084942808 11:72622687-72622709 CTGGAGACAGAGGAGGATGGGGG + Intronic
1085279456 11:75320491-75320513 CTGGAGCCTCTGAAAGCTTGGGG + Intronic
1085435437 11:76495172-76495194 CTAGAGAATGATAAAGATGGAGG - Intronic
1085717591 11:78886688-78886710 CTGGAGAGTCAGCAAGGTGTTGG - Intronic
1086933294 11:92717185-92717207 CTGGGGACAAAGAAACATGGAGG - Intronic
1087567031 11:99874048-99874070 CTGGGAACTCTGAAAGAGGGAGG + Intronic
1087705591 11:101487536-101487558 TTGGAGACTTAGAAAAGTGGGGG - Intronic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1088554126 11:111044332-111044354 AAGGAGACTCAGAAGGGTGGGGG - Intergenic
1088615286 11:111620621-111620643 CTGGAGAATCAAACATATGGAGG + Intronic
1088866260 11:113850878-113850900 CAGAAGTGTCAGAAAGATGGTGG - Intronic
1089076898 11:115745579-115745601 CAGGAGAAAGAGAAAGATGGAGG + Intergenic
1090733677 11:129592919-129592941 CTGGAGACTCACAGAGCAGGAGG - Intergenic
1090855071 11:130603691-130603713 GTGGAGACTCAGGATGATGGTGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091061916 11:132471579-132471601 CTGGAGACACCCACAGATGGAGG - Intronic
1091131609 11:133151403-133151425 CTGGAGATGCAGGAAGATGGGGG + Intronic
1091152537 11:133342201-133342223 TGGGAGTCTCTGAAAGATGGAGG - Intronic
1091782102 12:3220435-3220457 CTGGAGAGTCAGGAAGGTGACGG - Intronic
1092047600 12:5443139-5443161 CTGGAAACTCAGGAACCTGGAGG + Intronic
1092069265 12:5619519-5619541 CTGGATACACAGCTAGATGGGGG + Intronic
1092484129 12:8887034-8887056 CTGTAGTCTCAGAAACTTGGGGG + Intergenic
1092769549 12:11884274-11884296 ACGGAGGCCCAGAAAGATGGAGG - Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093524297 12:20089869-20089891 CTGGGGACTCCGAAAGAGGCAGG + Intergenic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1094190304 12:27691017-27691039 CTGGATACTCAGGCAGATAGAGG - Intronic
1094281332 12:28743006-28743028 CTGGAGTCACAGAAGCATGGAGG - Intergenic
1094415903 12:30214547-30214569 TTGGAAACTCAGAAGGGTGGTGG - Intergenic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1095670030 12:44848075-44848097 CTGTTGACTCAGGAAGATGATGG + Intronic
1095739179 12:45588375-45588397 CTGGAGAGCCAGAAAGCTGGTGG - Intergenic
1096470466 12:51872212-51872234 CTGGATCCTCAGCAAGATGGGGG + Intergenic
1096629719 12:52918345-52918367 TTGGAGCCTCAGAAACATGCAGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097686564 12:62696497-62696519 CTTAGGATTCAGAAAGATGGAGG - Intronic
1097924736 12:65114866-65114888 GTGGAGATTCAGAAAAATGAAGG + Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098158696 12:67626313-67626335 CTGGAGACCCAGAAAGCCAGTGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1100354316 12:93814691-93814713 CTGGAGGCTCAGAGAGTTGGTGG - Intronic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101411494 12:104472564-104472586 ATGGAGACTCAGAAGGATTTAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102559602 12:113752876-113752898 CTGGTCACCCAGAAAGATAGAGG - Intergenic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1103222373 12:119256539-119256561 ACTGAGACTCAGAAAGATTGGGG + Intergenic
1103232424 12:119342771-119342793 CTGGACACTCTGAAAAATGTAGG + Intronic
1104342240 12:127961286-127961308 CTGCAGCCTCAGACAGCTGGGGG + Intergenic
1104483460 12:129128755-129128777 CTGGAGACTCCCAAGGGTGGGGG - Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106456803 13:29934981-29935003 CTGCAGGCTCAGAAAGAGGCAGG + Intergenic
1106633666 13:31504462-31504484 CAGGAAACTCAGAATAATGGCGG - Intergenic
1107018586 13:35729126-35729148 CTGTGGAATCAGAAAGATGCAGG + Intergenic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1109019221 13:57063423-57063445 GTGGAGTCTCGGTAAGATGGTGG + Intergenic
1109131154 13:58587401-58587423 TTGAAAACACAGAAAGATGGTGG + Intergenic
1112042850 13:95565245-95565267 CTGGACATTCAGAAAGTTAGTGG - Intronic
1112227883 13:97558280-97558302 CTGCAGGCTCAGAAGGCTGGAGG + Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114363568 14:22002878-22002900 CTGCAGACTCAGAAAGAAAACGG - Intergenic
