ID: 1079195584

View in Genome Browser
Species Human (GRCh38)
Location 11:18323526-18323548
Sequence CTGGGTCTTCAAATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 6, 3: 22, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079195584_1079195588 11 Left 1079195584 11:18323526-18323548 CCTTTGTCCATTTGAAGACCCAG 0: 1
1: 0
2: 6
3: 22
4: 263
Right 1079195588 11:18323560-18323582 AAAACAAAAAAAAAACTGAGTGG 0: 1
1: 3
2: 291
3: 4011
4: 28825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079195584 Original CRISPR CTGGGTCTTCAAATGGACAA AGG (reversed) Intronic
900829049 1:4950939-4950961 CTGGGTCTTCAATTTGGGAAAGG + Intergenic
901603472 1:10440853-10440875 CTGGGTCTTCACCTGAACAACGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902883549 1:19388941-19388963 CTGGGACTTGATATGGCCAACGG + Intronic
902977414 1:20098882-20098904 CTGGGTCTTCTACTGGCCAGAGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905122878 1:35695322-35695344 CTGGACCTTCAAATACACAAAGG + Intergenic
905638372 1:39571293-39571315 TTGGGTCTCGAAGTGGACAAAGG + Exonic
906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG + Intronic
907052636 1:51340023-51340045 CTGTGTCTTCACATGGAGGAAGG - Intronic
908076158 1:60521204-60521226 CTGTGTCTTCAGATGGTGAAAGG + Intergenic
908667224 1:66506895-66506917 CTGGGTCTTCTTTTGGAAAATGG - Intergenic
910084245 1:83380285-83380307 CTGTGTCTTCACATGGTGAAAGG + Intergenic
910832144 1:91471671-91471693 CTGAGTCCTCACATGGAAAAAGG - Intergenic
911374521 1:97035450-97035472 CAGAGTCTTCAGATGGTCAAAGG + Intergenic
914425146 1:147569135-147569157 ATGGGTGAACAAATGGACAAAGG + Intronic
916162759 1:161935392-161935414 CTGTGTCTTCAAATGGCAGAAGG - Intronic
916606901 1:166351926-166351948 GTGAGACTTCAAATGGAAAAGGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
920291402 1:204925824-204925846 GTGGGTCCTCAGATGGACAATGG + Intronic
920832429 1:209477701-209477723 CTTGGTCTTCAAAATTACAATGG + Intergenic
923083800 1:230686118-230686140 CTGAGTCTTCATCTGGAGAATGG + Intronic
923276198 1:232399067-232399089 TTGTGACTTCAAAGGGACAAGGG + Exonic
923741482 1:236658883-236658905 TTGGTTTTTCAAATGCACAAAGG - Intergenic
1065420007 10:25532639-25532661 CTGGCTCTTAAAATGGGGAATGG - Intronic
1069326659 10:67239250-67239272 CTGTGTCTTTAGATGGACATAGG - Intronic
1069440168 10:68421286-68421308 CTGGGTTTACAAATGGACAGAGG - Intronic
1072012302 10:91313286-91313308 CTTGGTCTGAAAATTGACAAAGG - Intergenic
1072036853 10:91570632-91570654 CTGTGTCTTCACAGGGAGAAAGG - Intergenic
1072067399 10:91884339-91884361 CAGGGTCTTTAAATGGGAAACGG - Intergenic
1072678092 10:97483775-97483797 GTGGGTCTACAGATGCACAAAGG + Intronic
1072767797 10:98109825-98109847 ATGAGTCTTGAAAGGGACAAGGG + Intergenic
1073141084 10:101248235-101248257 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1077805452 11:5587545-5587567 CTGTGTCTTCACATGGAGAAAGG + Intronic
1078175433 11:8965989-8966011 GTGGGTCTTCTACTGGACAAAGG + Intergenic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1079562564 11:21840786-21840808 CTGTGTCTTCACAGGGAGAAAGG - Intergenic
1080909713 11:36583367-36583389 CTGGGTCTTAAAAGGTAAAAAGG - Intronic
1081240384 11:40698521-40698543 CTTTATCTTCAAATGGAAAATGG + Intronic
1084779300 11:71398022-71398044 CAGGCTCTTCATATGTACAAAGG + Intergenic
