ID: 1079211617

View in Genome Browser
Species Human (GRCh38)
Location 11:18465917-18465939
Sequence TTGCTCAGTACCTGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1811
Summary {0: 1, 1: 7, 2: 91, 3: 519, 4: 1193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079211617 Original CRISPR TTGCTCAGTACCTGGGTGGC AGG (reversed) Intronic
900279937 1:1860330-1860352 ATGCTTAGTACCTGGGTGATGGG + Intronic
900772551 1:4557006-4557028 ATGCTTACTACCTGGGTGACAGG - Intergenic
901155381 1:7133990-7134012 ATGCTCACCACCTGGGTGGTGGG - Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901272734 1:7965620-7965642 GTGCTTAGTAAGTGGGTGGCTGG + Intronic
901571267 1:10162723-10162745 ATGCTCACTCCCTGGGTGACAGG - Intronic
901820043 1:11823066-11823088 ATGCGCACTACCTGGGTGACAGG + Intronic
901950243 1:12739360-12739382 ATGTTCACTACTTGGGTGGCAGG + Intergenic
902151509 1:14446998-14447020 ATGCTCACTAACTGGGTGACGGG - Intergenic
902162497 1:14542645-14542667 ATGCTCACTACCAGGGTGACGGG - Intergenic
902248101 1:15135072-15135094 ACGCTCACTACCTGGGTGACGGG + Intergenic
902528266 1:17073663-17073685 ATGCTCAGTACCTGCGTGATGGG + Intronic
903007415 1:20307968-20307990 GTGCTAACTACCTGGGTGACGGG - Intronic
903023752 1:20412378-20412400 ATGCTCACTATCTGGGTGACGGG - Intergenic
903031981 1:20470304-20470326 TTGCTGAGCAACTGGCTGGCTGG + Intergenic
903215711 1:21842288-21842310 TTGCTCAGGGCCTGGGCCGCTGG + Exonic
903423313 1:23234416-23234438 ATGCTCAGTACCTGGGTGATGGG - Intergenic
904296720 1:29524226-29524248 TTAATGAGTACCTGGGTTGCTGG - Intergenic
905487451 1:38313196-38313218 ATGCTCACTACCTGAGTGACAGG + Intergenic
905907696 1:41630328-41630350 ATGCTCACTACCTGGGTGACAGG + Intronic
906171300 1:43727961-43727983 ATGCTGAGTACATGGGTGACAGG - Intronic
906332680 1:44900546-44900568 ATGCTCACTACCTGGGTGATGGG + Intronic
906351362 1:45062912-45062934 ATGCTCACTACCTGGGTGATGGG - Intronic
906578555 1:46914099-46914121 GTGCACAGTACCTGGGTCGTGGG - Intergenic
906874471 1:49521962-49521984 TTGCTCACTACCTGGGTGATGGG + Intronic
907149935 1:52275188-52275210 ATGCTCACTACCTGGGTGACAGG - Intronic
907337463 1:53709800-53709822 CTGCTCAGTGACTGGGTGGGTGG + Intronic
907793228 1:57688967-57688989 ATGCTCACTACCTGGGTGATGGG + Intronic
907924866 1:58945961-58945983 ATGCTCAGTACCTAGGTGACAGG - Intergenic
908106079 1:60843631-60843653 ATGCTCATTACCTGGGTGATGGG + Intergenic
908319874 1:62968743-62968765 ATGCTCAGTACCTGGATGATGGG + Intergenic
908367141 1:63436509-63436531 TTGTTCAGTGCCTTGGTGGTAGG + Intronic
908710612 1:67010237-67010259 ATGCTCACTACCTAGGTGACAGG + Intronic
908729015 1:67207296-67207318 ATGCTTAGCACCTGGGTGACAGG - Intronic
908773966 1:67621909-67621931 ATGCTCACTACCTGGGTGATGGG - Intergenic
909053910 1:70800255-70800277 ATGCTCACTATCTGGGTGACAGG + Intergenic
909367786 1:74848246-74848268 ATGCTCAATTCCTGGGTGACAGG - Intergenic
909420235 1:75456398-75456420 ATGCTCAGTACCTGGGTGACAGG + Intronic
909432279 1:75603073-75603095 ATGCTCAGTACCTAGGTGACAGG - Intronic
909520727 1:76565053-76565075 TTGCTGAGTACAAGGGTGGGAGG + Intronic
909575235 1:77167905-77167927 ATGTTCACTACCTGGGTGACAGG + Intronic
909577901 1:77195922-77195944 ATGCTTAGTACCTGGGTAGCAGG - Intronic
909703161 1:78550830-78550852 ATGCACAGTACCTGGGTACCTGG + Intergenic
909843664 1:80362465-80362487 ATGCACAGTACCTGAGTGACAGG - Intergenic
910388930 1:86717024-86717046 GTGCTCAGTACCTGGGTAACAGG + Intronic
910393235 1:86765629-86765651 ATGTTCAGTATCTGGGTGACAGG - Intergenic
910651144 1:89569403-89569425 ATGCTCACTACCTGGGTGACAGG - Intronic
910909800 1:92221383-92221405 GTGCTCACTACCTGGGTTACAGG + Intronic
911231481 1:95366201-95366223 TTGCTCAGTACCTGAGTAAAGGG + Intergenic
911248094 1:95542270-95542292 ATGCTCACTACCTGGGTGATGGG - Intergenic
911321438 1:96418018-96418040 ATGCTCGCTACCTGGGTGACGGG - Intergenic
911393603 1:97277260-97277282 AAGCTCACTACCTGGGTGACAGG + Intronic
911393726 1:97279102-97279124 ATGCTCACTACCTGGGTGACAGG - Intronic
911468781 1:98290042-98290064 ATGCTCACTACCTGGGTGACAGG - Intergenic
911649226 1:100368680-100368702 ATGCTCACTACCTGGGTGACAGG - Intronic
911736827 1:101345834-101345856 ATGCTCAGTACCTGAGTGACAGG - Intergenic
911826521 1:102493115-102493137 ATACTCAGTACCTGGGTGATAGG + Intergenic
912139626 1:106707421-106707443 ATGCTCACTACTTGGGTGACGGG - Intergenic
912231701 1:107800624-107800646 ATGCTCACTACCTGGGTGGTGGG - Intronic
912268766 1:108188274-108188296 ATGCTCACTACCTGGGTGACAGG + Intronic
912303193 1:108537641-108537663 ATGCTCACTTCCTGGGTGGTGGG - Intergenic
912661900 1:111539189-111539211 ATGCTCACTACCTGGGTGATGGG - Intronic
912919812 1:113855115-113855137 ATGCTCACTACCTGGGTGATGGG + Intronic
912948547 1:114104928-114104950 ATGCTCACTACCTGGGTGGCAGG - Intronic
912969666 1:114268912-114268934 GGGCTTAGTACCTGGGTGACAGG + Intergenic
913160869 1:116145557-116145579 TTTCTCAGTCCCTGTGTGTCTGG + Intergenic
913178266 1:116295149-116295171 ATGCTCAGTACCTGGGTGACGGG + Intergenic
913427791 1:118753837-118753859 ATGCTCAGTACCTTGGTGATGGG - Intergenic
913575107 1:120164375-120164397 ATGCTTAGTACTTGGGTGACGGG - Intronic
913965980 1:143377883-143377905 ATGCTCATTACCTGGGTGACGGG - Intergenic
914044566 1:144079853-144079875 TTGCTCAGAACCTGGCTTGCAGG - Intergenic
914047400 1:144103512-144103534 TGGCTCACTGGCTGGGTGGCTGG + Intergenic
914047646 1:144104581-144104603 TGGCTCACTGGCTGGGTGGCTGG + Intergenic
914048973 1:144115536-144115558 ATGCTCAGTGCCTGGGTGACGGG - Intergenic
914049206 1:144117699-144117721 ATGCTCACTACCTGGGTGATGGG - Intergenic
914060354 1:144203491-144203513 ATGCTCATTACCTGGGTGACGGG - Intergenic
914118796 1:144762878-144762900 ATGCTCATTACCTGGGTGACGGG + Intergenic
914129978 1:144847746-144847768 ATGCTCACTACCTGGGTGATGGG + Intergenic
914130211 1:144849909-144849931 ATGCTCAGTGCCTGGGTGACGGG + Intergenic
914133544 1:144880833-144880855 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
914214352 1:145611280-145611302 ATGCTCAGTACCTGGGTGACCGG - Intronic
914327532 1:146634970-146634992 TCTCTCAGTTCCTGTGTGGCTGG - Intergenic
914334616 1:146703041-146703063 ATGCTCAGTACCTGGGTGACGGG - Intergenic
914353767 1:146863359-146863381 AAGCTCAGTACCTGGGTGATGGG - Intergenic
914405468 1:147367103-147367125 ATGCCCACTACCTGGGTGACAGG - Intergenic
914466290 1:147931673-147931695 ACGCTCAGTACCTGGGTGACCGG - Intronic
914557412 1:148780016-148780038 ATGCTTAGTACTTGGGTGACGGG - Intergenic
914615422 1:149350214-149350236 ATGCTTAGTACTTGGGTGACGGG + Intergenic
914845993 1:151283642-151283664 TTTCTGAGTACCTGAGTGGAAGG + Intronic
914990093 1:152492072-152492094 ATGCTCACTACCTGGATGACAGG - Intergenic
914990204 1:152493599-152493621 ATGCTCACTACCTGGGTGACAGG + Intergenic
915102780 1:153512796-153512818 TTGCTCACTACCTGGGTGATAGG - Intergenic
916287194 1:163121156-163121178 CTGCTCAGTACCTGAGTGACAGG + Intronic
916396776 1:164398923-164398945 ATGCTCACTACTTGGGTGACAGG + Intergenic
916580863 1:166106775-166106797 ATGCTCATTACCTGGGTGATGGG + Intronic
916777395 1:167981469-167981491 ATGCTCAGTTCCTGGGTAACAGG - Intronic
917184312 1:172335842-172335864 ATGCTCAGTACCTGGGTGACAGG + Intronic
917312883 1:173695292-173695314 GTGTTCACTACCTGGGTGACAGG - Intergenic
917382725 1:174432054-174432076 ATGCTCACTACCTGGGTGAAGGG - Intronic
917408072 1:174730366-174730388 ATGCTCAGTACCTGGGTGATGGG + Intronic
917832507 1:178908029-178908051 CTGCTCACTAACTGGGTGACAGG - Intronic
918250923 1:182702430-182702452 ATGCTCAGTACCTGGGTGACAGG + Intergenic
918788164 1:188791231-188791253 ATGCTCACTACCTGGGTGATGGG + Intergenic
918846233 1:189617814-189617836 TTGCTCACTACCTGGGTGACGGG + Intergenic
918878070 1:190075730-190075752 ATGCTCACCACCTGGGTGACAGG + Intergenic
918883513 1:190158510-190158532 ATGCTCACTACCTGGGTGACGGG + Intronic
918905377 1:190485517-190485539 TTGCTCAGTACCTGGAGGAATGG - Intergenic
918950642 1:191132122-191132144 ATGCTCACTACCTGGGTGATGGG + Intergenic
918980119 1:191546515-191546537 ATGCTCAGTACCTGGGTAAAGGG + Intergenic
919242565 1:194934319-194934341 ATGCTCATTACCTGGGTGATGGG + Intergenic
919245169 1:194973455-194973477 ATCCTCAGTACCTGGATGACAGG + Intergenic
919400749 1:197113261-197113283 ATGCTCAATACCTGGGTGACAGG + Intronic
919409901 1:197229546-197229568 ATGCTCACTACCTGGGTGACGGG - Intergenic
919566913 1:199200327-199200349 ATGCTCACTACCTGGGTGGGGGG - Intergenic
919767573 1:201137100-201137122 TTCCTCAGGACCTGGGCGGGAGG - Intronic
919897225 1:202016717-202016739 ATACTCACTACCTGGGTGACAGG - Intronic
920130132 1:203725757-203725779 GTGTCCATTACCTGGGTGGCTGG - Intronic
920252319 1:204629994-204630016 ATGCTCACTACCAGGGTGACAGG + Intronic
920780914 1:208990234-208990256 ATGCTCACTACCTGGGTGATAGG + Intergenic
921411398 1:214839938-214839960 ATGCTCACTACCTGGATGACAGG - Intergenic
921434768 1:215105683-215105705 ATGCTCAGTACCTGGGTGATGGG - Intronic
921458561 1:215401684-215401706 ATGCTCAGTACCTGAGTGACAGG - Intergenic
921895706 1:220398179-220398201 ATGCTCAGTACCTGGGTGACGGG - Intergenic
921952214 1:220942190-220942212 ATGCTCACTACCTGGGTGATGGG - Intergenic
921983168 1:221280562-221280584 ATGCTTAGTACCTGGGTGATGGG - Intergenic
922330413 1:224570262-224570284 ATGCTCACTACATGGGTGACAGG - Intronic
922737336 1:227994512-227994534 ATGCTCAGGGCCTGGGTGGGAGG - Intergenic
922977697 1:229798990-229799012 ATGCTAACTACCTGGGTGACCGG + Intergenic
923244037 1:232113624-232113646 ATGCTCACTACCTGGGTGACAGG + Intergenic
923318076 1:232801166-232801188 ATGCTCACTACCTGGGTGAAGGG - Intergenic
923374572 1:233347782-233347804 ATGCTCAGTACCTGGGTGACAGG + Intronic
923425517 1:233865007-233865029 ATGCTCACTATCTGGGTGACAGG + Intergenic
923824989 1:237490231-237490253 TTGCTCACTACCTGGTTGATGGG + Intronic
923986438 1:239387240-239387262 CTGCCCAGCGCCTGGGTGGCGGG - Intronic
924132407 1:240925215-240925237 ATGCTCACTACCTGGGTGTTGGG - Intronic
924249411 1:242116508-242116530 ATTCTCACTACCTGGGTGACGGG - Intronic
924324837 1:242885266-242885288 ATGCTCAGTCCCTGGGTAACAGG + Intergenic
924699334 1:246435211-246435233 ATGCTCACTACCTGGGTGACAGG + Intronic
1063040312 10:2331396-2331418 GTGCTCACTACCCGGGTGACGGG + Intergenic
1063233821 10:4091450-4091472 GTGCTCACTACCTGGGTCACAGG + Intergenic
1063501087 10:6555176-6555198 ATGCTCAGTTCCTGGGTGATGGG + Intronic
1063625401 10:7684983-7685005 ATGCTCAGTACCTTGGTGATGGG + Intergenic
1063750466 10:8939826-8939848 ATGCTCACTACCTGGGTGACAGG - Intergenic
1064187014 10:13170787-13170809 ATGCTCATTACCTGGGTGATGGG - Intronic
1064198978 10:13268705-13268727 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1064212539 10:13372469-13372491 ATGCTCAGTACCTGGGTGATAGG - Intergenic
1064525243 10:16249324-16249346 ATGCTCAGTACCTAGGTGATGGG + Intergenic
1064619042 10:17195500-17195522 ATGCTCAGTGCCTGGGTGGTGGG + Intronic
1064676944 10:17769927-17769949 ATTCTCACTAACTGGGTGGCAGG - Intronic
1064866847 10:19890339-19890361 ATGCTCAGTACCTGGGTGATGGG - Intronic
1065170341 10:23020894-23020916 GGGCTCACTACCTGGGTGACAGG - Intronic
1065182692 10:23142799-23142821 ATGCTCACTACCTGGGTGACAGG + Intergenic
1065223325 10:23518368-23518390 ATTCTCAGTACCTGGGTGAGAGG - Intergenic
1065306317 10:24372539-24372561 ATGCTCACTGCCTGGGTGACGGG + Intronic
1065373970 10:25017468-25017490 TTTCTCACTGCCTGGTTGGCTGG + Intronic
1065510055 10:26469691-26469713 ATGCTCAGTACCCGGGTGATGGG - Intronic
1065602131 10:27379845-27379867 GTGCTCACTACCTGGGTGACAGG - Intergenic
1065697920 10:28397174-28397196 ATGCTTACTACCTGGGTGACTGG - Intergenic
1065716584 10:28575197-28575219 ATGCTCAGTACCTGGGTGATGGG - Intronic
1065743859 10:28820985-28821007 GTGCTTAATACCTGGGTGACAGG - Intergenic
1065826092 10:29573148-29573170 ATGCTCAGTACCAGGGTGATGGG - Intronic
1065987107 10:30965813-30965835 ATGCTCAGTACCTAGGTGACAGG + Intronic
1066016226 10:31246619-31246641 GTGCTCATTACCTGGGTGATGGG - Intergenic
1066136709 10:32454469-32454491 GTGCTCAGTACTTGGGTGACGGG + Intronic
1066184806 10:32998709-32998731 ATGCTTAGTACCTGGGTGACAGG - Intronic
1066340957 10:34533327-34533349 ATGCTCACTACCTGGATTGCGGG + Intronic
1066593816 10:37026046-37026068 TGGATGAGTAGCTGGGTGGCTGG + Intergenic
1066956694 10:42179540-42179562 TTGCTCAGAAACTGGCTTGCAGG - Intergenic
1067176288 10:43950310-43950332 ATGCTCACTGCCTGGGTGACGGG - Intergenic
1067484294 10:46633088-46633110 GTGCTCAGTACCTGGGTGACAGG - Intergenic
1067521506 10:47010566-47010588 ATGCTGATTACCTGGGTGGTGGG - Intergenic
1067610466 10:47708558-47708580 GTGCTCAGTACCTGGGTGACAGG + Intergenic
1068021143 10:51586027-51586049 ATGCTCACTAGCTGGGTGACAGG + Intronic