1114567881 14:23645799-23645821 CTGGGGGCTCAGCAAGGTGGTGG + Intergenic
1115167833 14:30469535-30469557 CTGGAGAACCAGAAAACTGGTGG - Intergenic
1115393301 14:32877866-32877888 CAGGTGACTGAGGAAGATGGTGG - Intergenic
1115456302 14:33607808-33607830 CAGGAAACTCAGAATCATGGCGG + Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116422464 14:44748793-44748815 CTAGAGACTAAGAAGGGTGGGGG + Intergenic
1116693851 14:48147220-48147242 CTGGAGACTCAGAAGGGCAGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1117074518 14:52088952-52088974 CTAGAGACTCAGAAGACTGGAGG - Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118918136 14:70125330-70125352 TTGGAGACTCGGAAGGGTGGGGG - Intronic
1119153567 14:72387896-72387918 GTGGAGACTCAGTGAGAAGGCGG - Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120346559 14:83298121-83298143 CTGGAGACTTACAATCATGGTGG + Intergenic
1123045984 14:105515092-105515114 CAGGAGACTTAGAATCATGGCGG - Intergenic
1124064913 15:26333387-26333409 CTGGAGACTCTAAAGGATGGGGG + Intergenic
1124938492 15:34195416-34195438 ATGGAGACTCAGAGAGGTAGGGG + Intronic
1125746982 15:42003954-42003976 CTGAGGACTCAGAGAGCTGGAGG - Intronic
1126138531 15:45416393-45416415 GAAGAGACTCAGAAAGAGGGAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126594575 15:50372745-50372767 CTGGAGATGCAGAAAGCTAGAGG - Intergenic
1127052475 15:55099250-55099272 CGGGAGACTCAGAAACGTGGCGG + Intergenic
1127564679 15:60175640-60175662 CTGGGGACTCAGCAAGGTGTGGG + Intergenic
1128092024 15:64925787-64925809 GTGGAGGCTCAGAGAGGTGGAGG + Intronic
1129488722 15:75903381-75903403 ATGTAAACTCAGAAATATGGCGG + Intergenic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1129955767 15:79635446-79635468 CTGCAGCCTCAGGAAGCTGGGGG - Intergenic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130102551 15:80904980-80905002 CTGCAGACTCAGTGAGATTGTGG - Intronic
1130680902 15:85995912-85995934 CTGGGGACTCCAAAAGAGGGGGG + Intergenic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1131035487 15:89219191-89219213 CTGCAGAGTCAGAATCATGGAGG - Intronic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131268807 15:90934412-90934434 CTGGAGAATCAGACAGACGAGGG - Intronic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131660105 15:94505211-94505233 CTGGAGTCACAAAAACATGGAGG - Intergenic
1131843962 15:96469164-96469186 CCTGAGATTCAGAAAGAGGGTGG + Intergenic
1131966363 15:97848171-97848193 CTGGATTCTCAGATAAATGGAGG + Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135376469 16:21951882-21951904 ATGGAGACTCCGAAAGGTGGAGG + Intergenic
1135401476 16:22169264-22169286 CTGGCCACCCAGGAAGATGGTGG + Intronic
1135799604 16:25480351-25480373 CTGGAAACTCAGAAAGGGAGGGG + Intergenic
1135871301 16:26153256-26153278 CTGGAGATACAGAAAGATGGCGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136023099 16:27452429-27452451 CAGGAGAATCTGAGAGATGGAGG + Intergenic
1136062260 16:27734810-27734832 CTTGACCCACAGAAAGATGGTGG + Intronic
1137337395 16:47563814-47563836 CTGGAGGCTCAGAAGACTGGAGG - Intronic
1137355833 16:47762906-47762928 CTGGGGACTCCAAAAGAGGGAGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138122389 16:54411158-54411180 CTGGAGACTGAGAGAGGTGAAGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138862997 16:60781861-60781883 TTTGAGGCTCAGAAAGATGACGG - Intergenic
1138966697 16:62093298-62093320 CTGGAGACTCCAAAAGGGGGAGG - Intergenic
1139947478 16:70651125-70651147 CTGGAGACAGAGACCGATGGGGG + Intronic
1140019639 16:71225669-71225691 CTTGAGGTTCAGAAAGAAGGAGG + Intronic
1143293124 17:5848113-5848135 CTGAAGACTCAGAAAGGAGGAGG - Intronic
1143532905 17:7516072-7516094 CTGGAGAACCAGGAAGCTGGTGG + Intergenic
1143737350 17:8922118-8922140 CTGGAGAATAGGAAAGAAGGAGG + Intronic
1143789939 17:9286801-9286823 CCAGAGACTCAGAAAAAGGGTGG + Intronic