1085903327 11:80728789-80728811 CAGGGTCTTCAATTGTAAAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087095257 11:94311995-94312017 CTTGGTCTCGAGATGGACAATGG - Intergenic
1089045083 11:115494462-115494484 CTGGGTCTTCTAATACAGAAAGG - Intronic
1089173549 11:116532748-116532770 CTGTGTCTTCAGATGGTGAAAGG - Intergenic
1090335510 11:125960533-125960555 CTGGGTTTTCAGGTGGAAAATGG - Exonic
1091893694 12:4083394-4083416 CTGCCCCTCCAAATGGACAAGGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094011254 12:25812493-25812515 CCTGGGCTTCAAATTGACAAGGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096590169 12:52652895-52652917 CTGGGTGTTCATGTAGACAAGGG - Intergenic
1096741484 12:53696941-53696963 CTGGATCTTGAAATGGAGGAGGG - Intergenic
1097714569 12:62953323-62953345 CTAGGTATTCAAATGGACCTGGG + Intergenic
1098414352 12:70215831-70215853 CTAGGTCTTCACATGGCAAAAGG + Intergenic
1099013883 12:77323242-77323264 CTGTGTCCTTACATGGACAAAGG - Intergenic
1100793136 12:98152483-98152505 ATGGGGGTTCAACTGGACAAAGG + Intergenic
1102005324 12:109586010-109586032 CTGTGTCTTCAGGTGGACCAAGG + Exonic
1102422765 12:112817140-112817162 CTGGATCTTCAAATGGAAGTTGG + Intronic
1103004470 12:117409787-117409809 CTTTGTCTGGAAATGGACAAGGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1105461224 13:20590077-20590099 CAGGGTTTACAAATGGAAAAAGG - Intronic
1105832576 13:24177433-24177455 CTGTGTCTTCATATGGTGAAGGG + Intronic
1105944123 13:25175342-25175364 GTGGGTCTTTAAAGGGATAATGG + Intergenic
1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG + Exonic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108679508 13:52767387-52767409 CTGTGTCTTCACATGGAAGAAGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1110223518 13:73096530-73096552 CAGGGTCGGCAAAGGGACAAGGG + Intergenic
1110975336 13:81826335-81826357 CAGTTGCTTCAAATGGACAAAGG + Intergenic
1111749790 13:92314564-92314586 CTGGGGCAGCAAATGGAAAAAGG + Intronic
1112195266 13:97219561-97219583 CTGTGTCTTCACATGGTAAAGGG + Intergenic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1114284445 14:21226923-21226945 CTGGGTCTTCATATGTAAATCGG - Intronic
1114888757 14:26889023-26889045 CTGGGTCCTCATATGGTGAAAGG + Intergenic
1115146913 14:30236948-30236970 CATGGTCCTCACATGGACAATGG - Intergenic
1118299959 14:64606438-64606460 CTGTGTCATCAAGTAGACAATGG + Intergenic
1118640160 14:67784781-67784803 CTGGGTGCTCAAATTCACAATGG + Intronic
1119993883 14:79230342-79230364 CTGTGTCTTTAAAGTGACAAGGG + Intronic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1120287312 14:82520342-82520364 CTGTGTCTTTAAATGGTGAAAGG - Intergenic
1120672823 14:87384032-87384054 CTGGGTTTTCAAATATAGAAAGG - Intergenic
1121970545 14:98351845-98351867 CTGTGTCTTCACATGGCCAAAGG - Intergenic
1122814382 14:104305247-104305269 CTGGGTCTCCAACTTGGCAACGG - Intergenic
1202921255 14_KI270723v1_random:32005-32027 CTGGATCTGCAAAGGGACTAGGG + Intergenic
1124220904 15:27848793-27848815 GTGGCTCTTCAACTCGACAAAGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1127703806 15:61527704-61527726 CTGTGTCCTCAAATTGACCATGG + Intergenic
1130799145 15:87243454-87243476 CTGAGTCTCCACATGGATAAGGG - Intergenic
1130864853 15:87924146-87924168 CTGTGTCTTCAACTGTAAAATGG - Intronic
1132562945 16:606724-606746 CTGGCTCTGCAGATGGGCAAGGG - Intronic