1068120099 10:52776025-52776047 TTTCTCAGTAACAGGGTGTCGGG + Intergenic
1068418787 10:56762245-56762267 ATGCTCAGTACCTGGGTTATGGG + Intergenic
1068542600 10:58312334-58312356 GTGCTCAGTACCTGGGTGATGGG - Intergenic
1068745045 10:60520323-60520345 ATGCTCACTACCTGGGTGATGGG + Intronic
1068759422 10:60691202-60691224 GTGCTCAGTAGCTGGGTGACAGG + Intronic
1068787099 10:60988401-60988423 ATGCTCACTACCTGGGTAACAGG - Intronic
1068965723 10:62910763-62910785 GTGCTCACTACCTGGGTGACAGG - Intronic
1068991849 10:63158767-63158789 TTGCTCAGGACCTGGGAAGGAGG + Intergenic
1069023396 10:63514673-63514695 AAGGTCAGTACCTGGGTGACGGG + Intergenic
1069458126 10:68570062-68570084 ATGTTCACTACCTGGGTGACAGG - Intronic
1069793607 10:71039103-71039125 GTGCTGAGTGCCTGGGTGCCTGG - Intergenic
1070769755 10:79075313-79075335 TGGCTCAGGACCTTGATGGCTGG + Intronic
1071146935 10:82586124-82586146 ATGCTCACTATCTGGGTGACAGG + Intronic
1071318924 10:84432350-84432372 ATGCTCACTACCTGGGTGATGGG - Intronic
1071625875 10:87168817-87168839 GTGCTCAGTACCTGGGTGACAGG + Intronic
1071808246 10:89147984-89148006 ATGCACACTACCTGGGTGACAGG - Intergenic
1071921494 10:90355801-90355823 TTCCCCATTACCTGGGTGGTAGG - Intergenic
1072207752 10:93220106-93220128 GTGCTCACTAGCTGGGTGACGGG + Intergenic
1072314882 10:94192281-94192303 ATGCTCACTACCTGGGTGACAGG - Intronic
1072692679 10:97582303-97582325 GTGCTCAGCAGCTGGGTGGGAGG - Exonic
1072832101 10:98669781-98669803 ATGCTCACTACCTGGGTGACAGG + Intronic
1073019222 10:100427810-100427832 ATGTTCAGTACCTGGGTGATGGG + Intergenic
1073784450 10:106873187-106873209 TTCCTGAGTACCTGAGTAGCTGG - Intronic
1073843447 10:107525093-107525115 ATGCTCAGTACCTGAATGACAGG + Intergenic
1073881768 10:107989809-107989831 ATGCTCAATACCTGGGTGACAGG + Intergenic
1073953307 10:108836902-108836924 ATGCTCAGTACCCGGGTGACAGG - Intergenic
1074230842 10:111533336-111533358 ATGCTCACTACCTGGGTGACAGG - Intergenic
1074442299 10:113488751-113488773 ATGCCCAGTACCTGGGTGACAGG - Intergenic
1074448091 10:113536918-113536940 ATGCTTGGTACCTGGGTGACGGG + Intergenic
1074660545 10:115651264-115651286 ATGCTCACTACCTGGGTGATGGG + Intronic
1075170371 10:120107824-120107846 ATGCTCACTACCTGGGTGATGGG + Intergenic
1075179589 10:120197876-120197898 ATGCTCAGTACCTGGATGACAGG - Intergenic
1075369274 10:121921166-121921188 ACGATCAGTACCTGGGTGGTGGG - Intronic
1075413745 10:122247795-122247817 ATGCTCAGTACCTGGGTGACAGG + Intronic
1075423195 10:122320946-122320968 ATGCTCAGTACCTGGGTGACAGG - Intronic
1075787565 10:125060527-125060549 TTGCTCAGAACCAGTGTTGCAGG - Intronic
1075905307 10:126076017-126076039 ATGCTCACTACCTGGGTGACAGG - Intronic
1076160368 10:128239361-128239383 TTTCTCAGTACCTCTGTGGAAGG + Intergenic
1076239344 10:128892288-128892310 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1076244784 10:128938399-128938421 CTGCTCAGAGCCTGGGTTGCAGG - Intergenic
1076430908 10:130401637-130401659 TCACTCAGTACCTGGAAGGCAGG - Intergenic
1076611465 10:131728607-131728629 GTGCTCACTACCTGGGTGATAGG + Intergenic
1076699413 10:132263490-132263512 ATGCTCAGTGCTTGGGTGACAGG + Intronic
1077059804 11:613133-613155 CTGCTGAGTACCTGGCAGGCAGG + Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077448683 11:2619958-2619980 ATGCTCACTACCTGGGTGATAGG - Intronic
1077548284 11:3186484-3186506 ATGTTCACTACCTGGGTGACGGG - Intergenic
1077659699 11:4056629-4056651 GTGCTCAGTAGCTCTGTGGCTGG - Intronic
1077694542 11:4382507-4382529 ATGCTCAGTACCAGGGTGACAGG - Intergenic
1077817684 11:5703139-5703161 ATGCTCATTACCTGGGTGATGGG - Intronic
1078321176 11:10336184-10336206 TTCCTGAGTAGCTGGGTAGCTGG + Intronic
1078515184 11:12015927-12015949 GTGCTCACTACCTGGGTGACAGG + Intergenic
1078737210 11:14031252-14031274 GTGCTCACTACCTGGGTGATGGG + Intronic
1078984768 11:16582207-16582229 ATGCTCAGCACCTGGGTGACAGG + Intronic
1079211617 11:18465917-18465939 TTGCTCAGTACCTGGGTGGCAGG - Intronic
1079244306 11:18741768-18741790 ACGCTCAGTACCTGGGTGATGGG + Intronic
1079461495 11:20683403-20683425 ATGCTCACTACCTGGGTGATGGG - Intronic
1079474458 11:20814389-20814411 GTGCTCAGCACCTGGGTGACAGG - Intronic
1079481566 11:20886153-20886175 ATGCTCACTACCTGAGTGACTGG + Intronic
1079537806 11:21536197-21536219 ATGCTCACTACCTTGGTGACAGG - Intronic
1079595524 11:22241117-22241139 ATGCTCACTACTTGGGTGGCAGG - Intronic
1079779272 11:24578824-24578846 ATGCTCAGTACTTTGGTGACTGG + Intronic
1079880773 11:25923720-25923742 ATGCTCACTACCTGGGTGATGGG - Intergenic
1079999315 11:27329442-27329464 ATGCTCGGTACCTCGGTGGGCGG - Intergenic
1080091956 11:28359022-28359044 ATGCTCACTACCTGGGTGACAGG - Intergenic
1080154760 11:29096603-29096625 ATGGTCATTACCTGGGTGACAGG + Intergenic
1080255387 11:30284539-30284561 ATGCTCAGAACCTGGGTTGTGGG + Intergenic
1080338523 11:31228947-31228969 ATGCTCACTACCTGGGTGATGGG + Intronic
1080507023 11:32924824-32924846 ATGCTCAGTACCCAGGTGACAGG - Intronic
1080709023 11:34728090-34728112 GTGCTCACTACCTGGATGACAGG - Intergenic
1081035745 11:38143772-38143794 ATGCTCACTACCTGGGTGATAGG - Intergenic
1081059091 11:38450200-38450222 ATGCTTACTACCTGGGTGACAGG + Intergenic
1081093741 11:38905100-38905122 ATGCTCATTACCTGGATGACGGG + Intergenic
1082642397 11:55679516-55679538 ATGCTCACGACCTGGGTGACAGG + Intergenic
1082663612 11:55946671-55946693 ATGCTCACTACCTGGGTGATGGG - Intergenic
1082712039 11:56564902-56564924 ATGCTCACTACCTGGGTGATGGG - Intergenic
1082869105 11:57927613-57927635 GTGCTCACTACCTGGGTGACGGG - Intergenic
1082908604 11:58342936-58342958 ATGCTCAGTATCTGAGTGACAGG + Intergenic
1082911387 11:58379248-58379270 ATGTTCACTACCTGGGTGACAGG + Intergenic
1082913527 11:58404991-58405013 ATGCTCACTACCAGGGTGACAGG - Intergenic
1083034763 11:59626563-59626585 ATGCTCACTACCTGGGTGACAGG - Intergenic
1083074912 11:60027086-60027108 ATGCCCAGTACCTGGATAGCAGG - Intergenic
1083497507 11:63070310-63070332 ATGCTCACTACCTGAGTGACGGG + Intergenic
1083542179 11:63519655-63519677 ATGCTCACTACCTGAGTGACGGG + Intergenic
1085065630 11:73493069-73493091 ACGCTCACTACCTGGGTGACAGG + Intronic
1085131673 11:74044645-74044667 ATGCTTAGTACCTGGGTGATGGG - Intronic
1085140453 11:74136014-74136036 ATGCTCAGTACCTGGGTGATAGG + Intronic
1085244123 11:75084248-75084270 ATGCTCACTATCTGGGTGACGGG + Intergenic
1085335738 11:75693205-75693227 ATGCTCACTACCTGGATGACGGG - Intergenic
1085566997 11:77523122-77523144 ATGCTCACTACCTGGGTGATGGG + Intronic
1085894494 11:80622275-80622297 TGGATGAGTAGCTGGGTGGCTGG - Intergenic
1086313142 11:85558839-85558861 ATGCCCAGTTCCTGGGTGACGGG + Intronic
1086600363 11:88625675-88625697 GTGCTCACTACCTGGGTGATGGG + Intronic
1086756110 11:90564153-90564175 ATGCTCATTACCTGGGTGATGGG + Intergenic
1086872830 11:92059977-92059999 TTGTTCAGTATCTGGTTTGCTGG + Intergenic
1087085659 11:94216030-94216052 ATGCTCAGTACTTGGGTGATGGG - Intergenic
1087107879 11:94429708-94429730 CTGCTCACTACCTGGGTGATGGG + Intronic
1087121534 11:94580236-94580258 TTGCACTGTAACTGGGTGACAGG - Intronic
1087604462 11:100360169-100360191 GTGCTCAGTACCTGGGTAACAGG - Intergenic
1087725737 11:101714092-101714114 ATGCTCACTACCTGGATGACAGG + Intronic
1087735765 11:101831299-101831321 ATGCTCAGTACCTTGGTGACAGG + Intronic
1087910241 11:103744123-103744145 GTGCTCAATACCTTGGTGACAGG - Intergenic
1088225201 11:107612407-107612429 ATGCTCACTACCTGGGTGACAGG + Intronic
1088290045 11:108226236-108226258 ATGCTCACTACCTGAGTGACAGG - Intronic
1088471621 11:110193419-110193441 ATGCTCACTACCCGGGTGACAGG + Intronic
1089010982 11:115131517-115131539 TTGCTCAGTACCTGGCTGGATGG - Intergenic
1089145093 11:116323268-116323290 TTTCTCAATAACTGGGTGGAGGG + Intergenic
1089361639 11:117892608-117892630 ATGCTCAGTACCTGGGTGGCGGG - Intergenic
1089945844 11:122472604-122472626 ATGCTCAGTTTCTGGGTGACAGG - Intergenic
1089945919 11:122473511-122473533 ATGCTCACTCCCTGGGTGACAGG + Intergenic
1090096615 11:123748311-123748333 GTGCTCACTACCTGGGTGATGGG - Intergenic
1090181140 11:124700863-124700885 ATGCTTACTACCTGGGTGACAGG - Intergenic
1090280151 11:125448771-125448793 ATGTTCACTACCTGGGTGACAGG + Intronic
1090315085 11:125779143-125779165 ATGTTCACTACCTGGGTGACGGG - Intergenic
1090845117 11:130523751-130523773 GTGCTCAGCAGCTCGGTGGCCGG + Intergenic
1090864886 11:130691050-130691072 GTGCTCACTACCTGGGTGATGGG - Intronic
1090894110 11:130954203-130954225 ATGCTCACTACCTGGGTGACAGG + Intergenic
1090934772 11:131331633-131331655 TTGTTCAGTACGTGTGTGTCGGG + Intergenic
1091031823 11:132196826-132196848 ATGGTCACTACCTGGGTGACTGG + Intronic
1091204950 11:133814164-133814186 ATGCTCAGTACCTGGGCGAACGG + Intergenic
1091284602 11:134401627-134401649 ATGCTCAGTACCTGGGTAAGAGG + Intronic
1092466972 12:8741793-8741815 GTGCTCACTCCCTGGGTGACAGG + Intronic
1092667532 12:10820171-10820193 ATGCTCACTACCTGGGTGATGGG + Intergenic
1093081159 12:14812845-14812867 ATGCTCAGTATCTGGGTGACAGG - Intronic
1093106932 12:15098181-15098203 ATGCTCACTACCTGGGTGATGGG - Intergenic
1093215616 12:16358232-16358254 ATGCTCACTACCTGGGTGATAGG - Intronic
1093305696 12:17514743-17514765 TTGCTCAATACCTGGGTGATGGG + Intergenic
1093500776 12:19809547-19809569 ATGCTCACTACCTGGGTGACGGG + Intergenic
1093523902 12:20084559-20084581 ATGCTCACTACTTGGGTGGTGGG - Intergenic
1093575670 12:20726799-20726821 ATGCTCACTACCTGGGTGACAGG - Intronic
1093936479 12:25006762-25006784 ATGCTCAGTACGTGGGTGATGGG + Intergenic
1093979257 12:25456879-25456901 ATGCTCACTACCTGGGTGATAGG + Intronic
1094336736 12:29365504-29365526 ATGCCCAGTACCTGGGTGATGGG + Intronic
1094405603 12:30112828-30112850 ATGCTCACTACCTGGGTGACAGG - Intergenic
1094695674 12:32816174-32816196 ATGCTTACTACCTGGGTGACGGG - Intronic
1094698865 12:32848695-32848717 ATGCTGAGTACCTGGGTGACAGG + Intronic
1094715546 12:33011445-33011467 ATGCTCAATACCTGGGTGATGGG + Intergenic
1094754202 12:33447470-33447492 ATGCTGAGTACCTGGGTGATGGG + Intergenic
1095139372 12:38642838-38642860 ATGCTCACCACCTGGGTGACAGG - Intergenic
1095144162 12:38704154-38704176 ATGCTCAGTACCTGGGTGACAGG + Intronic
1095160588 12:38910238-38910260 GTGCTCACTATCTGGGTGACAGG - Intergenic
1095298190 12:40551026-40551048 CTGCTCAGTACCTGGGTGACAGG - Intronic
1095576849 12:43749944-43749966 ATGCTCACTACCTGGGTGATGGG + Intronic
1095692541 12:45106711-45106733 ATGCTCACTACCTGGGTGATGGG - Intergenic
1095703245 12:45212521-45212543 ACGCTCAATACCTGGGTGACAGG + Intergenic
1095905785 12:47376757-47376779 ATGCTGACTACCTGGGTGACAGG + Intergenic
1095908484 12:47402241-47402263 ATGCTCAGTACCTGTGTGACAGG + Intergenic
1096051065 12:48607986-48608008 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1096205858 12:49721375-49721397 ATGCTCACTACCTGGGTGATGGG - Intronic
1096505009 12:52087198-52087220 TGGCTCAGCACCGGGGTGGAGGG - Intergenic
1096665899 12:53164626-53164648 ATGCTCACTACCTGGGTGATGGG + Intronic
1096761760 12:53847691-53847713 ATGCTCACTACCTGGGTGATGGG - Intergenic
1096764128 12:53869107-53869129 ATGCTCATTACCTGGGTGACGGG - Intergenic
1096830291 12:54308551-54308573 ATGCTCATTACCTGGGTGACAGG + Intronic
1096936680 12:55287739-55287761 ATGCTCACTACCTGGGTGATGGG + Intergenic
1097628068 12:62025306-62025328 ATGCTCAGTACCTGGGTGATGGG + Intronic
1097751693 12:63361861-63361883 ATACTCAGTACCTGGGTGACAGG - Intergenic
1097916614 12:65027165-65027187 ATGCTCAGTACCTGGGATGATGG - Intergenic
1098101530 12:67022798-67022820 ATGCTCACTACCTGGATGACAGG - Intergenic
1098371352 12:69763705-69763727 ATGCTCAGTACCAGGGTGACAGG - Intronic
1098536295 12:71597268-71597290 CTCCTCAGTACCTGGGTGATGGG - Intergenic
1098737990 12:74131806-74131828 ATGCTCACTACCAGGGTGACAGG - Intergenic
1098738306 12:74136625-74136647 ATGCTCACTACCTGGGTGATGGG - Intergenic
1099004434 12:77219239-77219261 ATGCTCACTACCTGGATGGCAGG - Intergenic
1099192078 12:79571089-79571111 TGCCTCAGTACCTGAGTAGCTGG + Intergenic
1099422885 12:82485028-82485050 ATGCTCATTACCTGGGTGACAGG + Intergenic
1099464057 12:82960688-82960710 ATGCTCAGTACCTGGGTGATGGG + Intronic
1099625075 12:85062290-85062312 ATGCTCACTACCTGGGTGACAGG - Intronic
1099646336 12:85362007-85362029 ATGCTCATTACCTGGGTGATGGG + Intergenic
1099836640 12:87914868-87914890 ATGCTCAGTAACTGGGTGATGGG + Intergenic
1099840214 12:87955359-87955381 ATGCTCAGTACCTGGGTTATGGG - Intergenic
1099879593 12:88451788-88451810 ATGTTCACTACCTGGGTGACGGG - Intergenic
1099993592 12:89752998-89753020 TTGTTCATCACCTGGGAGGCAGG - Intergenic
1100133253 12:91521887-91521909 ATGCTCAGTTCCTGGGTGATGGG + Intergenic