1143965584 17:10754541-10754563 ACGCAGACTCAGAAAGATGCTGG - Intergenic
1144504274 17:15817023-15817045 ATGGGGACTCAAAAAGTTGGGGG + Intergenic
1144634028 17:16892690-16892712 CTGGGGACTCAAAAAGTTGGGGG + Intergenic
1145168129 17:20632530-20632552 GTGGGGACTCAAAAAGTTGGGGG + Intergenic
1146402080 17:32507819-32507841 GTGAGGACTCAGAAAGAAGGTGG + Intronic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1146582354 17:34049953-34049975 CTGGAGACTCAGAAATAGTTGGG - Intronic
1147892485 17:43727147-43727169 CTGGGGACTCAGAATCAAGGAGG - Intergenic
1148233435 17:45951582-45951604 CTGGAGACACGGAAATCTGGAGG - Intronic
1148627003 17:49077226-49077248 CTGGTGACTCAGAAAGGATGCGG - Intergenic
1149623012 17:58060263-58060285 ATGGAGTCCAAGAAAGATGGAGG + Intergenic
1150957413 17:69874479-69874501 CTAGAGTCTCAGAAATATGTTGG - Intergenic
1151183855 17:72349467-72349489 CAGGAGGCTCTGGAAGATGGAGG + Intergenic
1151287357 17:73122515-73122537 CTTGAGGATCAGTAAGATGGTGG + Intergenic
1151540234 17:74761055-74761077 CTGGACACACAGTATGATGGAGG - Intronic
1152334570 17:79693173-79693195 ATGGAGACTCTGAATGATGGTGG + Intergenic
1152401029 17:80066208-80066230 GTGGAGACTACGAAAGGTGGAGG - Intronic
1152421121 17:80193709-80193731 CTGGCCACTCAGAGAGCTGGGGG + Intronic
1153080580 18:1218980-1219002 CTTCAGACTCAGAGAGATGCAGG + Intergenic
1153241382 18:3034315-3034337 CTGGAGGGGCAGAAATATGGAGG + Intergenic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1154064506 18:11094476-11094498 CAGGAGACTCAGACAGTTGTAGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154382682 18:13866927-13866949 CTGGATAATTAGAAAGATGGTGG - Intergenic
1155236940 18:23829777-23829799 CTGGAGACTATGAAAAGTGGAGG - Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1156558027 18:38089540-38089562 CTGGGGGCTAAGGAAGATGGAGG + Intergenic
1156874889 18:41997734-41997756 CTTGAGCCTCAGAAAGATTAGGG + Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158859440 18:61578030-61578052 GTGGACACTCAGAAGGGTGGAGG + Intergenic
1159950258 18:74477986-74478008 TTGGAGACACAGAACTATGGGGG - Intergenic
1161303874 19:3556551-3556573 CTGCACAGTCAGACAGATGGGGG + Intronic
1161471862 19:4461540-4461562 CAGGAGAATCCGAGAGATGGAGG - Intergenic
1163207373 19:15813581-15813603 GTGGAGACACAGAGAGATGTGGG + Intergenic
1163449258 19:17366015-17366037 CAGGAGACCCAGGAAGATTGGGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164729599 19:30493008-30493030 CTGCAGACTCAAAATGCTGGCGG - Intronic
1165258148 19:34592402-34592424 AGGGAGACTCAGAGGGATGGAGG + Intergenic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1165654435 19:37520831-37520853 CTGGATTCTCAGAATGGTGGTGG + Intronic
1165780262 19:38429086-38429108 CTGGAGAGTCAGCAATTTGGAGG - Intergenic
1166084309 19:40465065-40465087 CTGGAAACTGAAAAAGTTGGGGG - Intronic
1166880603 19:45927627-45927649 CTGGAGAGTGAAAAAGATGGGGG + Intergenic
1167359069 19:49020319-49020341 CTGGAGACCCAGAAAGATAGGGG - Intergenic
1167366756 19:49058556-49058578 CTGGGGACCCAGAAAGATGGGGG - Exonic
1167373258 19:49097289-49097311 CTCGAGACACAGAAAAAGGGAGG - Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168084190 19:54033319-54033341 GTGGAGACACAGCAAGAAGGCGG - Intergenic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
1168684166 19:58337929-58337951 CTGGAGACAGAGAGAGAGGGAGG - Intronic
925872368 2:8282395-8282417 CTGGAGACCAGGAAAGCTGGGGG + Intergenic
926606542 2:14904022-14904044 CTGGACACTCAGAGAAACGGGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927153557 2:20209292-20209314 CTAGAGACTCTGAAAGGTGAGGG + Intronic
927472062 2:23384708-23384730 CTGGAGTGTCATAAAGAGGGCGG + Intergenic
928870123 2:35965977-35965999 CTGGAGACCCAGGAAGCTGGTGG - Intergenic
929575208 2:43047346-43047368 CTGGAGACCCGGAAAGTGGGAGG - Intergenic
930028764 2:47045694-47045716 CTGGAGATACACAAAGAAGGCGG - Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
931997414 2:67852481-67852503 CTCGGGACTCAGAAACATGAGGG + Intergenic
