ID: 1079209639

View in Genome Browser
Species Human (GRCh38)
Location 11:18449767-18449789
Sequence GGGCTCTACTCAGGAGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079209639_1079209649 20 Left 1079209639 11:18449767-18449789 CCTTGTGCTCCTGAGTAGAGCCC 0: 1
1: 0
2: 2
3: 11
4: 132
Right 1079209649 11:18449810-18449832 AATGGCTGAATAGTGCCCATGGG 0: 1
1: 0
2: 1
3: 5
4: 129
1079209639_1079209648 19 Left 1079209639 11:18449767-18449789 CCTTGTGCTCCTGAGTAGAGCCC 0: 1
1: 0
2: 2
3: 11
4: 132
Right 1079209648 11:18449809-18449831 GAATGGCTGAATAGTGCCCATGG 0: 1
1: 0
2: 0
3: 7
4: 106
1079209639_1079209643 -6 Left 1079209639 11:18449767-18449789 CCTTGTGCTCCTGAGTAGAGCCC 0: 1
1: 0
2: 2
3: 11
4: 132
Right 1079209643 11:18449784-18449806 GAGCCCCAGAGATGGTGAGAGGG 0: 1
1: 0
2: 5
3: 36
4: 362
1079209639_1079209642 -7 Left 1079209639 11:18449767-18449789 CCTTGTGCTCCTGAGTAGAGCCC 0: 1
1: 0
2: 2
3: 11
4: 132
Right 1079209642 11:18449783-18449805 AGAGCCCCAGAGATGGTGAGAGG 0: 1
1: 0
2: 5
3: 49
4: 462
1079209639_1079209647 2 Left 1079209639 11:18449767-18449789 CCTTGTGCTCCTGAGTAGAGCCC 0: 1
1: 0
2: 2
3: 11
4: 132
Right 1079209647 11:18449792-18449814 GAGATGGTGAGAGGGAAGAATGG 0: 1
1: 2
2: 19
3: 267
4: 2488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079209639 Original CRISPR GGGCTCTACTCAGGAGCACA AGG (reversed) Intronic
900625739 1:3607815-3607837 CGGCTCTGCTCGGGAGCAGATGG - Intronic
907470514 1:54670716-54670738 GGGCTGAGCTGAGGAGCACAGGG - Intronic
907642157 1:56201824-56201846 GGGTTCTCCTCACGAGCACCTGG - Intergenic
912433022 1:109639569-109639591 GGGCTCTGCTCAAGTGCACATGG - Intergenic
913549583 1:119904205-119904227 GGGCTATACTCAGGAAAAGAAGG + Intergenic
917186967 1:172368171-172368193 GTGCTCTTCTCATTAGCACATGG + Intronic
917566274 1:176215409-176215431 GGGCTCTGTTCAGAACCACATGG - Intergenic
921467025 1:215501148-215501170 GTGCTTTACTCAAGATCACAGGG + Intergenic
1067566779 10:47345288-47345310 GGGCTCTGCAAGGGAGCACAAGG - Intergenic
1068385267 10:56317894-56317916 GGGCTTTCCTCAGGCCCACATGG - Intergenic
1069133343 10:64732820-64732842 GAATTCTACTGAGGAGCACAAGG - Intergenic
1073480047 10:103780612-103780634 GGGTTCCACTCAGCAACACAGGG - Intronic
1079136571 11:17779002-17779024 GGGCTCTGGTCAGCAGCAGAGGG + Intronic
1079209639 11:18449767-18449789 GGGCTCTACTCAGGAGCACAAGG - Intronic
1079694082 11:23456828-23456850 AGGCTCTACTCAAGAGAAGATGG - Intergenic
1080298813 11:30760730-30760752 GGGCTCTACTCAGATTAACATGG + Intergenic
1080420903 11:32109693-32109715 GGTATCTGCTCAGGAGCAAAAGG + Intergenic
1082888565 11:58113927-58113949 AAGCTCTTCACAGGAGCACAAGG - Intronic
1083455496 11:62776123-62776145 GGGCTGTTGTGAGGAGCACATGG - Intronic
1084173014 11:67409661-67409683 GGGCCCGAGTCAGGAGCCCATGG - Exonic
1084218385 11:67663789-67663811 GGGCTCTAGTCATGAGAAGAGGG + Intronic
1084788757 11:71459790-71459812 GGCCTCTTCTAAGCAGCACATGG + Intronic