1100335973 12:93630073-93630095 ATGCTCACTACCTGGGTGATGGG + Intergenic
1100541918 12:95565271-95565293 GTGCTCAGTACCTGGGTGATGGG + Intergenic
1100589088 12:96008094-96008116 GTGCTCAGTACCTGGGTGATGGG + Intronic
1100724882 12:97397709-97397731 ATGCTCACTACGTGGGTGACAGG + Intergenic
1100928373 12:99576851-99576873 ATGCTCAGTACCTGGATGGTGGG - Intronic
1100938390 12:99695991-99696013 ATGCTCACTACCTGGGTGGAGGG + Intronic
1100962317 12:99976240-99976262 ATGCTCACTACCTAGGTGACAGG + Intronic
1101075123 12:101121164-101121186 ATGCTCGCTACCTGGGTGGTGGG - Intronic
1101090905 12:101284183-101284205 ATGCTCACTACCTGGGTGACAGG - Intronic
1101112562 12:101500383-101500405 ATGCTCACTACCTGGTTGACAGG + Intergenic
1101220770 12:102637525-102637547 ATGCTCAGTACCTGGATGATGGG - Intergenic
1101847975 12:108378643-108378665 ATGCTTAGTATCTGGGTGACAGG + Intergenic
1102574597 12:113848382-113848404 GTGCCCACTGCCTGGGTGGCTGG + Intronic
1102696071 12:114800436-114800458 ATGATCAGTACCTGGGTGATGGG - Intergenic
1103118708 12:118361874-118361896 ATGCTCACTACCTGGGTGATGGG - Intronic
1103143422 12:118572380-118572402 GTGCTCAGTACCTGGGTGACAGG - Intergenic
1103565594 12:121813856-121813878 TTGCTCAGTACCTGTGTGCCAGG - Intronic
1103891703 12:124243880-124243902 ATGCTTACTACCTGGGTGACGGG - Intronic
1104101284 12:125614215-125614237 ATTCTCACTACCTGGGTGACAGG - Intronic
1104192878 12:126500279-126500301 GTGCTGACTACCTGGGTGACAGG - Intergenic
1104484813 12:129141818-129141840 ATGCTCAGTACCTGGGTGATGGG + Intronic
1105249295 13:18682652-18682674 CTGCTCACTACCTGGGTGACAGG + Intergenic
1105265360 13:18810064-18810086 TTGGTCAGTACCTGGCCCGCTGG - Intergenic
1105445522 13:20452177-20452199 ATGCTTACTACCTGGGTGACAGG + Intronic
1105457514 13:20555109-20555131 GTGCTCACTACCTGGGTGACAGG - Intergenic
1105595154 13:21830566-21830588 GTGCTCAGTACCTAGGTGACAGG - Intergenic
1105609805 13:21958355-21958377 ATGCTCACTACCTGAGTGACGGG - Intergenic
1105687532 13:22800084-22800106 ATGCTCACTACCTGGGTGACAGG + Intergenic
1105917506 13:24930405-24930427 ATGCTCAGTATCTGGGTGAGGGG - Intergenic
1106021004 13:25915454-25915476 AAGCTCAGTAGCTGGGTCGCTGG + Intronic
1106215427 13:27693617-27693639 ATGCTCAGTACCTGGGTGAGAGG - Intergenic
1107067166 13:36226845-36226867 ATGCTCAGTCCCTGGGTGATGGG + Intronic
1107158243 13:37195229-37195251 TTGCTCACTACCTGGGTGACAGG - Intergenic
1107233243 13:38136955-38136977 ATGCTCACTACCTGGGTGATGGG - Intergenic
1107267417 13:38572913-38572935 ATGCTCACTACCTGTGTGACAGG + Intergenic
1107396737 13:40025730-40025752 ATGCTTAGTACCTGGGTGATGGG + Intergenic
1107609208 13:42096187-42096209 GTGTTCAGTACCTGGGTGACAGG - Intronic
1107643174 13:42465444-42465466 ATGCTCACTACCTGGGCGACAGG + Intergenic
1107989592 13:45806619-45806641 ATGCTCACTACCTGGATGACAGG + Intronic
1108182538 13:47855004-47855026 CTGCTCAGGACCTGGGGGACAGG + Intergenic
1108223219 13:48259800-48259822 TTGCTCACTACCTGAGTGATGGG - Intronic
1108268423 13:48734977-48734999 TTGCACAGTACCTGGTTCACAGG + Intergenic
1108335683 13:49439388-49439410 ATGCCCAGTACCTGGATGACAGG - Intronic
1108488757 13:50957189-50957211 ATGCTCACTACCTGGGTGACAGG - Intronic
1108609977 13:52075543-52075565 ATGCTCAATACCTGGGTGACGGG + Intronic
1108627133 13:52241524-52241546 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1108658934 13:52564941-52564963 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1108705943 13:52987155-52987177 CTGCTCAGTACCTGGGTGACAGG - Intergenic
1108748944 13:53426547-53426569 ATGCTCACTACCTGGGTGATGGG - Intergenic
1108828363 13:54445057-54445079 ATGCTCATTACCTGAGTGGCAGG - Intergenic
1109047560 13:57433165-57433187 ATGCTCATTACCTGGGTGACAGG + Intergenic
1109311738 13:60703036-60703058 ATGCTCAGTACCTGGGTAACAGG - Intergenic
1109317760 13:60771350-60771372 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1109400363 13:61819700-61819722 ATCCTCAGTACCTGGGTGATGGG + Intergenic
1109432398 13:62252563-62252585 ATGCTCACTACATGGGTGACGGG - Intergenic
1109517005 13:63456810-63456832 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1109580038 13:64318599-64318621 ATGCTCAGTACCTGGATGATGGG - Intergenic
1109621105 13:64906497-64906519 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1109655163 13:65381203-65381225 ATGCACACTACCTGGGTGACAGG - Intergenic
1109667325 13:65556425-65556447 ATGCTCACTTCCTGGGTGACAGG - Intergenic
1110038244 13:70716813-70716835 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1110049655 13:70879660-70879682 ATGCTCAGTAACTGTGTGACAGG + Intergenic
1110182383 13:72633174-72633196 ATGCTCACTACCTGGGTGATGGG + Intergenic
1110248969 13:73359833-73359855 ATGCTTACTACCTGGGTGACAGG + Intergenic
1110397259 13:75045489-75045511 GTGCTCACTACCTGGGTGACAGG + Intergenic
1110456204 13:75693036-75693058 TTGCTCAGTTCCTCAGTGTCAGG + Intronic
1110692366 13:78445532-78445554 ATGCTCAGTATCTGGATGACAGG - Intergenic
1110714900 13:78690467-78690489 TGGCTCAGCACCTGGGTGATGGG + Intergenic
1110716244 13:78707848-78707870 ATGCTCACTACCTGGGTGATGGG - Intergenic
1110742202 13:79010821-79010843 ATGCTCAGTACCTGGGTGAAAGG - Intergenic
1110792772 13:79603478-79603500 ATGCTCAGTACCTGGGTTACAGG - Intergenic
1110876328 13:80515234-80515256 ATGCTCACTACCTGGGTGACAGG - Intergenic
1110926543 13:81161203-81161225 ATGCTCACTACCTGGGTGATGGG + Intergenic
1111027198 13:82544038-82544060 TTGCTCAGTACCTGGGTAAAGGG - Intergenic
1111080080 13:83293886-83293908 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1111211611 13:85087048-85087070 ATGCTCAGTGCCTGGGTGACAGG + Intergenic
1111260915 13:85738505-85738527 ATGCTCACTTCCTGGGTGACAGG + Intergenic
1111357408 13:87126471-87126493 ATGCTCACTACCTGGGTGATGGG + Intergenic
1111377809 13:87403284-87403306 ATGCTCACTACGTGGGTGACAGG + Intergenic
1111465159 13:88598613-88598635 ATGCTCAGTACTTGGGTGATGGG + Intergenic
1111550163 13:89798819-89798841 ATGCTCACTACCTGAGTGACAGG - Intergenic
1111861722 13:93715519-93715541 ATTCTCAGTACCTGGGTGATGGG + Intronic
1111927319 13:94477540-94477562 TCGCACACTACCTGGGTGACAGG + Intronic
1112082812 13:95993287-95993309 ATGCTCACTACCTGGGTGATGGG + Intronic
1112134547 13:96562414-96562436 ATGCTCAGTACCTGGGTGACAGG + Intronic
1112421051 13:99249116-99249138 ACGCTCACTACCTGGGTGACAGG - Intronic
1112573604 13:100615843-100615865 GTGCTCACTACCTGGATGACAGG - Intronic
1112715072 13:102174820-102174842 ATGCTCACTACCAGGGTGGCAGG + Intronic
1112752826 13:102599042-102599064 ACGCTCACTACCTGGGTGACAGG - Intronic
1113293657 13:108933691-108933713 ATGCTCAGTACCTGGGTAAAGGG - Intronic
1114353383 14:21879710-21879732 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1114368538 14:22057986-22058008 ATGCTCACTACCTGAGTGACAGG + Intergenic
1114395679 14:22358237-22358259 ATGCTCACTACCTGGGTGATGGG - Intergenic
1114434331 14:22691685-22691707 ATGCTCACTACCTGGGTGCTGGG - Intergenic
1114468212 14:22939852-22939874 ATGCTCACTAACTGGGTGACGGG + Intergenic
1114879812 14:26770166-26770188 ATGCTCACTACCTGGGCGACAGG + Intergenic
1114907226 14:27145176-27145198 ATGCTTAGTACCTGGGTGACAGG - Intergenic
1114922289 14:27347817-27347839 ATGCTCACTACCTGGATGACAGG - Intergenic
1114931327 14:27471569-27471591 TTGGTCATTACCTAGGTGGTAGG + Intergenic
1114992329 14:28301723-28301745 ATGCTCACTACCTGGGTGATGGG - Intergenic
1115012517 14:28566677-28566699 ATGCTCAGTACTTGGGTGATGGG - Intergenic
1115046412 14:29000346-29000368 ATGCTCACTACTTGGGTGACAGG + Intergenic
1115117628 14:29901388-29901410 ATGCTCACTACCTGGGTGATGGG + Intronic
1115303141 14:31906884-31906906 ATGCTCACTATCTGGGTGACAGG - Intergenic
1115653486 14:35420754-35420776 ATGCTCACTACCTGGGTGACAGG + Intergenic
1115714114 14:36083726-36083748 GTGCTTACTACCTGGGTGACAGG - Intergenic
1115781208 14:36770419-36770441 ATGCTCACTACCTGGGTGATGGG + Intronic
1115808793 14:37082278-37082300 GTGTTCAGTACCTGGGTGACAGG + Intronic
1115912335 14:38270185-38270207 ATGCTCACTACCTGGGTGGTGGG + Intergenic
1115930809 14:38491329-38491351 GTGCTCAGTACCTGGATGACAGG - Intergenic
1115959929 14:38824310-38824332 ATGCTTACTACCTGGGTGGTGGG - Intergenic
1115966758 14:38898564-38898586 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1115975641 14:38993546-38993568 ATGCTCACTACCTGGGTGATGGG + Intergenic
1116026383 14:39520449-39520471 ATGCTCAGTACCTGGGTTATGGG + Intergenic
1116043179 14:39710769-39710791 ATGCTCACTACCTGGGTGACAGG + Intergenic
1116211627 14:41953560-41953582 GTGCTCACTACCTGGGTGACAGG + Intergenic
1116253131 14:42513629-42513651 TTGCACAGTACTTGGGGGACTGG + Intergenic
1116367644 14:44087627-44087649 CTGCTCACTACCTGGGTGATGGG - Intergenic
1116746401 14:48824795-48824817 GTGCTCACTACCTGAGTGACAGG + Intergenic
1116884945 14:50211423-50211445 ATGCTCAGTACCTGGGTGATGGG - Intronic
1117023726 14:51598501-51598523 GTGCTCACTACCTGGGTGATGGG - Intronic
1117076058 14:52105859-52105881 ATGCTCAATACCTGGGTGAGGGG - Intergenic
1117166244 14:53036870-53036892 ATGCTCACTACCTGGGTGATGGG - Intronic
1117345767 14:54830615-54830637 ATGCTCAGTGCCTGGGTGACAGG - Intergenic
1118022820 14:61736431-61736453 ATGCTCACTACCTGGGTGACAGG - Intronic
1118083679 14:62390922-62390944 ATGCTCACTACCTGGGTGACAGG + Intergenic
1118207952 14:63740820-63740842 ATGCTCACTACCTGGGTGATGGG - Intergenic
1118303924 14:64638820-64638842 ATGCTCACTGCCTGGGTGACAGG + Intergenic
1118508027 14:66436892-66436914 ATGCTCAGTACTTGGGTGATGGG - Intergenic
1118522722 14:66604791-66604813 ATGCTCAGTACCTGGGTGACAGG - Intronic
1118830920 14:69431659-69431681 ATGCTCAGTGCCTGGGTGATGGG - Intronic
1119002637 14:70896729-70896751 ATGCTCACTACCTGGGTGACAGG + Intergenic
1119157411 14:72423722-72423744 TTGCTCAGTACTTGAGTGACGGG + Intronic
1119285904 14:73454100-73454122 ATGCTCACTACCTGGGTGACAGG + Intronic
1119545911 14:75471286-75471308 CTGCTCCGGCCCTGGGTGGCAGG - Intronic
1119629450 14:76214971-76214993 ATGCTCAGTACCTGGGTAACAGG - Intronic
1119943930 14:78671465-78671487 ATGCTCAGTATCTGGGTGATGGG + Intronic
1120077058 14:80170932-80170954 TAGCACAGTACATGGTTGGCAGG - Intergenic
1120175135 14:81285755-81285777 ATGCTTACTACCTGGGTGACAGG + Intronic
1120303451 14:82737462-82737484 GTGCTCAGTACTTTGGTGACAGG - Intergenic
1120307040 14:82784154-82784176 CTGCTCAGTACCTGGGTGACAGG - Intergenic
1120325643 14:83021846-83021868 ATGCTCAGTACCTCAGTAGCAGG + Intergenic
1120393701 14:83941761-83941783 GTGCTCACTACCTGGGTAACAGG - Intergenic
1120591483 14:86378994-86379016 ACGCTCAGTACCTGGGTGATGGG + Intergenic
1120664593 14:87291150-87291172 ATGCTCACTACCTGGGTGATGGG - Intergenic
1121157557 14:91700865-91700887 ATGCTCACTATCTGGGTGGTGGG + Intronic
1121177630 14:91902977-91902999 ATGCTCAGTACCTGGGTAATGGG + Intronic
1121600799 14:95201461-95201483 ATTCTCAGTACCTGGGTGATGGG + Intronic
1121946901 14:98131856-98131878 ATGCTCAGTGGCTGTGTGGCTGG + Intergenic
1122259574 14:100506007-100506029 ATGCTCAGTAACTGGGTGAAGGG - Intronic
1122763866 14:104051060-104051082 ATGCTTAGTACCTGGGTGATGGG - Intronic
1123004632 14:105315221-105315243 GTGCTCGGGACCTGGGGGGCTGG - Exonic
1202936423 14_KI270725v1_random:92220-92242 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
1123418909 15:20115110-20115132 ATGCTCAGTGCCTGGGTGACGGG - Intergenic
1123446958 15:20338401-20338423 ATGCTCAGTGCCTGGGTGACGGG + Intergenic
1123528130 15:21121649-21121671 ATGCTCAGTGCCTGGGTGACGGG - Intergenic
1123629462 15:22251120-22251142 TAGCTCTGTCCCTGGCTGGCGGG + Intergenic
1123796149 15:23772790-23772812 ATGCTCACTACCTGGGTGACAGG - Intergenic
1124248304 15:28089844-28089866 GTGCTCACTACCTGGGTGACAGG + Intronic
1125038878 15:35160093-35160115 ATGCTCACTACCTGGGTGATGGG + Intergenic
1125254797 15:37751244-37751266 ATGCTCACCACCTGGGTGACAGG + Intergenic
1125302544 15:38271848-38271870 ATGCTTACTACCTGGGTGACAGG - Intronic
1125382119 15:39097536-39097558 ATGCTCAATACCTGGGTGGTGGG - Intergenic
1125588725 15:40841096-40841118 ATGCTCACTACCTGGGTGACAGG - Intergenic
1125801633 15:42453511-42453533 TTACTGAGTACCTGAGTGTCAGG + Intronic
1126204551 15:46030360-46030382 ATGCTCAGTACCTGGGTGGCAGG - Intergenic
1126233202 15:46351993-46352015 ATGATCAGTACCTGGGTGACAGG - Intergenic
1126438414 15:48660430-48660452 ATGCTCAGCACCTGGGTGATGGG + Intergenic
1126467454 15:48973632-48973654 ATGCTCAGTACCTAGGTGATGGG + Intergenic
1126500190 15:49336798-49336820 GTGCTCACTACCTGGATGACAGG - Intronic
1126509011 15:49445212-49445234 ATGCTCAGTACCTGGGTAATGGG - Intronic
1126511306 15:49478017-49478039 ACGCTCAGTACCTGGGTGATGGG - Intronic