932444391 2:71766364-71766386 CTGGAGGCAAAGAAAGCTGGTGG - Intergenic
933232941 2:79830066-79830088 CTGGAGACTGAGAGAGACGAGGG + Intronic
933458335 2:82545669-82545691 ATGGAGACTAAGAAGGGTGGAGG - Intergenic
933465853 2:82650219-82650241 CTGCTGACTCATCAAGATGGTGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934055242 2:88246070-88246092 GTGGAGAAACAGAAACATGGAGG - Intergenic
934895098 2:98111112-98111134 CTGGAGAATCCAAAAGGTGGGGG - Intronic
935304145 2:101720286-101720308 CTGGCGACTCAGGAAGCTGAGGG - Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
937146116 2:119646370-119646392 CTGGAGACTTACAATCATGGCGG + Intronic
938132817 2:128732063-128732085 CTGGAGACACAGAAAGACAGAGG + Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939610011 2:144298664-144298686 CAGAAAACTCAGGAAGATGGTGG - Intronic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
943196127 2:184752464-184752486 CTGGAGACTCCAAAATGTGGGGG + Intronic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
945109414 2:206348429-206348451 CAGGAAACTTAGAATGATGGTGG + Intergenic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945342458 2:208673258-208673280 CTGGAGATCTAGGAAGATGGAGG - Intronic
945983975 2:216339897-216339919 CAGGAGGCCCAGAGAGATGGTGG - Intronic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
946875545 2:224126139-224126161 CTGGAGCCTCAGCAAGGAGGTGG + Intergenic
946906740 2:224424621-224424643 TTTGAGACTGAGAAGGATGGAGG + Intergenic
947329743 2:229015958-229015980 CTGGAGGCTGAGAAGAATGGTGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947952987 2:234164118-234164140 CTGGAGCCTCAGGAATAAGGGGG + Intergenic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169935441 20:10878588-10878610 CTGGAGACTCCAAAAGCAGGAGG + Intergenic
1170075572 20:12415280-12415302 CTGCAGACACAGAATGCTGGAGG - Intergenic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170388036 20:15841738-15841760 GAGGAGACTTAGAATGATGGTGG + Intronic
1170389387 20:15855173-15855195 CTGGTGGCTCTGAAAAATGGAGG + Intronic
1170963061 20:21042539-21042561 CTGGAGACCCAGAAAGCCAGTGG + Intergenic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171239270 20:23551840-23551862 CTGGAGATGCAGAGAGTTGGGGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171490550 20:25513816-25513838 CAGGAAACTCAGAATCATGGCGG - Intronic
1172883230 20:38215095-38215117 CTGGACACACAGACAGATGATGG - Intronic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173408814 20:42791467-42791489 CTGGAGACCCACAAAGCAGGTGG + Intronic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1174149532 20:48476361-48476383 CTGGAGACCCAGAAAGGAGTTGG - Intergenic
1174149601 20:48476760-48476782 CTGGAGACCCAGAAAGGAGCTGG - Intergenic
1174421547 20:50402232-50402254 GTGGAGGGTGAGAAAGATGGAGG + Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1174921978 20:54713098-54713120 ATGGGGACACAGAAAGAAGGTGG + Intergenic
1175617556 20:60414020-60414042 CTTGAGAATCAGAAAGGGGGAGG - Intergenic
1175750333 20:61492591-61492613 ATGAAGACTCAGATAGATGGTGG + Intronic
1176333108 21:5568621-5568643 CTGTAGTCTCAGGAAGTTGGAGG + Intergenic
1176394649 21:6252331-6252353 CTGTAGTCTCAGGAAGTTGGAGG - Intergenic
1176442508 21:6736773-6736795 CTGTAGTCTCAGGAAGTTGGAGG + Intergenic
1176466770 21:7063843-7063865 CTGTAGTCTCAGGAAGTTGGAGG + Intronic
1176490331 21:7445621-7445643 CTGTAGTCTCAGGAAGTTGGAGG + Intergenic
1176510311 21:7692762-7692784 CTGTAGTCTCAGGAAGTTGGAGG - Intergenic
1176673663 21:9757309-9757331 CTCGAGACTCAGAAAGCTGCCGG + Intergenic
1177096957 21:16847790-16847812 CTAGTGTCTCAGAAAGAAGGAGG - Intergenic
1177112192 21:17042023-17042045 ATGGAGGCTCAGAAGGATTGGGG + Intergenic
1177213872 21:18104411-18104433 CAGGAAACTCAGAATCATGGCGG - Intronic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1177864798 21:26500084-26500106 GTGAAGACACAGCAAGATGGTGG - Intronic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1179109381 21:38433280-38433302 CTGCAGGCCCAAAAAGATGGAGG + Intronic
