ID: 1079209770

View in Genome Browser
Species Human (GRCh38)
Location 11:18450449-18450471
Sequence GAGCATCTATAGGCTCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079209765_1079209770 -7 Left 1079209765 11:18450433-18450455 CCCACCGGGCATGTAAGAGCATC 0: 2
1: 0
2: 0
3: 2
4: 62
Right 1079209770 11:18450449-18450471 GAGCATCTATAGGCTCCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 110
1079209764_1079209770 -6 Left 1079209764 11:18450432-18450454 CCCCACCGGGCATGTAAGAGCAT 0: 2
1: 0
2: 0
3: 7
4: 63
Right 1079209770 11:18450449-18450471 GAGCATCTATAGGCTCCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 110
1079209766_1079209770 -8 Left 1079209766 11:18450434-18450456 CCACCGGGCATGTAAGAGCATCT 0: 2
1: 0
2: 0
3: 4
4: 60
Right 1079209770 11:18450449-18450471 GAGCATCTATAGGCTCCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 110
1079209759_1079209770 23 Left 1079209759 11:18450403-18450425 CCATTGCAGCTGGTGATGAGAGG 0: 1
1: 0
2: 4
3: 24
4: 216
Right 1079209770 11:18450449-18450471 GAGCATCTATAGGCTCCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079209770 Original CRISPR GAGCATCTATAGGCTCCACT GGG Intronic
902958076 1:19940484-19940506 GAGCATCTCCAGGCAACACTTGG - Intergenic
905031979 1:34890720-34890742 CAGCATCTCAAGGCTTCACTGGG - Intronic
916289861 1:163153275-163153297 CAGAATCTATAAGCTCCATTAGG - Intronic
918269839 1:182887330-182887352 GATCCTCTGTAGCCTCCACTAGG - Exonic
918413356 1:184283484-184283506 AAGAATCTATAAGCTCCAGTGGG + Intergenic
1064118137 10:12596304-12596326 GGGCTTCTATAGGCTGAACTTGG + Intronic
1064156043 10:12904124-12904146 GAGCATCTGGTGGTTCCACTTGG + Intronic
1064321186 10:14306384-14306406 GAGCATCTGTGGGCTTCTCTCGG - Intronic
1064366866 10:14716300-14716322 GGTCATCTGAAGGCTCCACTGGG + Intronic
1065247608 10:23774585-23774607 GAGCATCTCCAGGCTCGAATTGG + Intronic
1067211398 10:44262662-44262684 GATCATCTGCAGGCTCAACTGGG + Intergenic
1070508772 10:77140663-77140685 GAGTGTCTATTGGCTCCACCAGG - Intronic
1074561217 10:114536889-114536911 AAGCATCTGTAGCCTCCACCAGG - Intronic
1079209770 11:18450449-18450471 GAGCATCTATAGGCTCCACTGGG + Intronic
1079337123 11:19579811-19579833 GAGCATCTCTAGGCCCCTCTTGG + Intronic
1088082001 11:105929273-105929295 GTACATCTATCAGCTCCACTAGG + Intronic
1088175004 11:107043308-107043330 GAGCATCTTTAGGCACTACCAGG + Intergenic
1093946140 12:25112000-25112022 AAGCATCTAAAGGCTGCACCTGG - Intronic
1096591869 12:52665423-52665445 GTGCATTTATTGGCTCTACTGGG - Intergenic
1096996826 12:55843371-55843393 GAGCATCTATATTCCCAACTTGG - Intergenic
1100420699 12:94430034-94430056 CAGCACCTATACGCACCACTGGG + Intronic
1100809610 12:98325232-98325254 CAGCATCTATATGAACCACTAGG - Intergenic
1103150073 12:118629919-118629941 GAGCATCCATAGGGACCACTAGG - Intergenic
1107277704 13:38695563-38695585 GAAAATCTAAAGGCTCTACTAGG - Intronic
1110569406 13:76988553-76988575 GATCATCTGTAGCCTCTACTAGG - Intergenic
1117759819 14:59015170-59015192 CAGCTTCTATATGCACCACTAGG - Intergenic
1121863862 14:97344102-97344124 GAGCCTGGATGGGCTCCACTGGG - Intergenic
1124236013 15:27989945-27989967 GAGCACATACAGACTCCACTCGG - Intronic