1126540669 15:49819164-49819186 ATGCTCAGTATCTGGGTGACAGG + Intergenic
1126543889 15:49851886-49851908 ATGCTCACTTCCTGGGTGACAGG + Intergenic
1126839459 15:52702658-52702680 ATGCTCAGTACCTGGATGACAGG + Intronic
1126928781 15:53623206-53623228 ATGCTCAGTACCTGGGTGTTGGG - Intronic
1126929898 15:53635740-53635762 ATTCTTAGTACCTGGGTGACGGG + Intronic
1127101149 15:55566177-55566199 ATGCTCAGCACCTGGGTGACAGG - Intronic
1127183223 15:56448335-56448357 GTGCTCACTGCCTGGGTGACAGG - Intronic
1127357882 15:58218420-58218442 ATGCTCAGTACTTGGGTGACAGG - Intronic
1127551156 15:60039670-60039692 TTGCTCTGTGCTTGGGAGGCTGG + Intronic
1127601593 15:60543051-60543073 TTGCTGAGAACCTGCGTGACTGG + Intronic
1128498701 15:68212212-68212234 TGGCTGTGTCCCTGGGTGGCTGG + Intronic
1128524133 15:68399851-68399873 TAGCTCACTACCTGGGTGACGGG + Intronic
1128803398 15:70512671-70512693 ATGCTTATTACCTGGGTGACAGG + Intergenic
1129134684 15:73536965-73536987 ATGCTCACTACCTGGGTGATGGG - Intronic
1129557276 15:76525463-76525485 GTGCTCACTACCTGGGTGATGGG - Intronic
1129618561 15:77121172-77121194 GTGTTCAGTACCTGGGTGATGGG - Intronic
1130752693 15:86729374-86729396 ATGCTCACTACCTGAGTGACAGG - Intronic
1131304806 15:91232815-91232837 TTGCTCACTATCTGGGTGATGGG - Intronic
1131363766 15:91819678-91819700 GTGCTAAGTACCTAGGTGCCAGG + Intergenic
1131462639 15:92629455-92629477 TAGCTGAGGACGTGGGTGGCTGG - Intronic
1131698506 15:94906936-94906958 ACAATCAGTACCTGGGTGGCGGG - Intergenic
1131818514 15:96247260-96247282 ATGCTCACTACCTGGGTGATGGG - Intergenic
1132242347 15:100267618-100267640 ATGCTCAGTACCTGGGTGATGGG - Intronic
1132255364 15:100372367-100372389 CTACTCACTACCTGGGTGACTGG + Intergenic
1132676462 16:1123239-1123261 CTGCTCAGAACTTGGGGGGCGGG - Intergenic
1133249149 16:4468827-4468849 GTGCCCACTACCTGGGTGACAGG + Intronic
1133655940 16:7863965-7863987 ATGCTCACTACGTGGGTGACAGG - Intergenic
1133657319 16:7878380-7878402 ATGCTCACTACCTGGGTGATGGG + Intergenic
1133865874 16:9642956-9642978 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1134294248 16:12931373-12931395 ATGCTCACCACCTGGGTGACAGG - Intronic
1134388704 16:13798078-13798100 ATGCTCACTACCTGGGTGGTAGG + Intergenic
1134776094 16:16855007-16855029 ATGCTGAGTACCTGGGTGACTGG - Intergenic
1135149817 16:19995629-19995651 GTGCTCACCCCCTGGGTGGCGGG - Intergenic
1135220480 16:20610792-20610814 TTGCTCAGACGCTGGCTGGCAGG + Intronic
1135220912 16:20613331-20613353 TTGCTTAGAAGCTGGCTGGCAGG + Intronic
1135291295 16:21241181-21241203 ATGCTCACTACCTGGGTGATGGG - Intronic
1135472516 16:22744006-22744028 GTGCTCACTACCTGGGTGATGGG - Intergenic
1135677773 16:24431657-24431679 ATGCTCACTTCCTGGGTGACAGG + Intergenic
1135778652 16:25279405-25279427 ATGCTCACTACCTGGGTGATGGG + Intergenic
1135790017 16:25385345-25385367 ATGCTCACTACCTGGGTAACGGG - Intergenic
1135813004 16:25606794-25606816 ATGCTCACTACCTGGGTGACAGG - Intergenic
1135853172 16:25982942-25982964 TTGAACATTAGCTGGGTGGCAGG + Intronic
1135936269 16:26782893-26782915 ATGGTCAGTACCTGGGTGACAGG - Intergenic
1136000360 16:27287848-27287870 ATGCTCAGTACCTGGGTGATGGG + Intronic
1136600732 16:31285731-31285753 ATGCTCACTACCTGGGTGATGGG - Intronic
1137314911 16:47307734-47307756 GTGCTCAGTACCTGGGTGATGGG - Intronic
1137498428 16:48990452-48990474 ATGTTCAGTACCTGGGTGATGGG + Intergenic
1137774192 16:51041823-51041845 TTGAGCAGTACCTCCGTGGCGGG - Intergenic
1137826914 16:51505879-51505901 ATGCTCACTACCTGGGTGACAGG - Intergenic
1137879926 16:52035329-52035351 TTGCTAAGGACCTGGATGCCAGG + Intronic
1137953374 16:52804948-52804970 ATGCTCAGTACTTGGGTGATGGG + Intergenic
1137967241 16:52947871-52947893 ATGCTCACTACCTGGGTGATGGG - Intergenic
1138006046 16:53338688-53338710 ATGCTCGGTACCTGGATGACAGG + Intergenic
1138268004 16:55674121-55674143 ATGCTCATTACCTGGGTGGCAGG - Intronic
1138409816 16:56830054-56830076 TTACTCAGTATCTTGGTGTCAGG - Intronic
1138503477 16:57463478-57463500 ATGCTCACTACCTGGGTGAAAGG - Intronic
1138710131 16:58961779-58961801 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1138907695 16:61357600-61357622 ATGCTCAGTATCTGGGTGATGGG + Intergenic
1138921523 16:61535872-61535894 ATGCTCACTTCCTGGGTGGTGGG - Intergenic
1138934035 16:61696990-61697012 ATGCTCATTACCTGGGTAACAGG + Intronic
1138937720 16:61749999-61750021 ATGCTGACTACCTGGGTGACAGG - Intronic
1139010663 16:62629096-62629118 GTGCTCACTACCTGGGTGATGGG - Intergenic
1139139695 16:64246251-64246273 ATGCTCAGTATCTGGGTGAAGGG + Intergenic
1139196783 16:64928781-64928803 ATGCTCACTACCTGGGTGACAGG + Intergenic
1139381169 16:66532011-66532033 ATGCTCAGTACCTAGGTGATGGG + Intronic
1139980253 16:70852162-70852184 AAGCTCAGTACCTGGGTGATGGG + Intronic
1139999005 16:71008191-71008213 ATGCTCAGTACCTGGGTGACGGG + Intronic
1140006027 16:71075970-71075992 TCTCTCAGTTCCTGTGTGGCTGG + Intronic
1140333035 16:74076228-74076250 ATGCTCACTACCTGGGTGATGGG + Intergenic
1140648101 16:77056048-77056070 AAGCTCAGTACCTGGGTGACCGG + Intergenic
1140683295 16:77406991-77407013 CTGCTCACTACCTGGGTGACAGG + Intronic
1140697266 16:77547483-77547505 ATGTTCACTACCTGGGTGACGGG + Intergenic
1140894489 16:79313177-79313199 TTGCCCAGTGCCTGTGTGCCAGG - Intergenic
1141688004 16:85581283-85581305 TTCCTCATTTCCTGGGTGGTGGG - Intergenic
1141786852 16:86206686-86206708 ATGCTCAGTACCTGGGTGATAGG + Intergenic
1203138215 16_KI270728v1_random:1743664-1743686 ATGCTCAGTGTCTGGGTGACGGG + Intergenic
1143144235 17:4763373-4763395 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1143372792 17:6450708-6450730 TAGCTCTGTACCCGGGTGCCTGG + Exonic
1143399647 17:6635846-6635868 GTGATCAGTACGTGAGTGGCAGG - Intronic
1143425807 17:6836462-6836484 CTGCTCAGGACCTTGTTGGCTGG - Intergenic
1143934105 17:10464102-10464124 ATGCTCATTACCTGGATGACAGG - Intronic
1144183504 17:12774409-12774431 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1144345293 17:14344332-14344354 ATGCTCACTACCTGGGTGATGGG - Intronic
1144613206 17:16743777-16743799 ATGCTCATTACCTGGGTGATAGG - Intronic
1144899533 17:18571531-18571553 ATGCTCATTACCTGGGTGCCAGG + Intergenic
1145121490 17:20264328-20264350 ATGCTTACTACCTGGGTGACGGG - Intronic
1145132868 17:20373850-20373872 ATGCTCATTACCTGGGTGATAGG - Intergenic
1145253169 17:21307515-21307537 CTGCTGTGTGCCTGGGTGGCTGG + Intronic
1145323402 17:21780403-21780425 CTGCTGTGTGCCTGGGTGGCCGG - Intergenic
1146822562 17:35996106-35996128 ATGCTCAGTACCTGGGTGATGGG + Intronic
1146995802 17:37320010-37320032 TTGCTCAGTCCCTGAGTAGTTGG - Intronic
1147027026 17:37595541-37595563 ATGCTCACTACCTGGGTGATGGG + Intronic
1147337677 17:39737417-39737439 TTGCTCAGAAGGTGGGGGGCGGG + Intergenic
1147391499 17:40112109-40112131 ATGCTCACTACCTGGGTGACAGG + Intergenic
1147472803 17:40679322-40679344 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1148405985 17:47416522-47416544 ATCCTCAGTACCTGGGTGATGGG - Intronic
1148841902 17:50504137-50504159 ATGCTCAGCACCTGGATGGGTGG + Intergenic
1148994105 17:51693433-51693455 ATGCTCAGTACCTTGGTGATGGG - Intronic
1148998763 17:51735433-51735455 ATGCTCAGTACCTGGGTGATGGG + Intronic
1149098216 17:52870725-52870747 ATGCTCACTACCTGGGTGATGGG + Intronic
1149136747 17:53375700-53375722 GTGCTCCGTACCTGGGTGATGGG - Intergenic
1149147722 17:53517585-53517607 ATTCTCAGTTCCTGGGTGACAGG - Intergenic
1150014479 17:61539727-61539749 ATGCTCACTACCTGGGTGATGGG - Intergenic
1150046414 17:61917676-61917698 ATGCTCATAACCTGGGTGACGGG + Intronic
1150319730 17:64202494-64202516 TTGGTCAGATCCTGGGTGGGGGG - Intronic
1150470157 17:65430585-65430607 ATGCTCAGTAAGTAGGTGGCGGG - Intergenic
1150513576 17:65782865-65782887 ATGCTCAGTAACTGGGTGACAGG + Intronic
1150829715 17:68508571-68508593 ATGCTCACTACCTGGGTGATGGG + Intergenic
1151273168 17:73012634-73012656 GTGCTGACTACCTGGGTGACAGG - Intronic
1151936005 17:77261688-77261710 GTGCTGAGTCCCTGGGTGCCAGG + Intergenic
1151951799 17:77358523-77358545 TGCCTCAGTAGCTGGGTAGCTGG - Intronic
1153198609 18:2627027-2627049 ATGCTCATTACCTGGGTGATGGG + Intergenic
1153360770 18:4194101-4194123 ATGCTCAGTACCTGGGTGAGAGG - Intronic
1153657227 18:7293683-7293705 ATGCTCAGTACATGGGTGACAGG + Intergenic
1153709258 18:7781543-7781565 ATGCTCACTACCTGGGTGATGGG - Intronic
1153719662 18:7889009-7889031 GTGCTCACTACCTGGGTGACGGG + Intronic
1154094263 18:11396134-11396156 ATACTCAGTACCTAGGTGACAGG + Intergenic
1154291255 18:13109432-13109454 ATGCTCAGTACCTGGGTGATGGG + Intronic
1154423034 18:14251461-14251483 TTGGTCAGTACCTGGCCCGCTGG + Intergenic
1154439595 18:14376587-14376609 CTGCTCACTACCTGGGTGACAGG - Intergenic
1154488146 18:14895181-14895203 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1154503600 18:15009996-15010018 ATGCTCAGTACCTTGGTGACAGG + Intergenic
1155027890 18:21958807-21958829 TTCCTCAGTTCCTTGGAGGCTGG - Intergenic
1155029752 18:21973885-21973907 GTGCTAAGTACCTGGGTGATGGG - Intergenic
1155111963 18:22724666-22724688 ATGCTCACTACCTGGGTGATGGG + Intergenic
1155230469 18:23769040-23769062 ATGCTCAGTACCTGGGTGGCAGG + Intronic
1155424276 18:25689892-25689914 GTGCTCACTACCTGGGTGATGGG + Intergenic
1155550437 18:26959368-26959390 GTGCTCAGTATCTGGGTGATGGG + Intronic
1155561403 18:27081221-27081243 TTCCTGAGTAGCTGGGTAGCTGG - Intronic
1155562982 18:27100309-27100331 ATGCTCAGTATCTGGGTGATGGG + Intronic
1155852058 18:30786346-30786368 ATGTTCACTACCTGGGTGACAGG - Intergenic
1155927101 18:31668360-31668382 ATGCTCACTACCTAGGTGGCAGG + Intronic
1155937667 18:31770986-31771008 CTGCTCAGTACCTGGGTGATGGG + Intergenic
1156356777 18:36348904-36348926 ATGCTCTGCACCTGGATGGCAGG - Intronic
1156436410 18:37134797-37134819 ATTCTCAGTACCTGGGTGATAGG - Intronic
1156766074 18:40657073-40657095 ATGCTCAGTACCTGAGTGAAGGG + Intergenic
1156950354 18:42888956-42888978 ATGCTCAGTATCAGGGTGACAGG + Intronic
1156994898 18:43453223-43453245 CTGCTCACTACCTGGGTGATGGG - Intergenic
1157039080 18:44016919-44016941 ATGCTCACTAACTGGGTGACAGG - Intergenic
1157333434 18:46720224-46720246 CTGCTCACCACCTGGGAGGCAGG + Intronic
1157473146 18:48005153-48005175 ATGCTCACTACCTGGGTGATGGG - Intergenic
1157960746 18:52150962-52150984 ATGCTCACTACCTGTGTGACAGG - Intergenic
1158340739 18:56463282-56463304 ATGCTCAGTACCTGGGTGGCAGG + Intergenic
1158709588 18:59825544-59825566 ATGCTCACTACCTGGGTGCCGGG - Intergenic
1159221965 18:65476645-65476667 ATGTTCAGTATCTGGGTGACAGG + Intergenic
1159380203 18:67646540-67646562 GTGCTCAGTACCTGGGTGACAGG + Intergenic
1159384316 18:67703737-67703759 ATGCTCACTAGCTGGGTGACTGG - Intergenic
1159396435 18:67864121-67864143 ATGCTCACTACCTGGGTGATGGG + Intergenic
1159410671 18:68071546-68071568 ATGCTTCGTACCTGGGTGACAGG + Intergenic
1159414514 18:68126623-68126645 ATGCTCAGTGCCTAGGTGACGGG + Intergenic
1159430093 18:68340302-68340324 ATTCTCAGTACCTGGGTGACAGG + Intergenic
1159458136 18:68688948-68688970 ATGCTTATTACCTGGGTGACGGG + Intronic
1159800177 18:72889171-72889193 TTGCTCAGTACCGTGGGGGTGGG - Intergenic
1160016554 18:75145813-75145835 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1160183246 18:76654290-76654312 CTGCTCAGTACCTGGCTCCCTGG - Intergenic
1160183861 18:76659761-76659783 TTGCTCAGTCGCAGGGAGGCTGG + Intergenic
1160360854 18:78276892-78276914 GTGCTCAATACCTGGGTTACAGG - Intergenic
1160582261 18:79890413-79890435 GTGCTTGGTACCTGGGTGACAGG - Intronic
1160879340 19:1312483-1312505 TTCCCCAGCACCTGGGAGGCAGG - Intergenic
1161135522 19:2617332-2617354 GGGCTCAGTGCCTGGATGGCTGG - Intronic
1161501694 19:4619729-4619751 TGCCTCAGTACCTGGGAGGCAGG - Intergenic
1162597345 19:11639667-11639689 TCGCTCAGTGCCTAGGGGGCGGG + Intergenic
1163645694 19:18487881-18487903 GTGCTCAGAACCTGGCTGGCAGG + Intronic
1164435513 19:28225251-28225273 ATGCTCACTACCTGGGTGAAGGG - Intergenic
1164443398 19:28297377-28297399 GTGCTCACTACCTGGGTGATGGG + Intergenic
1164447198 19:28328077-28328099 ATGCTCACTACCTGGGTGATGGG - Intergenic
1164620852 19:29695264-29695286 TGTCTCAGTATCTGGGTGTCAGG - Intergenic
1164694354 19:30232376-30232398 ATGCTCACTACCTGGGTGACGGG - Intronic
1164850669 19:31480631-31480653 ATGCTCACTACCTGGGTGATGGG + Intergenic
1165082708 19:33318502-33318524 GTGCTCACTACCTGGGTGATGGG + Intergenic
1165368302 19:35384071-35384093 CTGCTTAATACCAGGGTGGCAGG - Intergenic
1165643281 19:37408450-37408472 GTGCTCAGTACGTGGGTGGCAGG - Intergenic
1165661935 19:37588610-37588632 CTGCTCACTACCTGGGTGACTGG + Intronic
1165663150 19:37600269-37600291 ATGCTCAGTACCTGGGTGGTGGG + Intronic
1166391699 19:42412187-42412209 TTGTTCAGGACCTGGGTGACAGG - Intronic