1179182413 21:39057169-39057191 CTGAAGACTCAGTAAGATGAAGG + Intergenic
1179576236 21:42310160-42310182 CGGGAGACAGAGAAAGACGGGGG + Intergenic
1180101081 21:45586310-45586332 CTGAAAAGTCAGAAAGCTGGCGG + Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1180726182 22:17948284-17948306 CTGGAGAGCCAGCAAGATTGTGG - Intronic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1181658289 22:24319251-24319273 CTGGAAACTTAGAATTATGGTGG + Intronic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1182068868 22:27449273-27449295 CTGGAGTCTCAGAAATACAGAGG + Intergenic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1184573696 22:45344603-45344625 CTGGATACTGAGAAAGATCTAGG + Exonic
1184644176 22:45887171-45887193 CTGGAGAGTCAGGGAGATGGAGG + Intergenic
1184751817 22:46490663-46490685 CTGCAGACTCAGGAAAGTGGTGG + Intronic
1184830279 22:46981676-46981698 CAGGAAACTCAGAATCATGGTGG - Intronic
1184920736 22:47603929-47603951 GTGAAGACTCAGGAAGAAGGTGG - Intergenic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
951008409 3:17646900-17646922 CTGGGGACTCAAAAAGTGGGAGG - Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
953040510 3:39251626-39251648 CTGGAGACTCAAGATGACGGAGG - Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953466348 3:43123531-43123553 TTGCAGCCTCAGAGAGATGGGGG + Intergenic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
954712532 3:52512258-52512280 CTGGACAGGCAGAAAGATGGGGG + Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955663582 3:61327186-61327208 GTGGAGAAGCAGAAAGCTGGTGG + Intergenic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
957768278 3:84655446-84655468 CTAGAGACACAGAAAGGTGAAGG + Intergenic
957973741 3:87416928-87416950 GTGGAGACACAGCAAGAAGGTGG + Intergenic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
959614516 3:108332206-108332228 TTCCAGACTCAGAAAAATGGAGG + Intronic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961715149 3:128852870-128852892 GTGTAGACTCAGAAGGCTGGGGG + Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
962870463 3:139486151-139486173 CTTGAGACTCAGAAATGGGGAGG - Intergenic
962896346 3:139718433-139718455 CAGGAGAATGAGAAAGCTGGAGG - Intergenic
962920646 3:139947458-139947480 CAGGAAACTCACAAAGATGCTGG + Intronic
963694564 3:148549036-148549058 CTGGAGGCTCACTTAGATGGCGG - Intergenic
963876799 3:150484966-150484988 CTGGGGACCCCAAAAGATGGAGG + Intergenic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
964708895 3:159650178-159650200 CTGGAGCATGAGAGAGATGGAGG + Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965045632 3:163573347-163573369 AAGAAGACTCAGAAACATGGTGG - Intergenic
965369972 3:167849806-167849828 CTAGAGACTGAAAAAGATAGGGG - Intergenic
966266743 3:178055113-178055135 CTTGGGAGTCAGAGAGATGGGGG + Intergenic
966344648 3:178965026-178965048 CTGGTCAGTCAGAAATATGGGGG + Intergenic
966486887 3:180481267-180481289 CAGGAGACTTAGAATCATGGTGG + Intergenic
966499305 3:180620921-180620943 CGGAAGACTCAGAAGCATGGTGG - Intronic
967728501 3:192884336-192884358 TTGGAGACTCAGGTAGGTGGAGG + Intronic
967755606 3:193164977-193164999 CTTGAAACTTAGAAAGATGATGG + Intergenic
968657780 4:1786047-1786069 CTGGGGACTCCGAGAGCTGGAGG + Intergenic
969166739 4:5322641-5322663 CTGGAGACTAAGAAAGGTCTAGG + Intronic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970497914 4:16645807-16645829 ATTGAGACTTAGAAAGATGAAGG - Intronic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972889456 4:43538363-43538385 CTGGAGATTCAGAAAGGGAGAGG + Intergenic
973156296 4:46957671-46957693 ATGGAGGCTGAGATAGATGGTGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
974112554 4:57542569-57542591 CTGGAGAACTAGAAAGGTGGTGG + Intergenic
974889123 4:67857695-67857717 CTAGAGACTGGGAAGGATGGAGG + Intronic
975361166 4:73474103-73474125 CTGGAAACTCACAATCATGGTGG + Intergenic