1089614634 11:119688358-119688380 GGGGTCTGCTCAGGATCACAGGG - Intronic
1092205300 12:6611172-6611194 GTGCTCTGCTCAGGAGCAGGGGG - Intergenic
1103613368 12:122137501-122137523 GGGCTCTGCTCCGATGCACACGG - Exonic
1108571193 13:51753160-51753182 GTGCTCTGAGCAGGAGCACATGG + Intronic
1112324935 13:98437820-98437842 GGCCTCCTCTCTGGAGCACATGG - Exonic
1113563540 13:111303182-111303204 GGGGTGCACTCAGGACCACAGGG + Intronic
1114793525 14:25685757-25685779 GGGCCCTTCTCAGCAGCTCAGGG - Intergenic
1116967018 14:51025523-51025545 AGAAACTACTCAGGAGCACAGGG - Intronic
1122871486 14:104640916-104640938 GGGGTCAACTCAGGAGCCAATGG - Intergenic
1125423669 15:39529110-39529132 GGGCTCTGCACAGGAACCCAGGG + Intergenic
1130749540 15:86696027-86696049 GCATTCTACTCATGAGCACATGG - Intronic
1133177543 16:4026645-4026667 GGGCACTACTCAGCATCACAAGG + Intronic
1134239696 16:12496434-12496456 GGGCCCTTCGCTGGAGCACATGG + Intronic
1134322052 16:13172969-13172991 GGTCTTTACTTGGGAGCACACGG - Intronic
1134383344 16:13748319-13748341 TGGTTCTAATCAGAAGCACAAGG - Intergenic
1141427504 16:83953482-83953504 GGCCTCCACTCAGGACCACCCGG - Intronic
1142167310 16:88599139-88599161 TGGCACTGCCCAGGAGCACAGGG + Intronic
1143042718 17:4051093-4051115 TGGCTCCAAACAGGAGCACAGGG + Intronic
1143894627 17:10126664-10126686 GGGCACTTCTCAGGAGCAGGAGG - Intronic
1145217494 17:21062920-21062942 GGGTTCTAATCAGGAGTAAATGG + Intergenic
1148471947 17:47899815-47899837 GAGCTCTGCTCAGGAGCAAGAGG + Intronic
1151122255 17:71806317-71806339 GTGCTCTACTCAGGCTCTCAAGG + Intergenic
1152580232 17:81162550-81162572 GGGCTGGACTCAGGGGCTCAAGG - Intronic
1154045070 18:10896665-10896687 GTTGTCTACTCAGTAGCACAGGG - Intronic
1155542397 18:26882066-26882088 TGGCTTTACTCTGCAGCACAAGG - Intergenic
1159948812 18:74463870-74463892 GGGTTCTTCTCAGCAGCAGACGG + Intergenic
1159970615 18:74647851-74647873 GAGCTCTGCTGAGGAGCAGAAGG + Intronic
1164605514 19:29595215-29595237 AGGCTGTTCTCTGGAGCACAAGG + Intergenic
1166438084 19:42786434-42786456 TTGCTCTACTCAGTATCACAAGG - Intronic
1166694692 19:44846062-44846084 GGGAACTACTCGGGAGCAGAGGG + Intergenic
925092919 2:1169501-1169523 GGGCTCTAGGCAGGGGCTCACGG - Intronic
926084112 2:10010292-10010314 TGGCCCTGCTCAGGGGCACAAGG - Intergenic
926698171 2:15785028-15785050 GGTGTCTGCTCAGGGGCACAGGG + Intergenic
927766163 2:25810446-25810468 GGACTGTGCTCAGGAGCACGTGG - Intronic
927850320 2:26494685-26494707 GGGGTCTGCCCAGGAGCACCCGG + Intronic
928181316 2:29070961-29070983 GTCCCCTTCTCAGGAGCACAAGG - Exonic
930630843 2:53753427-53753449 GGACTCTACTCCAGAACACATGG - Intronic
934985896 2:98884297-98884319 GGGCTCAACACAGAAGGACAGGG + Intronic
935258154 2:101330894-101330916 TAGCTTTACACAGGAGCACAGGG - Intergenic
936976120 2:118224256-118224278 CGGCTCTGCTCAGGCGCCCACGG - Intergenic
947203828 2:227642186-227642208 GTGATCTTCTCAGGAGCAGATGG - Intergenic