1135170890 16:20182436-20182458 CTGTTTCTTCAGATGTACAATGG - Intergenic
1135647038 16:24172204-24172226 CTGGGGCTCCAAATGGACAGTGG - Intronic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1137726136 16:50658027-50658049 CTGGGTTTTTAAATGGGCCAAGG + Intergenic
1138233084 16:55354184-55354206 CTGGGTTATCAAATTGACTATGG + Intergenic
1139774148 16:69303600-69303622 TTGGGGCTGCTAATGGACAAAGG - Exonic
1139970662 16:70772283-70772305 CAGGCTCTTCAAAAGGACCATGG + Intronic
1140154779 16:72412777-72412799 CAGGTTCATCAAATGGAAAATGG + Intergenic
1144827169 17:18111999-18112021 CAGGTTCTTCATCTGGACAATGG + Intronic
1146154958 17:30515496-30515518 CTAGGTCTTCTACTGGACTAGGG + Intronic
1146553628 17:33804067-33804089 CTGGGTGTTCAAATAGGGAAAGG - Intronic
1149179100 17:53912729-53912751 CTTGGTTCACAAATGGACAATGG + Intergenic
1150926715 17:69539998-69540020 CTGTGTCCTCAGATGGGCAAAGG + Intronic
1155432091 18:25770167-25770189 CTGGTCTTTCAAATGGCCAAAGG - Intergenic
1156256248 18:35399505-35399527 CAGGGTCTTTAAATGGAAGAGGG + Intergenic
1156770165 18:40710888-40710910 CTTTGTTTTCAAATGGAAAAAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157714954 18:49878163-49878185 CTTGCTCTTGAAATGCACAAAGG + Intronic
1158269476 18:55697305-55697327 CTTGGCCTTCAGATGGACAATGG + Intergenic
1158759706 18:60370008-60370030 CAGGGTCTTCAAATGCTCATGGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159214187 18:65368178-65368200 ATGGGTCTTCAAATGGGCTCAGG + Intergenic
1159715975 18:71823752-71823774 CTGTGTCTTCAAATGGTCCAAGG - Intergenic
1159996204 18:74967796-74967818 CTGTTTCTTAAAATTGACAATGG + Intronic
1160053804 18:75461115-75461137 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1161592928 19:5136832-5136854 CTGGGTCTGGAAATGGGGAAAGG - Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1165272256 19:34720716-34720738 CAGGTTCTTCACATGGACACAGG - Intergenic
1165876291 19:39009617-39009639 CTCAGTTTTCAAATGGGCAAAGG - Intronic
1168254610 19:55158542-55158564 CTGGGTTTCCAAGTGGACGAGGG - Intronic
925199432 2:1954318-1954340 CTGGGGCGTCAAATGGGCAGTGG - Intronic
927585013 2:24294904-24294926 CTGCGTCTTCACATGCAGAAAGG - Intronic
927712236 2:25333014-25333036 CTGGGTCCCCACATGGACAGGGG + Intronic
928454201 2:31404564-31404586 CTGGGCCTTCAAAACTACAATGG + Intronic
928995339 2:37283683-37283705 CTGAGTTTTCAAAGGGAAAATGG - Intronic
929023739 2:37579067-37579089 CTGGGTCTTCACATGGCAAAAGG + Intergenic
930444585 2:51453771-51453793 GTAGTTCTTGAAATGGACAATGG + Intergenic
931243483 2:60473338-60473360 CTGGGTCTTCAAAAAGAGAATGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
935038051 2:99398106-99398128 CTGGTTCTTGTAATGGGCAATGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935825826 2:106948265-106948287 CTGAGTCCTCAAATGGTGAAAGG + Intergenic
936369091 2:111888007-111888029 CTGGTTCTTCAAACAAACAATGG + Intergenic
937554302 2:123134157-123134179 CTGTGTCTTCACATGGTGAAAGG + Intergenic
940180997 2:150932660-150932682 CTCAGACTTCAAATGGAAAAAGG - Intergenic
942779361 2:179623094-179623116 CTGGATCTTCAAACTGGCAATGG + Intronic
942814945 2:180042032-180042054 CTGGGTCCTCACATGGAAGAAGG - Intergenic
943160871 2:184248796-184248818 CTGGGTCTTCGAATAGTAAAAGG - Intergenic
943551497 2:189345712-189345734 CTGGTTGTTCAAATAGAGAAGGG + Intergenic