1166599761 19:44083717-44083739 ATGCTCAGTACCTGGGTGACAGG - Intronic
1166681592 19:44770998-44771020 ATGCTCAGTACCTGGGTGACGGG - Intergenic
1167133927 19:47605781-47605803 ATGCTCAGTACCTAGGTGACGGG - Intergenic
1167653478 19:50747071-50747093 ACGCTCAGTACCTGGGTGGTGGG + Intergenic
1168210227 19:54884725-54884747 ATGCTCAGTACCTGGGTGACAGG + Intronic
1202684125 1_KI270712v1_random:33272-33294 TTGCTCAGAACCTGGCTTGCAGG - Intergenic
1202687343 1_KI270712v1_random:58590-58612 TGGCTCACTGGCTGGGTGGCTGG + Intergenic
1202687371 1_KI270712v1_random:58706-58728 TGGCTCACTGGCTGGGTGGCTGG + Intergenic
1202688424 1_KI270712v1_random:68430-68452 ATGCTCAGTGCCTGGGTGACGGG - Intergenic
1202688656 1_KI270712v1_random:70593-70615 ATGCTCACTACCTGGGTGATGGG - Intergenic
1202699758 1_KI270712v1_random:155376-155398 ATGCTCATTACCTGGGTGACGGG - Intergenic
925843670 2:8016741-8016763 TTGCTCAGCAACTGGCTTGCTGG - Intergenic
925954406 2:8948430-8948452 ATGCTCAGTACCTGGGTGAGGGG - Intronic
925992788 2:9267238-9267260 ATGCTCAGTACCTGGGTGATGGG - Intronic
926183323 2:10665977-10665999 ATGCTCACTGCCTGGGTGACGGG - Intronic
926382747 2:12306719-12306741 ATGCTCACTACCTGCGTGACCGG + Intergenic
926593828 2:14768245-14768267 ATGCTCAGTACCCGGGTGATGGG - Intergenic
926736225 2:16075068-16075090 GTGCTCACTACCTGGGTGCTGGG - Intergenic
926737918 2:16088307-16088329 ATGCTTAGTACCCGGGTGGCAGG + Intergenic
926753814 2:16220339-16220361 TAGCACAGTACCTGGCAGGCGGG - Intergenic
926821586 2:16857259-16857281 ATGCTCGCTACCTGGGTGACAGG - Intergenic
926911851 2:17858825-17858847 ATGCTCAGTACCTGGGTGATAGG - Intergenic
926916496 2:17896982-17897004 ATGCTCACTACCTGGGTAACTGG - Intronic
926963595 2:18386198-18386220 GTACTAAGTACCTGGGTGACAGG + Intergenic
927105711 2:19821965-19821987 CTGCTCAGCATGTGGGTGGCTGG + Intergenic
927224604 2:20751044-20751066 ATGCTCACTACCTGGGTCACAGG + Intronic
927237475 2:20887470-20887492 ATGCTTATTACCTGGGTGACAGG - Intergenic
927617200 2:24611044-24611066 ATGCTCACTACCTGGGTGACAGG - Intronic
927745213 2:25613336-25613358 GTGCTCACTACCTGGGTGATAGG - Intronic
928485385 2:31725823-31725845 GTGCTCACTACCTGGGTGACAGG + Intergenic
928866583 2:35924144-35924166 ATGCTCACTACCAGGGTGACAGG + Intergenic
928875770 2:36037187-36037209 ATGCTCAGTACCTGGGTGATGGG + Intergenic
928931872 2:36633270-36633292 ATGCTCAGTACTTGGGTGATGGG - Intronic
929367792 2:41181857-41181879 ATGCTCAGTGCCTGGGTGATAGG - Intergenic
929373531 2:41256057-41256079 ATGATCACTACCTGGGTGACAGG + Intergenic
929654835 2:43720381-43720403 ATGCTCACTACCTGGGTGATGGG - Intronic
929752076 2:44725936-44725958 ATGCTCACTACCTGGGTGATGGG - Intronic
929975091 2:46626038-46626060 ATGCTCACTACCTGGGTGACAGG - Intergenic
929975500 2:46630458-46630480 ATGCTCACTACCTGGGTGTCGGG - Intergenic
930000823 2:46860448-46860470 CTGCTCTGGACCTGGGAGGCTGG - Intergenic
930283920 2:49404309-49404331 TTGCTCAGTAAGTGGGAGGCAGG + Intergenic
930486696 2:52019248-52019270 GTGCTCACTACCTGGGTGACAGG - Intergenic
930615120 2:53585511-53585533 ATTCTCAGTACCTGGGTGATGGG - Intronic
930836438 2:55798801-55798823 ATGCTCACTACCTGGGTGATGGG + Intergenic
931534205 2:63254274-63254296 TTGCTTACTACCTGGGTGATGGG + Intronic
931813309 2:65875950-65875972 ATGCTCAGTACCTGGGTGATGGG - Intergenic
932092613 2:68819539-68819561 TTGCTCAGTCACTGGGTGATTGG - Intronic
932105641 2:68938879-68938901 ATGCTCAGTACCTGGGTGATGGG - Intergenic
932503676 2:72208175-72208197 GTGCTCACTACCTGGGTGATGGG - Intronic
932724252 2:74164402-74164424 TGCCTCAGTCCCTGGGTAGCTGG - Intronic
932971068 2:76542759-76542781 ATGTTCACTACCTGGGTGACAGG + Intergenic
933538707 2:83610867-83610889 ATGCTTAGTAGCTGGGTGACAGG - Intergenic
933918202 2:87017969-87017991 TAGCTCACTACCTGGGTGATGGG + Intronic
933957774 2:87385492-87385514 ATGCTCACTACCTGGGTGATGGG + Intergenic
933957999 2:87387503-87387525 ATGCTCAGCGCCTGGGTGACGGG + Intergenic
934004792 2:87751944-87751966 TAGCTCACTACCTGGGTGATGGG - Intronic
934066807 2:88348896-88348918 ATGCTCAGTACCTGGGTGGTGGG + Intergenic
934082127 2:88477808-88477830 ATACTCAGTACCTGGGTGAGGGG - Intergenic
934170701 2:89538864-89538886 ATGCTCATTACCTGGGTGACGGG - Intergenic
934241895 2:90277409-90277431 ATGCTCACTACCTGGGTGATGGG + Intergenic
934242121 2:90279421-90279443 ATGCTCAGCGCCTGGGTGACGGG + Intergenic
934243055 2:90288625-90288647 TGGCTCACTGGCTGGGTGGCTGG - Intergenic
934247596 2:90321580-90321602 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
934261728 2:91481021-91481043 TTGCTCAGAACCTGGCTTGCAGG - Intergenic
934270058 2:91527779-91527801 TGGCTCACTGGCTGGGTGGCTGG + Intergenic
934271052 2:91537267-91537289 ATGCTCAGCGCCTGGGTGACGGG - Intergenic
934271277 2:91539279-91539301 ATGCTCACTACCTGGGTGATGGG - Intergenic
934281004 2:91613184-91613206 ATGCTCATTACCTGGGTGGCGGG - Intergenic
934304769 2:91812000-91812022 TTGCTCAGAACCTGGCTTGCAGG - Intergenic
934328488 2:92040750-92040772 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
934466863 2:94271256-94271278 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
934549576 2:95248392-95248414 ATGCTCAGCACCTTGGTGACAGG + Intronic
934950949 2:98575044-98575066 GGACTCAGTACCTGAGTGGCTGG - Intronic
935280328 2:101511799-101511821 ATGCTCACTACCTGGGTGATGGG + Intergenic
935477562 2:103542030-103542052 ATGCTCAGTATGTGGGTGACAGG + Intergenic
935611381 2:105029367-105029389 ATGCTCAGTGCCTGGGTGATGGG + Intergenic
935727004 2:106032221-106032243 ATGCTCAGTACCTGGATGGTGGG - Intergenic
935767750 2:106385977-106385999 TAGCTCACTACCTGGGTGATGGG - Intergenic
936439542 2:112539218-112539240 GTGCTCGCTACCTGGGTGACAGG + Exonic
936667042 2:114608940-114608962 ATGCTCAGTACCTGTGTGATGGG + Intronic
936717547 2:115205927-115205949 GTGCTCACTACCTGGGTGATGGG + Intronic
936745472 2:115571323-115571345 ATGTTCAGTACCTGGGTGACAGG - Intronic
936783757 2:116067600-116067622 CTGCTCAGTATCTGGGTGACAGG + Intergenic
936928798 2:117765329-117765351 ATGCTCAGTACCTGAGTGATGGG + Intergenic
937000797 2:118465601-118465623 ATGCTCACTACCTGGGTGACAGG - Intergenic
937513685 2:122628435-122628457 TTGCACCTTACCTGGGTGGAAGG - Intergenic
937810172 2:126190557-126190579 ATCCTCACTACCTGGGTGGCAGG - Intergenic
937970996 2:127549406-127549428 ACGCTCACTACCTGGGTGACGGG - Intronic
938129307 2:128697528-128697550 ATGCTCAGTACCTGGGTGATAGG - Intergenic
938275610 2:130018761-130018783 TTGCTCTGTGCCTGGGGAGCAGG - Intergenic
938326554 2:130409467-130409489 TTGCTCTGTGCCTGGGGAGCAGG - Intergenic
938363383 2:130711983-130712005 TTGCTCTGTGCCTGGGGAGCAGG + Intergenic
938398250 2:130966119-130966141 TTCCTCAGTGCCTCTGTGGCTGG - Intronic
938439757 2:131318569-131318591 TTGCTCTGTGCCTGGGGAGCAGG + Intronic
938502774 2:131840127-131840149 ATGCTCACTACCTTGGTGACAGG + Intergenic
938515575 2:132002628-132002650 ATGCTCAGTACCTGGGCGACGGG - Intergenic
938618442 2:133023539-133023561 ACGCTCAGTACCTGGGTGATGGG - Intronic
938632570 2:133184059-133184081 GTGCTCACTACTTGGGTGACAGG - Intronic
938755170 2:134372759-134372781 TTGCTTATTGCGTGGGTGGCTGG + Intronic
938788759 2:134657905-134657927 ATGCTCATTACCTGGGTGATGGG + Intronic
938810769 2:134850881-134850903 ATGCTCACTAACTGGGTGGCGGG - Intronic
939370726 2:141296807-141296829 ATGCTCAGTACCTGGGTAATGGG - Intronic
939430343 2:142096816-142096838 ATGCTCAGTACCTGGGTGATGGG - Intronic
939441426 2:142255383-142255405 GTGCTCACTACCTGGGTGACAGG - Intergenic
939503639 2:143016835-143016857 GTGCTCAGTACCTAGGTGATGGG - Intronic
939757077 2:146127872-146127894 ATGCTCACTACCTGTGTGACGGG - Intergenic
940059775 2:149552226-149552248 ATGCTCACTACCTTGGTGACAGG - Intergenic
940081056 2:149801858-149801880 AAGCTCAGTACCTGGGTGATGGG - Intergenic
940092019 2:149931320-149931342 ATGCTCAGTGCCTGGGTGACAGG + Intergenic
940103793 2:150074105-150074127 ATGCTCACTACCTGTGTGACAGG + Intergenic
940541449 2:155025239-155025261 ATGCTCATTACCTGGGTGAGGGG - Intergenic
940571228 2:155437340-155437362 ATGCTCAGTACTTGAGTGACAGG - Intergenic
940644643 2:156378043-156378065 ATGCTCAGTACCTGGGTGATGGG - Intergenic
940699928 2:157028017-157028039 ATGCTCAGTACATGGGTGACAGG + Intergenic
940779095 2:157914404-157914426 TTGCTCGCTACCTGGGTGATGGG + Intronic
941063094 2:160870059-160870081 ATGCTCACTACCTGAGTGACAGG + Intergenic
941121450 2:161535188-161535210 ATGCTCACTACCTGGGTGACAGG + Intronic
941132566 2:161671585-161671607 ATGCTCACCACCTGGGTGACAGG + Intronic
941139237 2:161757160-161757182 GTGCTCCCTACCTGGGTGACAGG + Intronic
941514104 2:166450363-166450385 TCGCTCACTACCTGGGTGATAGG + Intronic
941587098 2:167373949-167373971 ATGTTCAGTATCTGGGTGACGGG - Intergenic
941680841 2:168397245-168397267 ATGCTCACTACTTGGGTGACAGG - Intergenic
941941976 2:171049177-171049199 ATGCTCACTACCTGAGTGGTGGG + Intronic
942288942 2:174450370-174450392 ATGCTTAGTACCTGGGTGATGGG + Intronic
942588665 2:177516019-177516041 ATGCTCACTACCTGGGTGATAGG + Intronic
942628908 2:177935003-177935025 ATGCTCAGTACCTGAGTGACAGG + Intronic
942635655 2:178002006-178002028 ATGCTCAGTACCTAGGTGATGGG - Intronic
942664698 2:178304851-178304873 TTACTAAGTACCAGGGTGTCTGG - Intronic
942746832 2:179243806-179243828 TTACTCACTACCTGGGTGACAGG + Intronic
942755152 2:179331847-179331869 ATGCTCGGTACCTGGGTGATAGG + Intergenic
942833775 2:180267631-180267653 ATGCTCAGTTCCTGGGTGACAGG - Intergenic
943121027 2:183735915-183735937 ATCCTCAGTACCTGGGTGATGGG - Intergenic
943147096 2:184059676-184059698 ATGCTCACTACCTGGGTGATGGG - Intergenic
943198829 2:184792865-184792887 ATGCTCACTACCTGGGTGACGGG - Intronic
943244780 2:185433071-185433093 GTGCTCACTACCTGGGTGATGGG - Intergenic
943395724 2:187330130-187330152 ATGCTCACTATCTGGGTGACAGG + Intergenic
943527648 2:189038123-189038145 ATGCTCACTACCTGGGTGACAGG - Intronic
943860346 2:192854131-192854153 GTGCTCACTCCCTGGGTGACAGG - Intergenic
943875162 2:193058176-193058198 ATTCTCACTACCTGGGTGACAGG - Intergenic
943897886 2:193390708-193390730 ATGCTCACTACCTGGGTGGCAGG - Intergenic
944070597 2:195663893-195663915 ATGCTCAGTACCTGGATGACAGG - Intronic
944081378 2:195792262-195792284 ATGCTCACTACCTGGGTGACAGG + Intronic
944092723 2:195931082-195931104 ATGCTCAGTACCTGGGTGATGGG + Intronic
944259858 2:197665047-197665069 ATGCGCACTACCTGGGTGACTGG + Intronic
944361022 2:198856629-198856651 ATGCTCAGCACCTGGGGGACAGG + Intergenic
944475714 2:200103434-200103456 ATGCACAGTACCTGGGTGGTGGG - Intergenic
944947136 2:204701832-204701854 TTGCTCAGTACCTGGATGACAGG - Intronic
945190369 2:207181406-207181428 ATGCTCAGTACCTGGGTGATGGG + Intergenic
945193258 2:207212411-207212433 ATGCTCAGTACCTGGGTGTTGGG + Intergenic
945308037 2:208278497-208278519 ATACTCACTACCTGGGTGACAGG - Intronic
945328094 2:208506537-208506559 ATGCTCACTACCTGGGTGACTGG - Intronic
945332513 2:208556485-208556507 ATGCTCAGTATCTGGGTGATGGG - Intronic
945416806 2:209583867-209583889 ATCCTCAGTACCTGGGTGACAGG - Intronic
945606223 2:211935617-211935639 TGGCTCAGCACCTCGGAGGCTGG - Intronic
945629619 2:212257009-212257031 ATGCTTACTACCTGGGTGGTGGG - Intronic
945680641 2:212909831-212909853 ATGCTCACTTCCTGGGTGACGGG + Intergenic
945929313 2:215839507-215839529 TAGTTCAGGAGCTGGGTGGCTGG + Intergenic
946082700 2:217137772-217137794 CTGCTCACTACCTGGGTGATGGG - Intergenic
946549021 2:220779865-220779887 ATGCTCACTACCTGGCTGACAGG + Intergenic
946589663 2:221230957-221230979 ATGCTCACTATCTGGGTGACAGG + Intergenic
946746559 2:222852366-222852388 GTGCTCATTACCTGGGTGACAGG + Intergenic
947103646 2:226647169-226647191 ATGCTCACTACTTGGGTGGTGGG - Intergenic
947390153 2:229630729-229630751 ATGCTCACTACCTGGGTGATGGG - Intronic
947438557 2:230095451-230095473 CAGCTGAGTACCTGGGTGACAGG - Intergenic
947891499 2:233625834-233625856 ATGCTCAGTACTTGGGTGATGGG + Intronic
947896449 2:233678211-233678233 ATGCTCAGTACTTGGGTGATGGG + Intronic
948386604 2:237584691-237584713 GAGCTTTGTACCTGGGTGGCTGG - Intronic
948509113 2:238451284-238451306 TTGCTCAGTGCCTGGATTGCAGG + Exonic
948532994 2:238625038-238625060 GTGTTCACTACCTGGGTGGATGG + Intergenic
948557110 2:238820643-238820665 AAGCTCAGTACCTGGGTGATGGG + Intergenic
948637025 2:239345129-239345151 TTGCTCAGAAACAAGGTGGCGGG - Intronic
948745654 2:240091442-240091464 ATGCTAAGTACCTGGGTGATGGG + Intergenic
948773431 2:240265369-240265391 ATGCTCATTACCTGGGTGATGGG - Intergenic
1168979985 20:1996069-1996091 TTCCTCCCTCCCTGGGTGGCTGG - Intergenic
1169509911 20:6252263-6252285 ATGCTCAGTACCTAGGTGACAGG + Intergenic
1169649520 20:7851435-7851457 TGGCTCATTACCTGTGTGGTGGG + Intergenic