975629469 4:76386144-76386166 CTGGAGGCAGAGCAAGATGGCGG + Intronic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976563987 4:86532720-86532742 TTGGAGATTCAGAAAAGTGGAGG - Intronic
976855880 4:89604890-89604912 CAGGAGTCCCAGAAAGAGGGAGG + Intergenic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
979760787 4:124401229-124401251 TTGGAGACTCAGAATAGTGGGGG - Intergenic
980548569 4:134302958-134302980 TTGGAGACTCAAAAGCATGGAGG - Intergenic
980627378 4:135391023-135391045 CAGGAAACTCAGAATCATGGTGG + Intergenic
980999130 4:139811283-139811305 CTGGAAACACAGGATGATGGAGG - Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
984363006 4:178761573-178761595 CTGGAGCCTGAGGAACATGGTGG + Intergenic
984424316 4:179563789-179563811 CTGAAGCCTCAGGAGGATGGGGG + Intergenic
985074620 4:186201697-186201719 CTGGAACCTCAGAAAGCAGGTGG - Intronic
985401045 4:189594360-189594382 CTCGAGACTCAGAAAGCTGCCGG - Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985849604 5:2379010-2379032 CTGGAGACTCTGCAAGATGCTGG + Intergenic
986065083 5:4227623-4227645 CTGGAGACTCTGGGGGATGGGGG - Intergenic
986384297 5:7216593-7216615 CTGGAGACTAAGAAGGAAAGAGG - Intergenic
986879008 5:12147283-12147305 TTGAAGACTCAGAAGGGTGGGGG - Intergenic
986991206 5:13554804-13554826 ATGTAGAGTCAGAGAGATGGAGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987580301 5:19782185-19782207 CAGGAGACTCACAATCATGGTGG + Intronic
987625555 5:20395428-20395450 CTGGAGACTCAGAAATAGAGAGG + Intronic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989191939 5:38678869-38678891 CTGGTCACTCAGAAAGAGGGAGG - Intergenic
990180197 5:53152410-53152432 CTAGAGAGTAAGAGAGATGGAGG - Intergenic
990787154 5:59434447-59434469 CTGGAGACCCACAAAAATTGGGG + Intronic
991963805 5:72071534-72071556 ATGGAGACTAACCAAGATGGTGG + Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992333913 5:75745760-75745782 ATTTAAACTCAGAAAGATGGAGG + Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993322757 5:86494319-86494341 CTGGACACTTAGAAGGGTGGAGG - Intergenic
993568432 5:89505130-89505152 CTGGAGTCTCCAAAACATGGAGG + Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
995031611 5:107488061-107488083 CTGGGGTCCCAGAAAAATGGTGG + Intronic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
996004117 5:118400613-118400635 CTGGAGACTACTAAAGAAGGAGG - Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997886729 5:137637115-137637137 GTTGAGACTCAGAGAGGTGGTGG - Intronic
1000459779 5:161500237-161500259 TCTGAGTCTCAGAAAGATGGAGG - Intronic
1001427018 5:171629392-171629414 ATGGAGGCTCAGAGAGAGGGAGG + Intergenic
1001529045 5:172449435-172449457 CTGCAGATTCAGAGAGGTGGAGG - Intronic
1001542391 5:172548723-172548745 CTGTGGACTCAGACAGATCGGGG + Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002466186 5:179410048-179410070 CTGGAAAGTCACAGAGATGGTGG + Intergenic
1002759931 6:193468-193490 CTGAAGACTAGGAGAGATGGTGG + Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003762762 6:9198908-9198930 CTGGTGACTCAGCAAGAAGAGGG - Intergenic
1005285184 6:24318558-24318580 TTAGAGACTCAGAAGGATGCTGG - Intronic
1005422816 6:25670484-25670506 TTGGAGAGTCAGATAGATGAAGG + Intronic
1005454224 6:26003653-26003675 CTGGAAACTCAGAGAGATGATGG + Intergenic
1006414134 6:33893314-33893336 CTGGAGGCTGAGAAACCTGGAGG + Intergenic
1006913883 6:37582322-37582344 CAGGAGAGTCAGAGATATGGTGG + Intergenic
1007790708 6:44306622-44306644 CTGGAGGCTCAGACACATTGAGG + Intronic
1008117523 6:47569240-47569262 ATGGAAACTCAGAAGAATGGTGG + Intronic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009514503 6:64597694-64597716 CTGGAGACTTAAAAGGGTGGGGG + Intronic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1014069932 6:117169089-117169111 CTGAAGCCTGAGAAGGATGGTGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017075674 6:150615525-150615547 CGGGAGATTTAGAAAGATGAAGG - Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018049108 6:159992370-159992392 CTGGAGACTCAGAAAGGTTGGGG - Intronic