943623401 2:190174382-190174404 AGGGGTATTCATATGGACAAGGG - Intronic
944083203 2:195813378-195813400 CTGGGTCATAAAACTGACAAAGG - Intronic
945195486 2:207233526-207233548 CTGTGTCTTCACATGGCAAAAGG - Intergenic
945244003 2:207701586-207701608 CTGGTTCTTCAACTGTAAAATGG + Intergenic
946666692 2:222057911-222057933 CTGGGTCATAAATAGGACAAGGG + Intergenic
946965689 2:225035075-225035097 CTGAGTCTTCAAAGAGAGAAGGG + Intronic
948281544 2:236751088-236751110 CTGTGTCTTCAAATGGTAGAAGG + Intergenic
948397196 2:237654176-237654198 CCTGGTTTTAAAATGGACAAAGG + Intronic
948704605 2:239781100-239781122 CTGTGTCCTCAAATGGTCAAGGG + Intronic
1170300540 20:14879854-14879876 CTGGGTTTCCAAATGGACAGAGG + Intronic
1175553858 20:59833935-59833957 CTGGGTCTTCGAGTGGAACAAGG + Intronic
1175747588 20:61469381-61469403 CTGGTTTTTTAAATGGGCAAAGG - Intronic
1177440134 21:21111831-21111853 CTAGGAGCTCAAATGGACAAGGG + Intronic
1177478433 21:21653929-21653951 CTGGTTCCTCAAATCAACAAGGG - Intergenic
1177796807 21:25787778-25787800 CTGGGTCTTCATATGGTTAAAGG + Intergenic
1181081820 22:20420586-20420608 CGGGGTCTTAGAATGGACAAGGG + Intergenic
950274090 3:11643603-11643625 CTGGCTCTTCAACTTCACAAAGG + Exonic
952501247 3:33964216-33964238 CTGGTTCTCTAACTGGACAAGGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG + Intergenic
956766574 3:72489299-72489321 CTGTGTCTTCATCTGGAAAATGG - Intergenic
957080264 3:75630964-75630986 CTGGCTCTGCAAAGGGACTAGGG - Intergenic
958091387 3:88881108-88881130 CTGTGTGTTCAAATGGATATTGG - Intergenic
959483064 3:106896956-106896978 CTGAGGCTTCAAATCCACAATGG + Intergenic
960309113 3:116098664-116098686 CTTTGTCTTCCAAAGGACAATGG + Intronic
960638690 3:119808011-119808033 CTGGGCATTCAAATGGAAAAGGG + Intronic
960694256 3:120380550-120380572 CTGGGCCTTGAAGTGGGCAAGGG + Intergenic
961689227 3:128656416-128656438 CTGGGTGTTCATATGGAAGAAGG + Intronic
962016653 3:131447932-131447954 ATGTGTCTTCACATGGAAAAAGG + Intergenic
962620999 3:137178830-137178852 CTGTGTCCTCACATGGCCAAAGG + Intergenic
963749081 3:149156390-149156412 CTGGGTCTTGAACTGGAGAAGGG - Intronic
963872256 3:150430039-150430061 CTTGGTCTTAATATGGAAAATGG + Intronic
967226147 3:187293255-187293277 CTGTGTCTTCATTTGGAAAATGG + Intergenic
967260698 3:187638921-187638943 CTGTGTCTTCACATGGCAAAAGG + Intergenic
967815375 3:193794030-193794052 CTGGGTCTTCAACTGGAAAATGG - Intergenic
970076657 4:12229601-12229623 CTGTGTCTTCATATGGTCAGAGG - Intergenic
970471350 4:16382238-16382260 CTGTGTCTTCACATGGCAAATGG - Intergenic
971201774 4:24515865-24515887 CTGGGCCTTTAAAGGGACACAGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971683460 4:29732617-29732639 CTGTGTCTTCACATGTAGAAGGG - Intergenic
972236044 4:37135343-37135365 CTGTGTCTTTACATAGACAAGGG - Intergenic
972992201 4:44834530-44834552 CTGTGTCTTCACATAGAAAAAGG + Intergenic
975224218 4:71851703-71851725 CTGTGTCTTCACATAGACGAAGG + Intergenic
976224891 4:82788096-82788118 CTGTGTCTTCACATGGCAAAAGG - Intronic
976851771 4:89555784-89555806 CTGGATTTTAAAATGGGCAAAGG - Intergenic
977603765 4:98961474-98961496 CTGTGTCTTCACATGGAGGAAGG - Intergenic
978707105 4:111726639-111726661 CAGTCTCTTCAAATTGACAATGG + Intergenic
979862850 4:125715912-125715934 CTGTGTCTTCACATGGTGAAGGG - Intergenic
981358840 4:143824276-143824298 AGGTGTCTTCAAAGGGACAACGG - Intergenic