1169709374 20:8544070-8544092 ATGCTCACAACCTGGGTGACAGG + Intronic
1169839029 20:9913906-9913928 ATGCTCAGTACCTGGGTTATGGG - Intergenic
1169861382 20:10156478-10156500 ATGCTCACTACCTGGGTGACTGG - Intergenic
1169944416 20:10973741-10973763 ATGCTGAGTACCTGGGTAACAGG - Intergenic
1169956127 20:11104877-11104899 ATGCTCAGTACCTGGTTGATGGG + Intergenic
1169983597 20:11416085-11416107 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1170234733 20:14089971-14089993 ATGCTCATTACCTAGGTGACAGG - Intronic
1170261191 20:14410322-14410344 ATGCTCACTACCTGGGTGACAGG - Intronic
1170409208 20:16070201-16070223 ATGCTCAGTACCTGGGTGAAGGG - Intergenic
1170859223 20:20087229-20087251 ATGCTCAGTACCTGGGTGATGGG - Intronic
1170902470 20:20478757-20478779 AAGCTCAGTACCTGGGTGACAGG + Intronic
1171195720 20:23197246-23197268 ATTCTCAGTACCTGGGTGATGGG + Intergenic
1171222372 20:23410583-23410605 ATGCTCAGTATCTGGGTGACAGG + Intronic
1171239585 20:23554179-23554201 ATGCTCACTACCTGGGTGATAGG - Intergenic
1171322997 20:24263220-24263242 ATGCTCAGTACCTGCGTGATGGG - Intergenic
1172511811 20:35505859-35505881 ATGCTGAGGACCTGGGTGGTGGG + Intronic
1172692138 20:36797296-36797318 TAGCCCAGTCCCTGGGTGGTTGG + Intronic
1172942221 20:38661973-38661995 ATGCTCACTACCAGGGTGACAGG + Intergenic
1173035969 20:39410696-39410718 ATGCTCACTACCCGGGTGACAGG + Intergenic
1173185284 20:40835865-40835887 ATGCTCAGCACCTGGGGGCCAGG - Intergenic
1173214030 20:41063035-41063057 ATGCTCAGTACCTGGGTGACAGG - Intronic
1173271545 20:41540667-41540689 TTGCTCACTACTTGGGTTGGAGG - Intronic
1174261802 20:49301572-49301594 TTGCTCGCTACCTGGATGACAGG - Intergenic
1174261824 20:49301650-49301672 TTGCTCACTACCTGGATGACAGG - Intergenic
1174667437 20:52272975-52272997 ATGCTCACTACCTGAGTGGTGGG + Intergenic
1175048648 20:56131758-56131780 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1175193626 20:57227587-57227609 TTACTCAGTGGCTGGGTTGCTGG - Intronic
1175332649 20:58175903-58175925 TTGTTCTGTCCCTGGGTGACGGG + Intergenic
1175616295 20:60402423-60402445 CTGCTGAGCACCTGGGTGGCTGG - Intergenic
1176037744 20:63048623-63048645 TTGCTCAGGACCTGGGTGCTGGG + Intergenic
1176076361 20:63250123-63250145 TGGCCCAGTACCTGGCTGGCGGG - Intronic
1176456148 21:6913151-6913173 CTGCTCACTACCTGGGTGACAGG + Intergenic
1176587075 21:8597379-8597401 TTGCTCAGAACCTGGCTTGCAGG - Intergenic
1176713239 21:10326579-10326601 ATGTTCAGTACCTGGGTGTTGGG - Intergenic
1176778211 21:13160299-13160321 ATGCTCAGTACCTGGGAGATGGG + Intergenic
1176793128 21:13344152-13344174 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1176834321 21:13778199-13778221 CTTCTCACTACCTGGGTGACAGG + Intergenic
1176850425 21:13908487-13908509 TTGGTCAGTACCTGGCCCGCTGG - Intergenic
1176978447 21:15351486-15351508 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1177047613 21:16189991-16190013 ATACTCACTACCTGGGTGACAGG - Intergenic
1177121119 21:17138170-17138192 ATGCTCACTACCTGGGTGACAGG + Intergenic
1177236823 21:18401632-18401654 ATGCTCAGTACCTGGGTGATGGG + Intronic
1177507290 21:22035318-22035340 ATGCTCACTACCTGGGTGATGGG - Intergenic
1177536206 21:22431511-22431533 ATGCCCACTACCTGGGTGACAGG - Intergenic
1177690452 21:24499906-24499928 ATGCTCAGTACCTCAGTGACTGG - Intergenic
1177708586 21:24740865-24740887 ATGCTCATTATCTGGGTGACAGG - Intergenic
1177715656 21:24837082-24837104 ATGCTCACTACCTGTGTGCCAGG - Intergenic
1177975830 21:27849310-27849332 ATGCTCAGTACCTGGGAGATGGG + Intergenic
1178051092 21:28748163-28748185 ATGCTCACTACCTGGGTGACAGG + Intergenic
1179210948 21:39323881-39323903 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1179254993 21:39707774-39707796 ATGCTCACTACCTGGGTGATAGG + Intergenic
1179648310 21:42789557-42789579 ATGCTCAGTACCTGGGTGACGGG + Intergenic
1179648318 21:42789620-42789642 ATGCTTAGTACCTGGGTGATGGG + Intergenic
1180184074 21:46130972-46130994 TTGCTCACTGCCTGCGGGGCTGG + Intronic
1180269904 22:10574376-10574398 TTGCTCAGAACCTGGCTTGCAGG - Intergenic
1180362404 22:11912205-11912227 TTGGTCAGTACCTGGCCTGCTGG + Intergenic
1180552819 22:16554325-16554347 ATGCTCACTACCTGGGTGATGGG + Intergenic
1180553064 22:16556589-16556611 ATGCTCAGTGCCTGGGTGACGGG + Intergenic
1180588002 22:16910487-16910509 TTGCTCGGAACCTGGCTTGCAGG + Intergenic
1180647441 22:17351276-17351298 TTGCTCATTGCCTGGGTGAGTGG - Intergenic
1180750378 22:18120225-18120247 ATGCTCATTACCTGGGTGACAGG - Intronic
1180829622 22:18897161-18897183 ATGTTCAGTACCTGGGTGTTGGG - Intergenic
1181329269 22:22076556-22076578 TTGCACAGTACCAGGGGTGCTGG + Intergenic
1181351024 22:22257839-22257861 ATGCTCAGTGCCTGGGTGACGGG - Intergenic
1181504478 22:23342832-23342854 ATGCTCACTACCTGGGTGACGGG - Intergenic
1181655593 22:24295444-24295466 ATGCTCACTACCTGGGTGACGGG - Intronic
1181709475 22:24673063-24673085 ATGCTCACTACCTGGGTGACGGG - Intergenic
1181817983 22:25453700-25453722 TTGCTCACTGCCTGGGTGACGGG - Intergenic
1182750437 22:32637572-32637594 ATGCTCAGTACCTGAGTGACAGG - Intronic
1182816068 22:33165048-33165070 ATGCTCACTACCTGAGTGACGGG + Intronic
1183228999 22:36569305-36569327 TGGTTCACTAGCTGGGTGGCAGG - Intronic
1183254924 22:36756182-36756204 TTTGTCAGTACCTGGCTGGCTGG + Intergenic
1184311604 22:43648608-43648630 ATGCTCACTACCTGGGTGGCGGG + Intronic
1184323638 22:43764150-43764172 ATGCCCACTACCTGGGTGACAGG - Intronic
1184493791 22:44825756-44825778 CTGCTCAGTGCCTGGTTGGGGGG + Intronic
1184515782 22:44961356-44961378 GTGCTCACTACCTGGGTGACAGG - Intronic
1185299902 22:50074150-50074172 CTGCTCAGATCCTGCGTGGCTGG - Intronic
1203279713 22_KI270734v1_random:122433-122455 ATGTTCAGTACCTGGGTGTTGGG - Intergenic
949201016 3:1379471-1379493 GTGCTCACTACCTGGGTGACGGG + Intronic
949218848 3:1605320-1605342 ATGCTCACCACCTGGGTGACAGG - Intergenic
949421425 3:3870413-3870435 GTGCTCATTACCTGGGTGATGGG - Intronic
949653022 3:6182870-6182892 GTGCTCACTACCTGGGTGACAGG + Intergenic
949659289 3:6259038-6259060 ATGCTCACTTCCTGGGTGACAGG - Intergenic
949668129 3:6365239-6365261 ATGCTCACTACCTGGGTGACGGG + Intergenic
949702581 3:6776248-6776270 ATGCTCACTACCTGGGTGATGGG - Intronic
950393061 3:12711828-12711850 ATGCTCAGTACCTGGGTGACTGG - Intergenic
950608198 3:14103418-14103440 ATGCTCACTACCTGGGTGACAGG + Intergenic
950657614 3:14446455-14446477 GTGTTCACTACTTGGGTGGCAGG + Intronic
950849294 3:16047611-16047633 ATGCACTGTACCTGGGTGACAGG - Intergenic
950945401 3:16940539-16940561 GTGCTCACTACCTGGGTGACAGG + Intronic
951424677 3:22530183-22530205 GTGCTCATTACCTGGGTTACAGG + Intergenic
951631932 3:24731472-24731494 ATGCTCCGTACCTGGGTAGTGGG + Intergenic
951646204 3:24894207-24894229 ATGCTCACTACCTGGGTGATAGG - Intergenic
952019181 3:28996618-28996640 ATGCTCAGTTCCTGGGTGATGGG + Intergenic
952128759 3:30334707-30334729 ATGCTTGGTACCTGGGTGGTGGG + Intergenic
952141590 3:30485028-30485050 ATGCTCAGTACTTGGGTGAAAGG + Intergenic
952280208 3:31915653-31915675 ATGCTCAGTGCCTAGGTGACAGG + Intronic
952305425 3:32141888-32141910 ATGCTCACTACCTGGGTGACAGG - Intronic
952613763 3:35244263-35244285 TTGCTCACTACCCGGGTGATGGG + Intergenic
952693418 3:36237153-36237175 ATGCTCACTACCTAGGTGACAGG + Intergenic
953109946 3:39925424-39925446 ATGCTCACTACCTGGGTGATGGG - Intronic
953247789 3:41211478-41211500 ATGCTCACTACCTGGGTGACTGG - Intronic
953267397 3:41405067-41405089 ATATTCAGTACCTGGGTGACGGG - Intronic
953304733 3:41817673-41817695 ATGCTCACTACCTGGGTGACAGG + Intronic
953541735 3:43825471-43825493 GTGCTCACTACCTGGGTACCAGG - Intergenic
955021572 3:55126674-55126696 TAATTCAGTACCTGGGTGACGGG + Intergenic
955151098 3:56368057-56368079 ATGCTCAGTACCTGGGTGACGGG + Intronic
955563166 3:60215069-60215091 ATACTCACTACCTGGGTGACAGG + Intronic
955648312 3:61164735-61164757 ATTCTCAGTACCTGGATGACAGG - Intronic
955896054 3:63701122-63701144 ATGCTCACTACCTGGGTGATAGG + Intergenic
955937887 3:64120107-64120129 ATGCTCAGTACCTGGGTGACAGG + Intronic
955968906 3:64417241-64417263 ATGCTCACTACCTGGGTGACAGG + Intronic
956112587 3:65884686-65884708 GTGTTCATTACCTGGGTGACAGG - Intronic
956135955 3:66099101-66099123 ATGCTTAGTACCTGAGTGACAGG - Intergenic
956261059 3:67342041-67342063 ATGCTCACTACCTGGGTGATGGG + Intergenic
956428156 3:69157967-69157989 ATGCTCACTACCTGGGTGGCAGG + Intergenic
956554529 3:70503853-70503875 TGGCTCAGTACCTGGATGACGGG + Intergenic
956611130 3:71124026-71124048 ATGCTCGGTACCTGGGTGTCGGG + Intronic
956864979 3:73360613-73360635 ATACTCAGTACCTGGGTGATGGG + Intergenic
957123283 3:76124938-76124960 ATGCTCAGTACCTGGGTGATGGG - Intronic
957366764 3:79234873-79234895 ATGCTCATTACCTGAGTGACAGG + Intronic
957370133 3:79283271-79283293 ATGCTCACTACCTGGGTGATGGG + Intronic
957400059 3:79699929-79699951 ATGCTCAGTACCTGGGTGACAGG - Intronic
957580077 3:82060743-82060765 ATGCTCACTACCTGGGTGACAGG - Intergenic
957588303 3:82160993-82161015 ATGCTCAGTACCTGGGTGATGGG + Intergenic
957628660 3:82688906-82688928 ATGCTCACTACCTGGGTGATGGG + Intergenic
957655954 3:83075581-83075603 ATGCTCACTACCTGTGTGACAGG + Intergenic
957668505 3:83268868-83268890 ATGCTCACTACCTGGGTGACAGG - Intergenic
957772832 3:84716499-84716521 ATGGTCACTACCTGGGTGACAGG + Intergenic
957830576 3:85512096-85512118 CTGCTCACTACCTGGGTGATGGG - Intronic
957992086 3:87639117-87639139 ATGCTCAGTACCTGTGTGATGGG - Intergenic
958174004 3:89972186-89972208 ATGCTCACTACCTGGATGACAGG + Intergenic
958254106 3:91304925-91304947 ATGTTCAGTACCTGGGTGATGGG - Intergenic
958517192 3:95132087-95132109 ATGCTCACTATCTGGGTGACAGG + Intergenic
958559530 3:95728148-95728170 CTGCTCACTACCTGGGTGATGGG - Intergenic
958656732 3:97011739-97011761 ATGCTCACTACCTGGGTGATGGG - Intronic
958705672 3:97651947-97651969 ATGCTCACTACCTGGGTGGTGGG - Intronic
958871555 3:99564890-99564912 ATGCTCACAACCTGGGTGACAGG - Intergenic
959083823 3:101830425-101830447 ATGATCAGTACCTGGGTGATGGG - Intronic
959249318 3:103920970-103920992 ATGCTTACTACCTGGGTGACGGG + Intergenic
959256039 3:104015281-104015303 GTGCTCATTACCTGGATGACAGG + Intergenic
959298638 3:104571641-104571663 ATGCTCAGGACCTGGGTGATGGG - Intergenic
959324068 3:104913722-104913744 ATGATCAGTACCTGTGTGACAGG + Intergenic
959541841 3:107549040-107549062 ATGCTCACCACCTGGGTGACAGG + Intronic
959678566 3:109066073-109066095 ATGCTCATTAGCTGGGTGACAGG + Intronic
959738501 3:109688816-109688838 ATGCTCAGTACCTGGGTGATGGG - Intergenic
959771046 3:110096743-110096765 ATACTCACTACCTGGGTGACTGG - Intergenic
959912484 3:111779345-111779367 ACGCTTAGTACCTGGGTGACAGG - Intronic
960189700 3:114688281-114688303 ATGCTCAGTACTTGGGTGATGGG + Intronic
960350713 3:116589484-116589506 ATGCTCATTACCTGGGTGATGGG - Intronic
960550956 3:118975916-118975938 ATGCTCACTACCTGGGTGACAGG + Intronic
960561728 3:119091750-119091772 GTGCTCATTACCTGGGTGATAGG + Intronic
960800782 3:121537392-121537414 TTGCTAAGTACCTGGGTGATGGG - Intronic
960933103 3:122874694-122874716 ATGCTCACTACCTGGGTGATGGG - Intronic
961570593 3:127795448-127795470 ATGCTCAATACCTGGGTGATGGG + Intronic
961579872 3:127871970-127871992 TTTCTCAGTCCATGGGTGACAGG - Intergenic
962243648 3:133773025-133773047 ATGCTCACTACCTGGGTGACAGG - Intronic
962977578 3:140459121-140459143 GTGCTCAGTAGATGGCTGGCAGG + Intronic
963180926 3:142355132-142355154 ATGCTCACTGCCTGGGTGACAGG + Intronic
963193694 3:142502516-142502538 ATGCTCACTACCTGGGTGATGGG + Intronic
963295652 3:143543482-143543504 ATGCTCACTACCTAGGTGACAGG - Intronic
963433055 3:145234132-145234154 TTGCTCTCTACTTGGGTGGGGGG + Intergenic
963572730 3:147017419-147017441 TTGTTCACTACTTGGGTGACAGG - Intergenic
963577338 3:147077391-147077413 ATGCTCAGTACCTGGGTGACAGG + Intergenic
963581480 3:147131250-147131272 ATGCTCAGTACTTGAGTGACAGG - Intergenic
964024698 3:152058277-152058299 ATGCTCACTACCTGGGTAACAGG - Intergenic
964057467 3:152478922-152478944 ATGCTCAGTACCCGGGTGACAGG - Intergenic
964535800 3:157719685-157719707 ATGCTCACTACCTGGGTGATGGG - Intergenic
964651842 3:159020228-159020250 TTGCTCACTACCCAGGTGACAGG - Intronic
964810424 3:160657599-160657621 ATGCTCAGTATCTGGGTGATGGG - Intergenic
964817599 3:160733024-160733046 ATGCTCACTACCTGGGTGATGGG + Intergenic
964895261 3:161588309-161588331 ATGCTCAGTATCCGGGTGACAGG + Intergenic
965049703 3:163629994-163630016 ATGCTCACTAACTGGGTGACAGG - Intergenic
965077094 3:163992937-163992959 ATGCTCACTACCTGGGTGATGGG + Intergenic
965172779 3:165289506-165289528 ATGCTCACTACCTGGGTGACAGG - Intergenic
965365847 3:167798886-167798908 GTGCTCACTATCTGGGTGACAGG + Intronic
965734641 3:171808122-171808144 ATGCTCACCACCTGGGTGACGGG + Intronic
965793748 3:172416325-172416347 ATACTCACTACCTGGGTGGCAGG - Intergenic
965850266 3:173014486-173014508 ATGCTCACTACCTGGGTAACAGG + Intronic
965939653 3:174163525-174163547 ATGCTCAGTACCGGGGTGATGGG - Intronic
966049301 3:175594084-175594106 ATGCTCACTACCTGGGTGACAGG - Intronic
966288744 3:178329531-178329553 TTGCTGAGTCCTTGTGTGGCAGG + Intergenic
966319313 3:178683376-178683398 ATGCTCAGTACCTATGTGACAGG + Intronic
966577137 3:181514953-181514975 ATGCTCACTACCTGGGTGATGGG - Intergenic
966618544 3:181938953-181938975 GTGCTCACTACCTGAGTGACAGG + Intergenic
966694144 3:182772335-182772357 ATGCTCACTACCTGGGTGATGGG - Intergenic
966751051 3:183322726-183322748 ATACTCACTACCTGGGTGACAGG - Intronic
966825104 3:183958274-183958296 ATGCTTAGTACCTGGGTGAGAGG - Intronic
966901089 3:184485995-184486017 ATGCTCAGTAGCTGCGTGTCGGG - Intronic
966969890 3:185034018-185034040 ATGCTCACTACCTGGGTGACAGG - Intronic
966988579 3:185205267-185205289 ATGCTCACTACTGGGGTGGCAGG - Intronic
966998200 3:185305864-185305886 ATGCTCACTACCTGGGTGACAGG - Intronic
967114587 3:186325298-186325320 ATGCTCACTACCTGGGTGATGGG + Intronic
967197030 3:187036786-187036808 TTATTCAGTACCTGCATGGCAGG + Intronic
967280441 3:187817359-187817381 ATGCCCAGTACCTGGGTGAAAGG - Intergenic
967398723 3:189036328-189036350 ATGCTCACTACTTGGGTGACAGG + Intronic
967442559 3:189525992-189526014 ATGCTCACTACCTGGGTGGTGGG + Intergenic
967634294 3:191782730-191782752 ATGCTCACTACCTTGGTGACAGG + Intergenic
967740059 3:192995006-192995028 ATGCTCAGTATCTGGGTGGCAGG - Intergenic
967834123 3:193946470-193946492 ATGCTCAGTACCTGGGTAACAGG - Intergenic
967944992 3:194797338-194797360 ATGCTCAGGCCCTGGGTGGCGGG + Intergenic
969029091 4:4197014-4197036 ATGCTCATTACCTGGGTGATGGG + Intronic
969267460 4:6073957-6073979 TTGCTCAGGACCTGGGCCTCTGG - Intronic
970314625 4:14817465-14817487 ATGCTCACTGCCTGGGTGACTGG - Intergenic
970560042 4:17273769-17273791 ATGCTCACTACTTGGGTGACAGG + Intergenic
971045152 4:22797959-22797981 ATGCTCACTACCTGGATGACAGG - Intergenic
971170522 4:24228545-24228567 ATGCTCGGTACGTGGGTGACAGG + Intergenic
971260211 4:25050114-25050136 ATGCTCAGTACCTGGGTGATGGG + Intergenic
971420911 4:26473423-26473445 ATGCTCAGTACCTGGATGATGGG + Intergenic
971614482 4:28770008-28770030 ATGCTCATTACCTGGGTGATGGG + Intergenic
971923850 4:32980469-32980491 ATGCTCAGTACCTGGGTGATGGG - Intergenic
972000127 4:34020824-34020846 ATGCTCACTACCTTGGTGACAGG + Intergenic
972007882 4:34134271-34134293 ATGCTCAGTACCTGGGTAACAGG - Intergenic
972078043 4:35111330-35111352 ATGCTCACTACCTGGGTGATGGG - Intergenic
972078632 4:35120354-35120376 ATGCTTAGTACCTGGGTGATGGG - Intergenic
972211793 4:36847364-36847386 ATGCTCACTACCTGGGTGACAGG + Intergenic
972772777 4:42213677-42213699 ATGCCCACTACCTGGGTGACAGG - Intergenic
972834096 4:42847860-42847882 GTGCTCACTACCTGGGTGACAGG - Intergenic
972920995 4:43941646-43941668 ATACTCAGTACCTGGGTGATGGG - Intergenic
972926869 4:44020152-44020174 ATGCTCAGTACCTGGATGATGGG - Intergenic
973038356 4:45437368-45437390 ATGCTCAATACCTGGGTGATGGG + Intergenic
973047113 4:45548311-45548333 ATGCTCACTACCTGGGTGATGGG + Intergenic
973113102 4:46419692-46419714 TAGCTCAGTTCCCGTGTGGCTGG - Intronic
973548792 4:52010413-52010435 ATGCTCACTACCTGGGTGATGGG - Intronic
973620978 4:52725460-52725482 ATGCTCAGTACCTGGCTGAAGGG + Intronic
973711995 4:53639380-53639402 ATGCTCAGTACCTGGGTGACAGG + Intronic
973948561 4:55986749-55986771 ATGCTCACTACCTGGGTGATGGG - Intronic
974084589 4:57245741-57245763 ATGCTCATTACCTGAGTGACAGG - Intergenic
974277860 4:59749211-59749233 ATGCTCACTACCCGGGTGGAAGG + Intergenic
974424896 4:61729103-61729125 GTGCTCACTACCTGGGTGATGGG + Intronic
974543485 4:63269710-63269732 ATGCTCATGACCTGGGTGACAGG - Intergenic
975072010 4:70153335-70153357 ATGCTCAATACCTGGGTGAAGGG - Intronic
975123144 4:70751163-70751185 ATGCTCACTACCTGGGTGACAGG - Intronic
975245511 4:72116467-72116489 ATGCTCACTACCTGGGTGATGGG + Intronic
975275799 4:72499717-72499739 GTGCTCAGTATCTGGGTGACGGG - Intronic
975480694 4:74876851-74876873 ATGCTCAGTATCTGTGTGGTGGG - Intergenic
975613258 4:76221807-76221829 ATGCTCACTACCTGGGTGACAGG + Intronic
975699734 4:77052060-77052082 GTGCTCACTACCTGGTTGACAGG - Intronic
975705567 4:77109135-77109157 ATGCTCACTACCAGGGTGACTGG - Intergenic
975971219 4:80040168-80040190 ATGTTCAGTACCTGGGTGATGGG + Intronic
976079566 4:81340273-81340295 ATGCTCAGTACCTGGGTGACAGG - Intergenic
976149842 4:82080854-82080876 ATGCTCACTACCTGGGTGACAGG - Intergenic
976153624 4:82118710-82118732 ATGCTCAGTGCCTGGGTGACGGG + Intergenic
976245989 4:83006494-83006516 ATGCTCGGTGCCTGGGTGACAGG + Intronic
976337999 4:83912923-83912945 ATGTTCACTACCTGGGTGACAGG + Intergenic
976340273 4:83939509-83939531 ATGCTCAGTACCTGGGTGGTGGG - Intergenic
976540664 4:86271538-86271560 ATGCTCACTACCTGGGTCACAGG - Intronic
976551314 4:86398698-86398720 GTGCTCACTACCTGGGTGACAGG - Intronic
976668222 4:87623199-87623221 ATGGTCAGTACCTGGGTGATGGG - Intergenic
976909132 4:90278727-90278749 ATGCTCACTACCTGGGTCACAGG + Intronic
976915016 4:90361593-90361615 GTGCTCACTACCTGGGTGATAGG - Intronic
977001460 4:91509944-91509966 ATGCTTAGTACCTCGGTGACAGG - Intronic
977027362 4:91835339-91835361 ATGCTCACTACTTGGGTGACAGG + Intergenic
977191000 4:94000678-94000700 GTGCTCAGTACCTGGGTTATGGG - Intergenic
977281689 4:95047889-95047911 ATGCTCACTACCAGGGTGACTGG - Intronic
977332367 4:95653543-95653565 ATACTCAGTACCTGGGTGACAGG - Intergenic
977481166 4:97577631-97577653 ATGCTCAGTACATGGGTGACAGG + Intronic
977487088 4:97662838-97662860 ATGCTTACTACCTGGGTGACAGG + Intronic
977498466 4:97806413-97806435 ATGCTCACTACCTGGGTGACAGG + Intronic
977538433 4:98284321-98284343 ATGTTCAGTACCTGGGTGATGGG - Intronic
977724360 4:100277998-100278020 ATGCTCACTACCTGGGTGATGGG - Intergenic
977769793 4:100844746-100844768 ATGCTCACTATCTGGGTGACAGG + Intronic
977875457 4:102144523-102144545 ATGCTCACTACCTGGGTGATGGG - Intergenic
978079601 4:104575976-104575998 TGGCTAAGTACCTGGGTAGTTGG - Intergenic
978226441 4:106340376-106340398 ATGCTCACTACCTGGGTGATGGG - Intronic
978400922 4:108329724-108329746 ATGCTCAGTACCTGGGTGATGGG + Intergenic
978637346 4:110825123-110825145 ATACTCACTACCTGGGTGACAGG - Intergenic
978685842 4:111442237-111442259 ATGCTCAGTACCTGGGTGATAGG - Intergenic
978823693 4:112994698-112994720 ATGCTCCGTACCTGGGTGACAGG - Intronic
978883621 4:113739886-113739908 ATGCTTAGTACCTGGGTGATGGG - Intronic
978910864 4:114062126-114062148 ATGTTCACTACCTGGGTGGCAGG - Intergenic
978924713 4:114229249-114229271 ATGCTCACTACCTGGGTGACAGG - Intergenic
978949450 4:114540137-114540159 ATGCTCACTACCTGGGTGATGGG - Intergenic
979026582 4:115585020-115585042 ATGCTCAGTACCTGCATGACAGG - Intergenic
979068522 4:116170056-116170078 TAGCTCACTACCTGGGTGACAGG + Intergenic
979091202 4:116484848-116484870 ATGCTCAGTACGTGGGTGATGGG - Intergenic
979117648 4:116847959-116847981 ATGCTCACTAACTGGGTGACAGG + Intergenic
979436699 4:120701716-120701738 ATGCTCAGTACCTGGCTGATGGG + Intronic
979823852 4:125208123-125208145 ATGCTCACTGCCTGGGTGACAGG - Intergenic
980013298 4:127620946-127620968 ATGCTTAGTACCTGGGTGGTGGG - Intergenic
980178955 4:129380946-129380968 ATGTTCAGTACCTGGGTGATGGG + Intergenic
980282058 4:130735391-130735413 ATGCTCAATATCTGGGTGACAGG + Intergenic
980555615 4:134400048-134400070 ATGCTCACTACCAGGGTGGCAGG - Intergenic
980622270 4:135323122-135323144 ATGCTCAGTACCTGGGTGGTAGG + Intergenic
980670420 4:135997270-135997292 GTGCTCACTACCTGGGTGACTGG + Intergenic
980695807 4:136354153-136354175 CTGCTCACTACCTGGGTGACAGG - Intergenic
980716155 4:136632467-136632489 GTGCTCAGTTCCTGGGTGACAGG - Intergenic
980726574 4:136769580-136769602 ATGCTCACTACCTGGGTGACAGG - Intergenic
980878942 4:138689847-138689869 ATGCTCACTACCTAGGTGACAGG + Intergenic
981121991 4:141062768-141062790 GTGCTCATTGCCTGGGTGACAGG - Intronic
981427225 4:144617491-144617513 ATGCTCAGTACCTGGGAGACAGG + Intergenic
981447521 4:144857158-144857180 ATGCTCAGTACCTGCATGACAGG + Intergenic
981617642 4:146658204-146658226 ATGCTCATTACCTGGGTGACAGG - Intergenic
981634906 4:146865557-146865579 ATGCTCACTATCTGGGTGACAGG + Intronic
981674244 4:147322878-147322900 AAGCTCAGTACCTGGGTGATGGG + Intergenic
981961017 4:150538854-150538876 ATGCTCACTACCTAGGTGACAGG + Intronic
981988049 4:150881567-150881589 ATACTCAGTACTTGGGTGACAGG + Intronic
982049673 4:151488264-151488286 ATGCTCACTACCTAGGTGACAGG - Intronic
982315888 4:154031510-154031532 ATGTTCACTACCTGGGTGACAGG - Intergenic
982629541 4:157814450-157814472 ATGCTCAGTACCTGGGTGACAGG + Intergenic
982755786 4:159217262-159217284 TTGCTCACTATCTGGGTGATGGG - Intronic
982866022 4:160512779-160512801 ATGTTCAGTACCTGGGTGATGGG + Intergenic
982982449 4:162156794-162156816 ATGCTCAGTACCTGGGTGGTGGG + Intronic
983307871 4:166017029-166017051 ATGCTTAGAACCTGGGTGACAGG - Intronic
983368844 4:166832954-166832976 ATACTCACTACCTGGGTGTCAGG + Intronic
983655049 4:170074296-170074318 ATGCTCAGTACCTGGGTGACAGG - Intronic
983671180 4:170239622-170239644 CTGCTTACTACCTGGGTGACAGG - Intergenic
983854429 4:172624904-172624926 ATGCTCACTACCTGGGTGACAGG - Intronic
983981489 4:174002483-174002505 ATGCTCACTACCTGGGTGATGGG - Intergenic
984216828 4:176923584-176923606 ATGCTCACTACCTGGGTGATGGG + Intergenic
984831258 4:183976608-183976630 ATGCTCACTACCTGGATGACAGG + Intronic
985050431 4:185985730-185985752 ATGCTCATTACCTGGGTGATGGG - Intergenic
985218129 4:187674693-187674715 TGGCTCAGGTCCTGGGTGGTCGG + Intergenic
985225330 4:187754045-187754067 GTGCTCACTACCTGGGTGATGGG - Intergenic
985229097 4:187795988-187796010 ATGCTCAGTACCTGGGTGATGGG - Intergenic
985366738 4:189238952-189238974 ATGCTCAATACCTGGATGACAGG - Intergenic
986060498 5:4185556-4185578 GTGATCACTACCTGGGTGACAGG + Intergenic
986426898 5:7641612-7641634 ATGCTCAGTACCTGGGTAATGGG - Intronic
986537969 5:8812498-8812520 ATGCTTACTACCTGGGTGACAGG + Intergenic
986813236 5:11382024-11382046 ATGCTCAGTACCTGGGTGACAGG + Intronic
986866711 5:11997844-11997866 ATGCTCAGTACCTGTGTGATGGG + Intergenic
986903342 5:12464002-12464024 ATGCTCACTACCTGGGTGACAGG + Intergenic
986945204 5:13009669-13009691 ATACTCACTACCTGGGTGGTGGG + Intergenic
987053128 5:14165215-14165237 ATGCTCACTACCTGGGTGACGGG - Intronic
987161871 5:15153307-15153329 ATGCTCACTACCTGAGTGGTGGG - Intergenic
987175654 5:15305806-15305828 AAGCTCAGTACCTGGATGACAGG - Intergenic
987468491 5:18301404-18301426 ATGCTCACTACCTGGGTGATGGG - Intergenic
987516248 5:18914173-18914195 ATGCTCACTACCTGGGTGACAGG - Intergenic
987670335 5:20998828-20998850 GTGCTCAGTACCTGGGTTATGGG + Intergenic
987722908 5:21661967-21661989 ATGCTCACTACCTGGGTGACAGG + Intergenic
987806424 5:22774883-22774905 ATGCTCACTACCTGGGTGACAGG + Intronic
987827760 5:23055582-23055604 ATGCTCACTACCTTGGTGACAGG - Intergenic
987849279 5:23328434-23328456 ATGCTCACTACCTGGGTGAAAGG - Intergenic
987853591 5:23388621-23388643 TTGCTCAAAACCTTGGTGTCAGG + Intergenic
988003140 5:25375335-25375357 ATGCTCACTACTTGGGTGACAGG - Intergenic
988068821 5:26260713-26260735 ATGCTCAGTACCTGAGTGATGGG - Intergenic
988094093 5:26580545-26580567 ATGCTCACTACCTGAGTGACAGG - Intergenic
988104670 5:26729322-26729344 ATGCTCACTACCTGGATGACAGG - Intergenic
988311188 5:29559595-29559617 ATGCTCACTATCTGGGTGACAGG + Intergenic
988444934 5:31275285-31275307 ATGCTCAGTACCTGGGTGATGGG - Intronic
988518691 5:31927112-31927134 ATGCTTAGTACCTGGGTGACAGG + Intronic
988651583 5:33157729-33157751 ATGCTCACTACCTGGGTGATGGG + Intergenic
988830356 5:34981223-34981245 ATGCTCACTACCTGGGTGATGGG + Intergenic
989299263 5:39869648-39869670 ATGCTCAGTACCTGCATGACAGG - Intergenic
989340704 5:40371381-40371403 ATGCTCACTACCAGGGTGACAGG + Intergenic
989416536 5:41184025-41184047 CTGCTCAGTACCTGGGTAAAGGG + Intronic
989421836 5:41249205-41249227 ATGCTCAGTACTTGGGTGAGGGG + Intronic
989459276 5:41678609-41678631 ATGCTCACTACCTGGGTGACGGG - Intergenic
989796653 5:45482703-45482725 GTGCTCACTACCTGGGTGACGGG - Intronic
990317243 5:54594769-54594791 ATGCTCACTACCTGGGTGATAGG - Intergenic
990492582 5:56317029-56317051 ATGCTTAGTACCTGGGTGATGGG + Intergenic
990530076 5:56664686-56664708 ATGCTCACTACTTGGGTGACAGG - Intergenic
990612953 5:57477504-57477526 ATACTCAGTACCTGGGTGATGGG + Intergenic
990634019 5:57703314-57703336 ATGCTCAGTACCTGGCTGACAGG - Intergenic