1125143067 15:36432585-36432607 GAGAATCTATATGCCCCGCTGGG - Intergenic
1126353339 15:47768170-47768192 GAAAATCTATAGGCTTTACTGGG - Intronic
1130357236 15:83144687-83144709 GATCATCTTAAGGCTCAACTGGG - Intronic
1132143970 15:99415972-99415994 GAGCATGTTTAAGGTCCACTAGG + Intergenic
1132267548 15:100488261-100488283 CAGCAGCTATAGGCTGCACCAGG - Intronic
1132712648 16:1276399-1276421 GAGGATCTATAGCTACCACTGGG - Intergenic
1135471976 16:22739374-22739396 GAGCAACTATAGGCTGGACCTGG - Intergenic
1137345682 16:47656737-47656759 TGGCATCTATATGCTCCTCTTGG + Intronic
1137497185 16:48979577-48979599 GAGCCTCAAGAGTCTCCACTTGG - Intergenic
1139252211 16:65507157-65507179 GAACATCTATAGCCTCCACTAGG + Intergenic
1145047703 17:19631345-19631367 GAGCATCTACATGCTGAACTGGG + Intergenic
1148601331 17:48896362-48896384 GAGCATCTGTGGTATCCACTGGG + Intergenic
1149100008 17:52894430-52894452 GATCATCTTGAGGCTCAACTGGG - Intronic
1149711550 17:58746900-58746922 GAGTATCTGAAGGCTCAACTGGG - Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1153807361 18:8720867-8720889 TAGCAATAATAGGCTCCACTTGG - Intronic
1155466305 18:26139381-26139403 ATGCATCTCTAGGCTCAACTGGG - Intronic
1155809710 18:30216742-30216764 GTGCATCTATATTCTCCACTGGG - Intergenic
1156464544 18:37340432-37340454 GAGAACCTACAGGCTCCCCTTGG - Intronic
1156878452 18:42045416-42045438 TATCATCTAAAGGCTCAACTAGG + Intronic
1164437249 19:28241325-28241347 GAGCACTTATAAGTTCCACTGGG + Intergenic
927314116 2:21662484-21662506 GAGCATCACTAGGCATCACTAGG + Intergenic
928103502 2:28452972-28452994 GAACAGCTATTAGCTCCACTAGG + Intergenic
930246858 2:48992438-48992460 GAGCATCTTTGGGCTCCAGTGGG - Intronic
935721878 2:105986677-105986699 CATCATCTGAAGGCTCCACTAGG - Intergenic
937249903 2:120516936-120516958 GATCATTCCTAGGCTCCACTGGG - Intergenic
937590325 2:123606008-123606030 GAGGATTTATAGGCTTGACTTGG - Intergenic
947070965 2:226287712-226287734 GAGCACTGATAGGCTCCAGTAGG - Intergenic
1173035193 20:39402195-39402217 GAGGATCTATAGGTTCTTCTAGG + Intergenic
1175527690 20:59646878-59646900 GGGCATCTTTGTGCTCCACTGGG - Intronic
1175872758 20:62216230-62216252 GAGCATCTTTGGGCTCTGCTGGG - Exonic
1176071767 20:63230604-63230626 GCCCATCTATATGCTCCCCTAGG - Intergenic
1177652254 21:23972880-23972902 GAGCATCTATTGGGTCCATTTGG + Intergenic
1177809036 21:25905060-25905082 GGGCATCAACAGGCTCAACTGGG + Exonic
1182984455 22:34703171-34703193 GAGCCTCCATGTGCTCCACTCGG - Intergenic
950531465 3:13554408-13554430 GATCATCTAAAAGCTCAACTTGG - Intronic
950758726 3:15201641-15201663 GCACATCTACAGGCTACACTGGG - Intergenic
952580765 3:34831236-34831258 GAACATCCATGGTCTCCACTTGG - Intergenic
953113103 3:39962700-39962722 GAGCATGTAAAGGCACCCCTAGG + Intronic
954883654 3:53853481-53853503 GAGAATCTACAGACTCCAGTTGG + Intronic
954955993 3:54518529-54518551 GACCAGCTGTAGGCTCCTCTTGG + Intronic
959668265 3:108945150-108945172 AAGCATCCGTAGGCTTCACTTGG - Intronic
962216661 3:133528459-133528481 GAACATCCAAAGGCTCGACTGGG + Intergenic
964537465 3:157739327-157739349 GAGCATGTATAAGCTCCTCCTGG - Intergenic