948440401 2:237983536-237983558 GGGCTCTACTCTGAGGCTCAGGG - Intronic
948641150 2:239376684-239376706 AGGCTGTATTCAGGAACACACGG - Intronic
948865029 2:240770877-240770899 GGGCTGTACCCAGGAGGGCAGGG + Intronic
949063808 2:241976957-241976979 GGGCTCTACCAAGGAGCACAAGG - Intergenic
1169393400 20:5208749-5208771 GGGTGCTGCTCTGGAGCACAAGG - Intergenic
1170423307 20:16213872-16213894 GGGCTCTATTCTGCAGCACTAGG + Intergenic
1171420378 20:25013764-25013786 GGGCCCTCCTCAGGGGCAGAGGG - Intronic
1171785146 20:29457198-29457220 GGGGTTCACTCTGGAGCACAGGG + Intergenic
1172222469 20:33283320-33283342 GGGGTCAGGTCAGGAGCACAGGG + Intronic
1174416004 20:50367730-50367752 TGCATCTACTCAGGAGCTCAGGG - Intergenic
1174593602 20:51666328-51666350 GGGCCAGAGTCAGGAGCACAAGG - Intronic
1175178995 20:57131701-57131723 GGCCTCTCCTGAGGAGCACCAGG - Intergenic
1175282886 20:57816104-57816126 GGGCTCTGCTCATTGGCACAAGG + Intergenic
1176385961 21:6138654-6138676 GGCCTCCAGTGAGGAGCACAGGG + Intergenic
1179481131 21:41679332-41679354 GGGCTCTTCTCAGATGCACAGGG + Intergenic
1179583527 21:42360439-42360461 GGGCTCAAATCAGTAGCTCAGGG + Intergenic
1179586664 21:42377738-42377760 GGGCTGCTCTGAGGAGCACATGG + Intronic
1179737512 21:43399598-43399620 GGCCTCCAGTGAGGAGCACAGGG - Intergenic
1179820989 21:43936740-43936762 TGGCTCCACTCAGAAGCACTAGG - Intronic
1180140094 21:45888047-45888069 GGTCTCTCCTCAGGAGCACTGGG + Intronic
1180988217 22:19917936-19917958 AGGCTCTGCTCAGCAGCAAAGGG + Intronic
1183338720 22:37266284-37266306 GGGTTGTACTGAGGAGCACTTGG + Intergenic
1183405694 22:37629618-37629640 GGGCTCTACTCAAGAGCCCAGGG + Intronic
1184430580 22:44439730-44439752 GGGCTCTGTGCAGGTGCACAGGG - Intergenic
949642145 3:6048657-6048679 GGATTCTTCTCAGCAGCACATGG + Intergenic
952170538 3:30801887-30801909 TGGCTCCACTGAGGAGCATAAGG - Intronic
952729645 3:36625471-36625493 AGGCTTTTCTCAGGATCACAGGG - Intergenic
955073328 3:55589849-55589871 GGGCTGCACTGAGGAGCACATGG + Intronic
956744346 3:72299760-72299782 GGGCTGCACTGAGGAGCACTCGG - Intergenic
962025593 3:131543976-131543998 GTGCTGTACTCAGCAGCACAGGG + Intronic
963708300 3:148716173-148716195 GAGCTCTGCCCAGGAGGACAAGG - Intronic
966450666 3:180057013-180057035 ATCCTCTACACAGGAGCACATGG - Intergenic
966515893 3:180820819-180820841 GGGCCCCAGTCAGCAGCACAGGG - Intronic
967077215 3:186014192-186014214 TGGTTCTACACAGGAGAACAGGG + Intergenic
967464996 3:189794750-189794772 GAGCTCTACTAGAGAGCACAGGG + Intronic
967489271 3:190070546-190070568 GTGCTGTAATCAAGAGCACACGG + Intronic
968694357 4:2015187-2015209 AGGCTCCTCTGAGGAGCACAGGG - Intronic
969289446 4:6229352-6229374 GGGCTCTACTCAGCATCCCAAGG + Intergenic
969337705 4:6521512-6521534 GGGCTCCTCTCTGGAGCACTGGG - Intronic
972019382 4:34290960-34290982 AGGCTCTTGGCAGGAGCACAAGG + Intergenic
973695541 4:53486833-53486855 GAGCTATACACTGGAGCACATGG + Intronic