981621417 4:146703936-146703958 CTTGGTATGCAAAAGGACAAAGG - Intergenic
981628111 4:146784592-146784614 CTGTGTCCTCACATGGTCAAAGG - Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982572545 4:157068495-157068517 CTGTGTCTTCACATGGAGGAAGG + Intergenic
982597489 4:157404731-157404753 GTAGGACTTCAAATTGACAAGGG - Intergenic
984289728 4:177780663-177780685 CTGTGTCTTCACATGGTGAAGGG + Intronic
985924687 5:3006610-3006632 CTGGTCCTTCAAAAGGACCATGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986848633 5:11784233-11784255 CATGGAATTCAAATGGACAATGG + Intronic
988326538 5:29776005-29776027 CTGAGTCTTCATATGTAAAATGG + Intergenic
991453286 5:66775658-66775680 ATGGTTCTTCAAAAGAACAATGG + Intronic
993816031 5:92546626-92546648 AAGGGTAGTCAAATGGACAATGG - Intergenic
997029790 5:130113623-130113645 CTGGGCCTTGTAATAGACAAAGG - Intronic
997957003 5:138286553-138286575 CTGGGTGTCCAAAGGGACGATGG + Exonic
998618078 5:143762750-143762772 GTGTGTGTTCAAGTGGACAATGG - Intergenic
998641744 5:144019656-144019678 CTTGCTCTTCAAATGTACAAAGG - Intergenic
998738075 5:145165959-145165981 CTGGGACCTCAAAAGTACAATGG - Intergenic
999816141 5:155178250-155178272 CTGTGTCTTCACATGGTGAAAGG - Intergenic
1003139715 6:3460251-3460273 ATGGGGCATCAAAAGGACAATGG - Intergenic
1004050747 6:12076540-12076562 CTGTGTCTTCACATGGAGGAAGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004977152 6:20980901-20980923 CTGAGTCTTCAAATGGGCAAAGG - Intronic
1005163963 6:22897805-22897827 ATGGATCTTAAAATGGACAGGGG + Intergenic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1005843366 6:29759111-29759133 CAGGGTCTTCCAAGAGACAAGGG - Intergenic
1006866575 6:37213607-37213629 CTGGGCCTTCACCTGCACAATGG - Intronic
1008011245 6:46469877-46469899 CTGTGTCCTCACATGGCCAAAGG - Intronic
1008402474 6:51079600-51079622 CTGTTTCTTCATATGGAAAAGGG + Intergenic
1010403670 6:75477875-75477897 AGGGGGCTACAAATGGACAATGG + Intronic
1011126504 6:84013446-84013468 GTGGCTCTCCAAATGAACAAAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014220539 6:118794713-118794735 CTGCCTCTTCATATGGAGAAAGG - Intergenic
1015675444 6:135741802-135741824 CTGGGACTTTAAATGCTCAAAGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1018162101 6:161054896-161054918 CTGGGTCCACAAATGGATATGGG - Intronic
1018234900 6:161714419-161714441 CTGTGTCTTCACATGGCAAAAGG - Intronic
1021518727 7:21517018-21517040 CTGTGTCTTCACATGGTGAAAGG + Intergenic
1023512232 7:40965796-40965818 CTTTGTTTTAAAATGGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026365748 7:69646702-69646724 CTGGGTCTACAAAAGGAGAGAGG - Intronic
1026821589 7:73553247-73553269 AAGGGTCTTTAAATGGACACAGG - Intronic
1027301070 7:76836413-76836435 CTGTGTCTTCACATGGTGAAAGG + Intergenic
1028603349 7:92627467-92627489 CTGTGTCTTCATATGGTGAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029972900 7:104806756-104806778 CTGGGTCATGAAATGATCAAAGG + Intronic
1030065344 7:105655182-105655204 CTGGGTTTTCAGATGAGCAAAGG - Intronic
1030507908 7:110447552-110447574 CTGGGGCTTCAAATGCCCTAGGG + Intergenic
1030941212 7:115651627-115651649 CTGTGTCTCCAAATGGCAAAGGG - Intergenic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1032499972 7:132392914-132392936 CTGGGTGCTCAGATGGACACAGG - Intronic