1018792263 6:167157598-167157620 CTGGAGGCTCAGGTAGAAGGCGG + Exonic
1018851848 6:167646118-167646140 CAGGTGACTAAGAAAGAAGGGGG + Intergenic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019708651 7:2508353-2508375 CTGGAGACTCCGGAAGGAGGAGG - Intergenic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1020632093 7:10651737-10651759 CTGGGGACTCCAAAAGGTGGAGG + Intergenic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1022180843 7:27917891-27917913 GTGGAGAGTCAGAAATATGTGGG - Intronic
1023456691 7:40347182-40347204 CTGAAGGCTCAGAAAGAATGAGG + Intronic
1024186879 7:46958472-46958494 CTGTATACTCAGAAAGATCAGGG + Intergenic
1024272458 7:47652864-47652886 AGGGAGACTCAGAAGGGTGGAGG + Intergenic
1024584747 7:50832394-50832416 CTGGAAATTCAGAAATAGGGTGG + Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1025164067 7:56695403-56695425 TTTGAGATTCAGAAAGAAGGTGG + Intergenic
1025706219 7:63866675-63866697 TTTGAGATTCAGAAAGAAGGTGG - Intergenic
1026326838 7:69317818-69317840 CTGCTGAATCAGAAAGTTGGTGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026820362 7:73543683-73543705 CAGGAGACTCACAGAGAGGGAGG + Intronic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028314293 7:89381048-89381070 CCTGAGACTCAAAAAGATGTAGG + Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1029805036 7:102987139-102987161 CTGGAGACTCTGAAAGGGAGAGG + Intronic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032155655 7:129465481-129465503 CTGGTGACACAGGAAGCTGGAGG + Intronic
1032214850 7:129949959-129949981 CTGGGGGTTGAGAAAGATGGTGG - Intronic
1032785139 7:135194627-135194649 CTGGAAACACAGACAAATGGAGG + Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035749380 8:1985141-1985163 CTGGAGACCCCCAAAGAGGGTGG + Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1037020610 8:13965888-13965910 CTGGAGACCCAGAAAGCCAGTGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1038560138 8:28569415-28569437 CTAGAGAATGAGAAAAATGGAGG - Exonic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039020197 8:33196827-33196849 CTGGAGACTAAGTATGATGGCGG - Intergenic
1039052428 8:33507044-33507066 GTGGAGACTCAGGAATGTGGAGG + Intronic
1039800409 8:40949802-40949824 GTGAAGACACAGAAAGAAGGTGG + Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041499583 8:58525933-58525955 CTGGAAAGTCAGAAAGGTGAGGG + Intergenic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041912425 8:63103138-63103160 CTGGATCCACTGAAAGATGGAGG + Intergenic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042482737 8:69322568-69322590 CTGGAGACCCAGAAAGGAGCTGG + Intergenic
1043192373 8:77241837-77241859 CTGGAAGCTCACAATGATGGTGG - Intergenic
1043366521 8:79539454-79539476 TTGGAGACTCAGAAGGGTAGTGG - Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1046730569 8:117721263-117721285 TTGGAGACTCAGAAGGGTTGGGG - Intergenic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047345547 8:124024357-124024379 CTGAAAACTCAGAAAGGGGGAGG - Intronic
1047508445 8:125497856-125497878 ATGGAGAGTCAGCAAGGTGGGGG + Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047899866 8:129408413-129408435 CTGGAGATTCAGAAGGGTTGGGG - Intergenic
1048589696 8:135809998-135810020 CTGGTCACCCAGAAAGATGGAGG - Intergenic
1048809869 8:138276177-138276199 CAGGAGACTCAGCAAATTGGAGG + Intronic
1049330941 8:142050429-142050451 CTGGAGACTCACCCAGATTGTGG + Intergenic
1049782047 8:144433613-144433635 CTGGTGGCTCAGAAAGAAGCTGG + Exonic
1049971804 9:828199-828221 CTGAAAAATCAGAAAGATAGTGG + Intergenic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1052178688 9:25498682-25498704 GTAGAGACTCAGAAAAATGTGGG + Intergenic
1052208163 9:25869004-25869026 GTGAAGACTCAGAAAGGAGGAGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1053343510 9:37360734-37360756 CTGGAGACTCAGCCAGCTGAGGG + Intergenic