973695570 4:53487185-53487207 GAGCTGTACACTGGAGCACAGGG + Intronic
999448726 5:151662782-151662804 GGGCTCTTCTCAGGGGCTCTAGG - Exonic
999843387 5:155452687-155452709 ACCCTCTACTCAGGAGCACAGGG + Intergenic
1001808311 5:174608195-174608217 GGGCTCTAATGACCAGCACAGGG - Intergenic
1001961370 5:175882131-175882153 GGGCTGGACACAGGGGCACAAGG - Exonic
1004278715 6:14260548-14260570 AGACTCTACTCAGGATCAAAAGG + Intergenic
1006500008 6:34452373-34452395 GGGATATACTAAGAAGCACAGGG - Intergenic
1006574128 6:35031509-35031531 GGGTTCTGGTCAAGAGCACAAGG - Intronic
1006974934 6:38091011-38091033 GGGCTTTACTCAGGAGAAGCAGG + Intronic
1010128609 6:72464973-72464995 TGGCTCTACTTAAAAGCACATGG + Intergenic
1012232721 6:96779158-96779180 GGCCTCTTCTGAGGACCACAGGG + Intergenic
1012926445 6:105272918-105272940 TTGCTCTGCTCAGGAGCTCAGGG - Intergenic
1013372474 6:109483003-109483025 GGGCCCGACTGGGGAGCACACGG + Intronic
1016854941 6:148658032-148658054 GGGCTTCACTCAGGAGCAATCGG + Intergenic
1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG + Intergenic
1019829413 7:3311848-3311870 GGGCGTTAATCAGGAGCTCAAGG + Intronic
1025254592 7:57375010-57375032 TGCCTCTACTCAGGAGCTCAGGG + Intergenic
1027245915 7:76367289-76367311 GGGCTCTTCTCTAGAGAACATGG - Intergenic
1035429373 7:158806536-158806558 AGCTTCTACTCAGGAGAACAGGG + Intronic
1037354752 8:18006250-18006272 GGATTTTTCTCAGGAGCACATGG + Exonic
1037514723 8:19619110-19619132 GGGCACTACAGAGGAGCAAAGGG + Intronic
1038227242 8:25668790-25668812 TGCCTCTACCCAGGAGCCCAGGG + Intergenic
1040425311 8:47279317-47279339 GGAATCCACTCAGCAGCACAGGG - Intronic
1042607405 8:70559288-70559310 CGACTCTACTCTGGAGCAGATGG - Intergenic
1044883396 8:96747602-96747624 GGGCACTACTTAGGAGCCAAAGG + Intronic
1045017318 8:98010709-98010731 GGGCTGGACTCAGGAGTCCAAGG + Intronic
1048263787 8:132967577-132967599 TGCCTTTATTCAGGAGCACACGG + Intronic
1049255351 8:141610760-141610782 GGGCTCTGCTCAGGGTCCCATGG - Intergenic
1050746609 9:8883675-8883697 GGGGTCTCTTCAGAAGCACAGGG - Intronic
1059382013 9:113934158-113934180 GGGCCCAACTCACGGGCACACGG + Intronic
1061597885 9:131644112-131644134 GGGCTTCTCTCAGGAGCAGAGGG - Intronic
1062243100 9:135550190-135550212 GGGCTCTGGGCAGGAGCACTTGG + Intergenic
1062622154 9:137427998-137428020 GGGGTCCCCTCAGCAGCACAGGG - Intronic
1203445932 Un_GL000219v1:56430-56452 GGGGTTCACTCTGGAGCACAGGG + Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1192413248 X:70953716-70953738 AGGCTCTACTCAGGTGCAGCAGG + Intergenic
1192632924 X:72790898-72790920 GGGCCCACCTCAGGAGAACACGG + Intronic
1192648785 X:72929903-72929925 GGGCCCACCTCAGGAGAACACGG - Intronic
1194888453 X:99348337-99348359 GGGTGCTTCTCAGGAGAACACGG + Intergenic
1197144499 X:123156495-123156517 GGGCCCTAGTCAGGAGCACCAGG - Intergenic
1199711202 X:150470783-150470805 GGGAGCTTCTCAGGAGCATAGGG - Exonic
1199979541 X:152913377-152913399 GGGCCCTTCTCCGGAGCAAATGG + Intergenic