1032949165 7:136887852-136887874 CTGTTTCTTCAAATGTAAAATGG - Intronic
1033540929 7:142355379-142355401 CTGGGTCTTCGAGTGGACAAAGG - Intergenic
1033552145 7:142457320-142457342 CTGGGTCTTGGAATGGACAAAGG - Intergenic
1033554417 7:142476262-142476284 CTGGATCTTGGAATGGACAAAGG - Intergenic
1033556690 7:142494363-142494385 CTGAATCTTGGAATGGACAAAGG - Intergenic
1033559049 7:142513819-142513841 CTGGGTCTTGGAATGGACAACGG - Intergenic
1035030996 7:155860552-155860574 CTGGGTCATCAAATGGTAACCGG + Intergenic
1038165613 8:25082584-25082606 CTGTGTCTTCACATGGTGAAAGG - Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038701561 8:29854271-29854293 CTTGGAATTCAAATGGACTAGGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1041159801 8:55027997-55028019 CTGTGTCTTCCAATGGAGGAAGG - Intergenic
1041721049 8:60975591-60975613 CTGGAGCTTCAAAGGGACCATGG + Intergenic
1041860034 8:62502846-62502868 CTTTGTCTTCAGATGGACCAGGG + Intronic
1042058776 8:64794553-64794575 CTGTGTCCTCACATGGACAAAGG + Intronic
1042102068 8:65284569-65284591 CAGCGTGTTCAAATGCACAAAGG - Intergenic
1042796910 8:72674072-72674094 CTGGCTCTTCCAATAGAGAAGGG - Intronic
1043530382 8:81143454-81143476 CTGGATCTTCACATGGTGAAAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044728255 8:95210051-95210073 CTGGGTCTTCTGAGGGACACAGG + Intergenic
1046601670 8:116324430-116324452 CTGTTTCTCCAAATGGAAAATGG - Intergenic
1047298764 8:123594701-123594723 CTGGGTCTTCAAAGGAATGATGG - Intergenic
1047874160 8:129116709-129116731 CTGGGTCTCTAAATGGAAGATGG + Intergenic
1048423293 8:134298274-134298296 CTGGGTCTTAAAATAGCCAGTGG - Intergenic
1055755823 9:79556469-79556491 CCGCCTCTTCAAATGGACACAGG - Intergenic
1056735176 9:89203312-89203334 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1057041411 9:91850518-91850540 CTGGCTCTGAAGATGGACAAGGG + Intronic
1057452148 9:95174245-95174267 CTGTGTCTTCACATGGTGAAAGG + Intronic
1058186697 9:101863784-101863806 CTGGCTCTTGAAAGGGAGAAAGG + Intergenic
1058706819 9:107644455-107644477 CAGATTCTTCAAGTGGACAATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1185848411 X:3462382-3462404 CTGTGTCTTCAAATGGTGGAAGG + Intergenic
1185951744 X:4445119-4445141 AAGGGTCTTAAAATGAACAATGG - Intergenic
1186083698 X:5962785-5962807 CTGTGTCCTCACATGGAAAAAGG - Intronic
1186387188 X:9121759-9121781 CTGTGTCTTCACATGGAGGAAGG - Intronic
1187614589 X:20979661-20979683 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1189234204 X:39475294-39475316 CTGGGTCCTGAAATGGGCTATGG - Intergenic
1189317212 X:40064552-40064574 CTGGGGCTTCAAAGGGATCACGG + Exonic
1189601692 X:42633530-42633552 CTGCGTCCTCACATGGCCAAAGG - Intergenic
1191250465 X:58257738-58257760 CTGGGTCTTCTCATGGATGATGG + Intergenic
1194047374 X:89024845-89024867 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1195961801 X:110394771-110394793 CTGCCTCTTCAACTGGAAAATGG + Intronic
1196201250 X:112888028-112888050 CTGGGTTTTAAAATGGATATTGG - Intergenic
1196577203 X:117333157-117333179 CTGTGTCTTCACATGGTAAAAGG - Intergenic
1199424879 X:147689674-147689696 CTGTGTGTTCACATGGTCAAAGG - Intergenic
1199519699 X:148721767-148721789 TAGGGGCTTCAAATGGACCATGG - Intronic
1200815214 Y:7524423-7524445 CTGTGTCTTCAAATGGTAGAAGG - Intergenic
1200948690 Y:8870664-8870686 CTGGGTCTTTATTTGGAAAATGG + Intergenic