967822382 3:193850078-193850100 GATCATCTAAAGACTCAACTGGG + Intergenic
967992662 3:195142941-195142963 GAGCATCTTTAAACTCCTCTCGG - Intronic
969763506 4:9209966-9209988 GAGAATCAATAGGCTCAACGTGG + Intergenic
969764107 4:9214712-9214734 GAGAATCAATAGGCTCAACGTGG + Intergenic
969764716 4:9219459-9219481 GAGAATCAATAGGCTCAACGTGG + Intergenic
969765318 4:9224206-9224228 GAGAATCAATAGGCTCAACGTGG + Intergenic
969765931 4:9228951-9228973 GAGAATCAATAGGCTCAACGTGG + Intergenic
969766540 4:9233694-9233716 GAGAATCAATAGGCTCAACGTGG + Intergenic
969767156 4:9238438-9238460 GAGAATCAATAGGCTCAACGTGG + Intronic
969767762 4:9243185-9243207 GAGAATCAATAGGCTCAACGTGG + Intronic
969768368 4:9247934-9247956 GAGAATCAATAGGCTCAACGTGG + Intronic
969768972 4:9252684-9252706 GAGAATCAATAGGCTCAACGTGG + Intronic
969769579 4:9257433-9257455 GAGAATCAATAGGCTCAACGTGG + Intronic
969770193 4:9262179-9262201 GAGAATCAATAGGCTCAACGTGG + Intronic
969770801 4:9266928-9266950 GAGAATCAATAGGCTCAACGTGG + Intronic
969771413 4:9271673-9271695 GAGAATCAATAGGCTCAACGTGG + Intronic
969771782 4:9324475-9324497 GAGAATCAATAGGCTCAACGTGG + Intronic
969772395 4:9329220-9329242 GAGAATCAATAGGCTCAACGTGG + Intronic
969773011 4:9333966-9333988 GAGAATCAATAGGCTCAACGTGG + Intronic
969773628 4:9338713-9338735 GAGAATCAATAGGCTCAACGTGG + Intronic
969774243 4:9343458-9343480 GAGAATCAATAGGCTCAACGTGG + Intronic
969774858 4:9348203-9348225 GAGAATCAATAGGCTCAACGTGG + Intronic
969775474 4:9352948-9352970 GAGAATCAATAGGCTCAACGTGG + Intronic
969776088 4:9357693-9357715 GAGAATCAATAGGCTCAACGTGG + Intronic
969776699 4:9362438-9362460 GAGAATCAATAGGCTCAACGTGG + Intronic
969777317 4:9367184-9367206 GAGAATCAATAGGCTCAACGTGG + Intergenic
971474707 4:27061671-27061693 CATCATCTCAAGGCTCCACTGGG - Intergenic
972502562 4:39692084-39692106 GAGCTGCTTTAGTCTCCACTAGG + Intergenic
973701238 4:53539226-53539248 GAGCATCCCTCAGCTCCACTTGG - Intronic
974188973 4:58478029-58478051 TTTCATCTAGAGGCTCCACTTGG - Intergenic
977659727 4:99569311-99569333 AAGTATCTTTAGGCTCCTCTTGG - Intronic
982905710 4:161067762-161067784 TTGCATCTATAGGTTCCATTAGG - Intergenic
986019716 5:3790039-3790061 GAGCATCAATGGGCACCAATGGG + Intergenic
986061923 5:4199732-4199754 AGGCATCTACTGGCTCCACTTGG - Intergenic
992459809 5:76950321-76950343 GAGCCTCCACAGGCTGCACTTGG - Intergenic
994327758 5:98468785-98468807 GAGGATCTTTAGGGTCCTCTAGG - Intergenic
996192491 5:120563348-120563370 GAGCATCTCTAGACCCTACTAGG - Intronic
1001401463 5:171448879-171448901 CAGCCTCTCTTGGCTCCACTTGG - Intronic
1016661248 6:146583267-146583289 GAGCATCTGGAGGCTCTATTTGG - Intergenic
1043728736 8:83647899-83647921 GAGCATTTTTAGGCTCTTCTAGG + Intergenic
1048368112 8:133756279-133756301 GAGCATCTTCTTGCTCCACTTGG + Intergenic
1061068990 9:128297044-128297066 GAGACTCAAGAGGCTCCACTGGG - Intergenic
1061238513 9:129355899-129355921 AGTCATCTAAAGGCTCCACTGGG + Intergenic
1187246526 X:17557692-17557714 TAGCATCTCAAGGCTCAACTGGG + Intronic
1187936317 X:24339637-24339659 GGGCATCTTTGAGCTCCACTTGG + Intergenic
1189394244 X:40606400-40606422 AAGCATCTATATACTCCACAAGG - Exonic