ID: 1079188812

View in Genome Browser
Species Human (GRCh38)
Location 11:18260703-18260725
Sequence TAGTAAGACTGGAGAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079188812_1079188815 8 Left 1079188812 11:18260703-18260725 CCACCTTCTCTCCAGTCTTACTA No data
Right 1079188815 11:18260734-18260756 TGCACAAGTGATTTCCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079188812 Original CRISPR TAGTAAGACTGGAGAGAAGG TGG (reversed) Intergenic
No off target data available for this crispr