1053475498 9:38379335-38379357 CTGGAGCCTCAGAAAGGAGCAGG + Intergenic
1053478883 9:38401523-38401545 CTGGAGTCTGAGAAATATGGAGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053749103 9:41235444-41235466 CTGGAGTCTCAGCGAGAGGGTGG - Intergenic
1054336761 9:63815305-63815327 CTGGAGTCTCAGCGAGAGGGTGG + Intergenic
1054866087 9:70003215-70003237 TTGGATTCTCAGAAAGATGGTGG - Intergenic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1057977146 9:99618137-99618159 CTGGAGACTCAGAAGAGTAGGGG + Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058634958 9:107029444-107029466 CTGGTGACTAAGTAAGGTGGGGG + Intergenic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059580731 9:115545800-115545822 TTGGAGACTCAGTCAGAAGGGGG + Intergenic
1059580914 9:115547326-115547348 TTGGAGACTCAGTCAGAAGGGGG + Intergenic
1059643904 9:116245144-116245166 ATGGACACTCAGAAGGGTGGGGG + Intronic
1059657349 9:116368679-116368701 CTGGAGAAACCGAAAGAAGGAGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060045429 9:120336711-120336733 GTGGGGAGTCAGAAAGATGAGGG + Intergenic
1060573019 9:124660571-124660593 TTGGAGCTGCAGAAAGATGGGGG + Intronic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1062142729 9:134968729-134968751 CGGGAGACTCACACAGAGGGTGG - Intergenic
1062175452 9:135159605-135159627 ATTGAGGCACAGAAAGATGGGGG + Intergenic
1203428589 Un_GL000195v1:66601-66623 CTGTAGTCTCAGGAAGTTGGAGG - Intergenic
1203437696 Un_GL000195v1:156641-156663 CTGTAGTCTCAGGAAGTTGGAGG + Intergenic
1185783142 X:2866511-2866533 CTAGAGACTAGGAAAGGTGGGGG + Intronic
1185913671 X:4010375-4010397 CTGGAGACCCAGGAAGCTGGTGG + Intergenic
1185962466 X:4560176-4560198 ATGGAGACTCAGAGAGCTCGAGG - Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188181439 X:27060815-27060837 ATGGAGGCTCAGAAGGGTGGAGG - Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1188469845 X:30525850-30525872 CTGGAGACCCAAAAAGCTAGCGG + Intergenic
1188780209 X:34273961-34273983 TTGGACACTCAGAAAGGTGAGGG - Intergenic
1190770667 X:53511385-53511407 CAGGAAACTTACAAAGATGGCGG + Intergenic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192688908 X:73338488-73338510 CTAGAGACTGAGAAAGGTAGGGG + Intergenic
1192805720 X:74506691-74506713 GGAGAGACTCAGAAAGATGAGGG + Intronic
1192851881 X:74965498-74965520 GTGTAGAATGAGAAAGATGGAGG - Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193465984 X:81848383-81848405 ATAGAAAATCAGAAAGATGGTGG + Intergenic
1193525852 X:82587911-82587933 ATGGAGACTCAGACAGGTGGAGG - Intergenic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194874478 X:99169671-99169693 CTGGAGACTCAAAAGCAAGGAGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195616978 X:106920331-106920353 CTGGAGGCTGGGAAAGATTGAGG - Intronic
1195966715 X:110435596-110435618 TTGGAGACTCAGAAAGAAAGTGG - Intronic
1195969856 X:110461343-110461365 TTGGAGACTCAGAGAAATGTTGG + Intergenic
1196399048 X:115294660-115294682 TGGGAGACTGAGAGAGATGGTGG + Intronic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1196814493 X:119654158-119654180 GTGGAGACTCAGTGAGCTGGCGG - Intronic
1197142937 X:123136709-123136731 CTGGGGACTGGGAAAGGTGGAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197973612 X:132141207-132141229 CTGAGGACTCAGCAAGAAGGTGG + Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199777155 X:151022194-151022216 CTGGAGACCCAGAAAGCCAGTGG - Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200783327 Y:7236651-7236673 CTGGGGACCCAGAAAGTTAGAGG + Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic
1202281777 Y:23198351-23198373 CTGGTGGCTCCGCAAGATGGCGG - Intronic
1202284114 Y:23220168-23220190 CTGGTGGCTCCGCAAGATGGCGG + Intronic
1202433449 Y:24812736-24812758 CTGGTGGCTCCGCAAGATGGCGG - Intronic
1202435790 Y:24834554-24834576 CTGGTGGCTCCGCAAGATGGCGG + Intronic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic