ID: 1079193386

View in Genome Browser
Species Human (GRCh38)
Location 11:18301694-18301716
Sequence CTCCTGCTCAACGATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079193386 Original CRISPR CTCCTGCTCAACGATGTGCC AGG Intronic
903293441 1:22329090-22329112 CTCCTGCCCACCCATGGGCCTGG + Intergenic
903767383 1:25743539-25743561 CTGCAGCTCAGCCATGTGCCAGG + Intronic
905867127 1:41382427-41382449 CTCCTGCTGGACGCTCTGCCGGG + Exonic
907556591 1:55349595-55349617 CTACTGCACAACACTGTGCCTGG - Intergenic
910761804 1:90740263-90740285 CTCCTTCTCCACGAGGTCCCTGG + Intergenic
912545883 1:110451143-110451165 CTCCCGCTCAGCCTTGTGCCTGG - Intergenic
915695849 1:157740317-157740339 CTCCTGCTCATCCATTTCCCAGG + Intergenic
918171335 1:182000431-182000453 CTCCTGCTCAGTGATGTGCTGGG - Intergenic
919643948 1:200073792-200073814 CTGCTGCTTAGCAATGTGCCTGG - Intronic
921583337 1:216921194-216921216 CTCCTGATGAAAGATGTGTCTGG - Intronic
1079193386 11:18301694-18301716 CTCCTGCTCAACGATGTGCCAGG + Intronic
1079493988 11:21020323-21020345 CCACTGCTCAACGCTGTGTCTGG - Intronic
1083255309 11:61491808-61491830 CTGCTGCTCAAGGCTGTGCTGGG - Intergenic
1092469900 12:8768188-8768210 TTCCTGCACAACTAAGTGCCTGG - Intronic
1097376721 12:58852089-58852111 TTCCTGCACAGCTATGTGCCCGG - Intergenic
1100863602 12:98832589-98832611 CCCCTGCTCAACCACCTGCCTGG + Intronic
1103836206 12:123823182-123823204 CTCCTGCCCAGCGCTCTGCCTGG - Intronic
1104831723 12:131757171-131757193 CTGCTGCTCCACGAGGTTCCTGG - Intronic
1105449313 13:20484651-20484673 TTCCTGCTGTACGATGTGCTCGG - Intronic
1106749947 13:32752431-32752453 CTTCTGATCATCTATGTGCCAGG + Intronic
1107409307 13:40143699-40143721 ATCCTGCTCTACCATGTGCCAGG - Intergenic
1114660462 14:24340225-24340247 TTCCTGCTCCACGACCTGCCAGG + Intergenic
1117185852 14:53240148-53240170 CTACTGCTCAACCAGTTGCCTGG - Intergenic
1124696571 15:31869341-31869363 CTCCTCCTCCAGGGTGTGCCCGG - Intronic
1126497785 15:49311805-49311827 CTTCTCCACAAAGATGTGCCTGG - Intronic
1129190921 15:73937172-73937194 CTCCTGCTCAATGCTGGGTCTGG - Intronic
1131049663 15:89338214-89338236 CTACTGCACAACTGTGTGCCAGG + Intergenic
1142204254 16:88775216-88775238 CTCCTGCTCCAGCCTGTGCCAGG - Intronic
1143253008 17:5536795-5536817 CTCCTGCTCAGCCCTGGGCCTGG + Intronic
1147308376 17:39579075-39579097 CTCCTCCTCACCCATCTGCCAGG + Intergenic
1152094835 17:78266979-78267001 CCCCTGCTCAAGGACCTGCCAGG - Intergenic
1156791539 18:40980822-40980844 CTGCTTCTCAACCAAGTGCCTGG + Intergenic
1160010565 18:75104554-75104576 CGCCTGCTCAACCCGGTGCCTGG + Intergenic
1160161105 18:76471673-76471695 CTCCCGTTCAGCGATGTGACAGG - Intronic
1162896048 19:13765126-13765148 TTCCTGCTCAGCGCCGTGCCTGG - Intronic
1163863305 19:19753713-19753735 CGCCTGCTCAGTGATGGGCCTGG - Intergenic
1166324697 19:42042105-42042127 CTCCAGGTCCATGATGTGCCAGG + Intronic
925230113 2:2225663-2225685 CTCCTGCTCCTCCATGAGCCGGG + Intronic
927254198 2:21025697-21025719 CTCGTGCTCAACAGTGAGCCTGG + Intronic
930291244 2:49495540-49495562 CTCCTGCTCAACGTAGTACTGGG + Intergenic
941737288 2:168992867-168992889 CTATTGCTCAACGATGTGTGAGG + Intronic
1172809396 20:37636682-37636704 CTCTTGCTCAATGAAGAGCCCGG - Intergenic
1174783322 20:53410340-53410362 ATTCTGCTCAGGGATGTGCCTGG - Intronic
1180184348 21:46132047-46132069 CACCTGCTCCACGAAGCGCCGGG - Exonic
1183093944 22:35541181-35541203 CTCCTGCTGAGCCAGGTGCCCGG - Exonic
1183423733 22:37726338-37726360 CTCCCGCTCCAAGTTGTGCCTGG - Exonic
950428240 3:12936125-12936147 CTCCTCCTCATCGATGTACAGGG + Exonic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
965077345 3:163995777-163995799 ATCCTCCTCAACGTTGTGTCGGG + Intergenic
965578532 3:170243628-170243650 CATCTGCCCAAGGATGTGCCTGG - Intronic
977115685 4:93023977-93023999 TTCCTGCTCAACAATGGGCTAGG - Intronic
978653232 4:111033581-111033603 CTCCTACTCAATAAAGTGCCTGG - Intergenic
985959328 5:3287803-3287825 CTCCTGCTCCAGGAGCTGCCTGG - Intergenic
986308805 5:6536040-6536062 CTTCTACTCAACAATCTGCCTGG + Intergenic
990991812 5:61692314-61692336 CTCCTACTCAACATTGTGCTGGG + Intronic
1001713198 5:173794342-173794364 CTCGGGCTCTACGATGGGCCAGG + Intergenic
1001713376 5:173795236-173795258 TTCCTGCTCCAGGATGTCCCCGG - Intergenic
1001976719 5:176006382-176006404 CTCCTGGTCAACCATGTGGCAGG + Intronic
1002240706 5:177837399-177837421 CTCCTGGTCAACCATGTGGCAGG - Intergenic
1007271075 6:40637477-40637499 GTCCTGCCCTACGTTGTGCCAGG - Intergenic
1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG + Intronic
1013582701 6:111551868-111551890 CTGCTGCTCGACGATGAGGCTGG + Intergenic
1019501660 7:1367911-1367933 CTCCTGCTCAAAGATGTTCAGGG - Intergenic
1021000939 7:15329348-15329370 CTCCTCATCACCTATGTGCCTGG - Intronic
1024464775 7:49700666-49700688 CTCCTGCTTAACGTGGAGCCAGG - Intergenic
1035818354 8:2564492-2564514 CTCCTGCTCAGGGACATGCCAGG - Intergenic
1047464702 8:125100990-125101012 CTCATGCTAAAGGAAGTGCCTGG + Intronic
1051699171 9:19801283-19801305 TTCCTGCACAGCTATGTGCCTGG - Intergenic
1059761983 9:117346599-117346621 TTTCTGCTAAACGATGTGTCAGG - Intronic
1190608215 X:52167026-52167048 CTGCTGCTCACCCCTGTGCCTGG + Intergenic
1193743128 X:85243012-85243034 CTCCTGGTCTACTATGAGCCAGG + Intergenic
1201417480 Y:13761794-13761816 TTCCTACTCAAAGATGTGACGGG - Intergenic