991056468 5:62326023-62326045 CTGCTCACTACCTGGGTGATGGG + Intronic
991407470 5:66315274-66315296 AAGCTCAGTACCTGGGTGACAGG - Intergenic
991465139 5:66904860-66904882 TCACTCACTACCTGGGTGTCAGG - Intronic
991519589 5:67480939-67480961 ATGCTCACTACTTGGGTGACAGG + Intergenic
991649939 5:68841958-68841980 ATGCTCAGTACCTGGATGACAGG - Intergenic
991660023 5:68941847-68941869 ATGCTCAGTACCTGGGTGATGGG + Intergenic
992220566 5:74568047-74568069 ATGCTCAGTACCTGGGTGATGGG - Intergenic
992293165 5:75302108-75302130 TTGCTCACTACCTGGGTGATGGG - Intergenic
992417017 5:76561511-76561533 TAGATCAGTAGCTGGGTGGCAGG + Intronic
992519749 5:77538388-77538410 ATGCTCACTACCTGAGTGACAGG - Intronic
992520981 5:77551106-77551128 AGGCTCACTACCTGGGTGACAGG + Intronic
992607445 5:78473564-78473586 ATGCTCACTACCTGGATGACAGG - Intronic
992995329 5:82327193-82327215 ATGCTCACTACCTGGGTGACGGG - Intronic
993086459 5:83369340-83369362 ATGCTCAATACCAGGGTGACAGG - Intergenic
993171618 5:84427199-84427221 ATGCTCACTACCTGAGTGACAGG - Intergenic
993350089 5:86839046-86839068 ATGCTCACTACCAGGGTGACAGG - Intergenic
993400858 5:87449104-87449126 ATGCTCACTACCTAGGTGACAGG + Intergenic
993439020 5:87932302-87932324 ATGCTCACTGCCTGGGTGACGGG + Intergenic
993615840 5:90111175-90111197 ATGCTCACTACCTGGGTGACAGG + Intergenic
993783652 5:92101168-92101190 ATGCTCAGCACCTGGGTGATGGG + Intergenic
994127960 5:96190824-96190846 ATGCTCAGTACCTGGGTGACAGG - Intergenic
994237130 5:97375675-97375697 ATGCCCAGTACCTGGGTGATGGG + Intergenic
995387712 5:111606757-111606779 GTGCTCTCTACCTGGGTGACAGG - Intergenic
995403576 5:111768456-111768478 GTGCTCATTACCTGTGTGGCAGG - Intronic
995626677 5:114086372-114086394 ATGCTCAGTCCCTGGGTGACAGG - Intergenic
995700771 5:114932694-114932716 ATGCTCACTACCTGGGTGTTGGG - Intergenic
995738639 5:115330602-115330624 GTGCTCACTACCTGGGTGACAGG + Intergenic
995849453 5:116529892-116529914 ATGCTCACTACCTGGGTGACGGG + Intronic
996537063 5:124589009-124589031 ATGCTCAGTAGCTGGGTGATGGG - Intergenic
996895985 5:128483208-128483230 ACGCTCAGTACCTGGATGACAGG + Intronic
997292173 5:132745546-132745568 GTGCTCAGTACCTGGGTGACAGG - Intergenic
997443626 5:133925929-133925951 TTGCTCAGTACCAGTGGGTCAGG - Intergenic
997455611 5:134015266-134015288 ATGCTCAATACCTGGATGACAGG + Intergenic
997837648 5:137208759-137208781 ATACTCAGTACCTGGGTGATGGG + Intronic
997898321 5:137740169-137740191 ATGCTCATTACCTAGGTGACAGG + Intergenic
997917726 5:137944998-137945020 ATGCTCAGTACCTAGGTGACAGG + Intronic
998804061 5:145901199-145901221 ATGTTCAGTACCTGGGTGACAGG + Intergenic
998809862 5:145955456-145955478 ATGCTCAGTACCTGGGTGACAGG + Intronic
999392559 5:151204953-151204975 ATGCTTAGTACCTGGGTGACAGG - Intronic
999533271 5:152486350-152486372 ATGCTCACTACCTGGGTGACAGG + Intergenic
999861564 5:155653187-155653209 ATGCTCAGTACCTGGGTGAAGGG - Intergenic
999929025 5:156410420-156410442 ATGCTCACTACCTGGGTGATGGG + Intronic
1000275517 5:159731293-159731315 GTGCTCAGTATCTGGGTGACAGG + Intergenic
1000530813 5:162417578-162417600 ATGCTTACTACCTGGGTGACGGG - Intergenic
1000543712 5:162572371-162572393 GTGCTCACTACCTGGGTGATGGG + Intergenic
1000726551 5:164778975-164778997 ATGCTCAGTACCAGGGTGAAGGG + Intergenic
1000741692 5:164976368-164976390 ATGCTCAGTACCTATGTGACAGG - Intergenic
1000745420 5:165026707-165026729 ATGCTCAGTAGCTGGGTGATGGG + Intergenic
1000822302 5:165999686-165999708 ATGCTCACTACCTGGGTGGTGGG - Intergenic
1001019455 5:168170659-168170681 TTGCTCTGCACCTGGGTTACGGG + Intronic
1001257587 5:170196175-170196197 CTGATGAGAACCTGGGTGGCAGG - Intergenic
1001451840 5:171832058-171832080 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1001454979 5:171853407-171853429 GAGCTCAGTACCTGGGTGATGGG + Intergenic
1001692861 5:173645823-173645845 TTTCTCAGTTCGAGGGTGGCGGG + Intergenic
1001703845 5:173727590-173727612 ATGCTTAGTACCTGGGTGACAGG + Intergenic
1001805848 5:174585435-174585457 ATGCTCAGTACCTGTGTGATAGG - Intergenic
1002284096 5:178150840-178150862 TTGCTCAGCACTGGGGTGTCTGG - Intronic
1002370066 5:178744875-178744897 TCACTCACTACCTGGGTGACAGG + Intergenic
1002578061 5:180188770-180188792 ATGCTCAGTACCTGGGGGACAGG - Intronic
1002699204 5:181110666-181110688 ATGCTCAGCACCTGGGTGAGGGG + Intergenic
1002790292 6:432573-432595 ATGTTCAGTACCTGGGTGATGGG - Intergenic
1003057371 6:2834331-2834353 TTGCTGGGTAGCTGGGTGGATGG - Intronic
1003218159 6:4134378-4134400 CTGCTCTGTTCCTGGCTGGCTGG - Intronic
1003617072 6:7664754-7664776 GTGCTCCGTACCTGGGTGATGGG + Intergenic
1003936168 6:10977207-10977229 ATGCTCACTATCTGGGTGACAGG - Intronic
1004008834 6:11661645-11661667 ATGCTCAGTACCTGGGCAACAGG - Intergenic
1004109802 6:12706031-12706053 ATGCTTAGTACCTGGGTGACAGG + Intergenic
1004611973 6:17250725-17250747 GTGCTCACTGCCTGGGTGACGGG - Intergenic
1004872316 6:19919313-19919335 ATTCTCAGTACCTAGGTGACAGG + Intergenic
1005000859 6:21240142-21240164 AGGCTCACTACCTGGGTGACAGG + Intergenic
1005007848 6:21308062-21308084 GTGCCCACTACCTGGGTGACGGG - Intergenic
1005090752 6:22054400-22054422 ATGCTCACTACCTGGGTGATGGG - Intergenic
1005363017 6:25050060-25050082 ACACTCAGTACCTGGGTGGCAGG + Intergenic
1005742452 6:28805156-28805178 ATGCTCACTACCCGGGTGACAGG + Intergenic
1005968897 6:30745709-30745731 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1006200579 6:32286075-32286097 ATGCTCACTACCTGAGTGACAGG - Intergenic
1006734080 6:36259876-36259898 ATGCTTAGTACCTGGGTGACAGG + Intronic
1006749924 6:36370580-36370602 ATGCTGAGTACCTTGGTGACAGG + Intronic
1007024954 6:38561827-38561849 ATGCTCACTACCTGGGTGACAGG + Intronic
1007040670 6:38719323-38719345 ATGCTCACTATCTGGGTGACAGG - Intronic
1007393060 6:41561551-41561573 TTGCTGAGGACCTTGGTGGCTGG + Intronic
1007871412 6:45043411-45043433 ATGCTCACTACTTGGGTGACTGG - Intronic
1008236158 6:49053742-49053764 ATGCTCCTTACCTGGGTGACAGG + Intergenic
1008463649 6:51805428-51805450 ATGCTCACTACCTGGGTGAAAGG + Intronic
1008612817 6:53199971-53199993 ATGCTCACTACCTGGGTGATGGG - Intergenic
1008779005 6:55078953-55078975 ATGCCCAGTACCTGGGTGATGGG - Intergenic
1008904870 6:56665737-56665759 ATGCTCACTACGTGGGTGACAGG + Intronic
1009044796 6:58225617-58225639 ATGCTCACTACCTGGGTGATGGG - Intergenic
1009060459 6:58392339-58392361 ATGCTCAGTACCTGGGTAATGGG + Intergenic
1009178722 6:60490758-60490780 TTGTTCACTACTTGGGTGACGGG + Intergenic
1009189721 6:60615556-60615578 ATGCTCAGGACCTGGGTGATGGG + Intergenic
1009195373 6:60678366-60678388 TTGCTGAGTACCTGAGTGATAGG + Intergenic
1009220611 6:60979931-60979953 ATGCTCACTACCTGGGTGATGGG - Intergenic
1009375782 6:62966569-62966591 ATGCTCAGTACCTAGGTGACTGG - Intergenic
1009445200 6:63734171-63734193 ATGCTCACTACCTGGGTGACTGG + Intronic
1009461923 6:63923671-63923693 ATGCTCAGTACCTGGGTGAAAGG - Intronic
1009521769 6:64691594-64691616 ATGCTCACTACCTGGGTGACAGG - Intronic
1009539922 6:64941548-64941570 ATGCTCACTACCTGGGTGATGGG - Intronic
1009560821 6:65240370-65240392 ATGTTCAGTACCTGGGTGACAGG - Intronic
1009849228 6:69174192-69174214 ATGCTTAGTACCTGGGAGACAGG - Intronic
1009965893 6:70577650-70577672 ATGCTCATTACCTGGGTGATGGG - Intronic
1010074249 6:71782699-71782721 GTGCTCACTACCTGGGTGTTGGG - Intergenic
1010139251 6:72594729-72594751 ATGCTCACTACCTGGGTGATGGG - Intergenic
1010501400 6:76605209-76605231 ATGCTCAGTACCTGGCTGATGGG + Intergenic
1010604497 6:77871596-77871618 ATGCTCAGTACATGGGTGACAGG + Intronic
1010726689 6:79343183-79343205 ATGCTCATTACCTGGGTGATGGG - Intergenic
1010763925 6:79756992-79757014 ATGCTCACTACCTGGGTGAAGGG - Intergenic
1011180984 6:84620349-84620371 ATGCTCAGTACCTGGGTGATAGG - Intergenic
1011316793 6:86041824-86041846 ATGCTCAGTACCTGGCTAACAGG + Intergenic
1011326895 6:86158307-86158329 AGGCTCACTACCTGGGTGACAGG + Intergenic
1011360647 6:86520697-86520719 ATGCTCACTACCTAGGTGACAGG - Intergenic
1011568230 6:88703585-88703607 ATGCTCAGTACCTGGGTGATGGG + Intronic
1011835231 6:91422580-91422602 ATACTCAGTACCTGGGTGATGGG + Intergenic
1011842619 6:91520532-91520554 ATGCTCACTATCTGGGTGGTGGG - Intergenic
1011891295 6:92164240-92164262 ATGCTCAGTTCCTGGGTGACAGG - Intergenic
1011926010 6:92645559-92645581 ATGCCCAGTAACTGGATGGCTGG - Intergenic
1012160005 6:95872770-95872792 ATGCTCACTACCTGGGTGATGGG + Intergenic
1012160679 6:95881506-95881528 GTGATCAGTACCTGGGTGATAGG - Intergenic
1012249610 6:96964952-96964974 TTGCTCGTTACCTGGGTGATGGG - Intronic
1012439182 6:99246587-99246609 ATGCTTAGTACCTGGGTGATGGG - Intergenic
1012462693 6:99481607-99481629 ATGCTTAGTACCTGAGTGACGGG - Intronic
1012537810 6:100320340-100320362 ATGCTCAGTACCTGGGTAATGGG - Intergenic
1012599433 6:101076422-101076444 GTGCTCACTACCTGAGTGACAGG + Intergenic
1012666056 6:101971685-101971707 ATTCTCAATACCTGGGTGACAGG - Intronic
1012714482 6:102651013-102651035 CTGCTCACTACCTGGGTGACAGG - Intergenic
1012761198 6:103304482-103304504 ATGCTCAGTACCTGGGTGATAGG + Intergenic
1012832143 6:104217706-104217728 ATGCTCACTACCTGGGTGATGGG - Intergenic
1012892872 6:104917075-104917097 TTGCCCACTACCTGGGTGATGGG - Intergenic
1012902046 6:105017791-105017813 ATGCTCATTACCTGGGTGGTGGG + Intronic
1013254733 6:108373129-108373151 ATGCTCAGTACCTAGGTGATGGG - Intronic
1013419925 6:109958160-109958182 ATGCCCATTACCTGGGTGACAGG + Intergenic
1013427457 6:110026151-110026173 ATGCTTAGTACCTGGGCGACGGG + Intergenic
1013572658 6:111445278-111445300 ATGCTCACTACCTGGGTAACGGG + Intronic
1013864487 6:114678862-114678884 TTTCTCAGTATATGGGTTGCAGG + Intergenic
1013877098 6:114845410-114845432 ATGCTCAGTACCTGGGTGAGAGG + Intergenic
1013933750 6:115568592-115568614 ATGCTCACTGCCTGGGTGACAGG + Intergenic
1014005461 6:116412790-116412812 ATGCTTACTACCTGGGTGTCAGG - Intronic
1014068329 6:117152209-117152231 ATGCTCAGTAGCTGGGTGATGGG + Intergenic
1014210319 6:118701672-118701694 ATGTTCAGTACCTGGGTGATGGG + Intronic
1014382149 6:120755466-120755488 GTGCTCACTACCTGGGTGACAGG - Intergenic
1014433606 6:121397539-121397561 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1014498694 6:122159403-122159425 ATGCTCACTACCTGGGTGGTGGG - Intergenic
1014501383 6:122194252-122194274 ATGCTCAGTACATGGGTGATGGG - Intergenic
1014660292 6:124161841-124161863 ATGCTCACTACCTGGGTGACGGG + Intronic
1014871989 6:126608364-126608386 ATGCTCACTACCTGGGTGGTGGG - Intergenic
1015040672 6:128714991-128715013 ATGCTTACTACCTGGGTGACAGG - Intergenic
1015349785 6:132204217-132204239 ATGCTGAGTACCTGGGTGATGGG - Intergenic
1015477165 6:133666920-133666942 ATGCTCACTATCTGGGTGACAGG + Intergenic
1015691468 6:135928861-135928883 ATGCTCACTACCTGGGTAACAGG + Intronic
1015828731 6:137344726-137344748 ACGCTCAGAACCTGGGAGGCTGG + Intergenic
1016038332 6:139406124-139406146 ATGCTTAGTACCTGGGTGAGAGG - Intergenic
1016173255 6:141046221-141046243 ATGCTCACTACCTAGGTGACAGG - Intergenic
1016175550 6:141074519-141074541 GTGCTCAGTCCCTGGGAGGCAGG + Intergenic
1016267651 6:142251141-142251163 ATGCTCACTACCTGGGTGACAGG - Intergenic
1016482771 6:144499705-144499727 ATGCTCACTACCTGGGTGATGGG - Intronic
1017056086 6:150436511-150436533 TTGCTCAGGACTCGGGTGCCTGG + Intergenic
1017524123 6:155227960-155227982 TTGGTCTGTACCTGGGAGCCAGG + Intronic
1017567631 6:155705227-155705249 ATGCTCACTACCTGCGTGACAGG + Intergenic
1018128587 6:160706104-160706126 TAGCTCACTACCTGGGTGATGGG - Intronic
1018276156 6:162133684-162133706 GTGCTCAGTTCTTGGGTTGCTGG + Intronic
1018307035 6:162468696-162468718 AAGCTCAGTACTTGGCTGGCCGG - Intronic
1018322915 6:162632546-162632568 ATGCTCACTACCTGGGTGATAGG + Intronic
1018600262 6:165530529-165530551 ATGCTCACTACCTGGGTGATGGG + Intronic
1018721257 6:166574253-166574275 GTGCTCAGTACCCGGGTGACGGG - Intronic
1018742214 6:166738533-166738555 TTGCACAGTACCTTGGAGGCAGG + Intronic
1018843733 6:167539383-167539405 ACGCTCAGCACCTGGGTGACAGG + Intergenic
1019073281 6:169367106-169367128 GTGCTCAGTGCCTGGGTGATGGG - Intergenic
1019217658 6:170454040-170454062 TTCCTCAGTGCCTGGCTGGTGGG - Intergenic
1019776338 7:2913911-2913933 TTTCTCAGTCCCTCTGTGGCTGG + Intronic
1020244955 7:6422775-6422797 ATGCTCAGTACCTGGGAGACGGG + Intronic
1020490185 7:8773001-8773023 ATGCTCAGTACCTAGGTGACAGG - Intergenic
1020551148 7:9606440-9606462 ATGCTTACTACCTGGGTGACAGG - Intergenic
1020581944 7:10012932-10012954 GTGCTCAATACCTGGGTGATGGG - Intergenic
1020638700 7:10728520-10728542 TAGCTCACTACCAGGGTGGTGGG + Intergenic
1020647619 7:10834001-10834023 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1020650225 7:10865958-10865980 ATGCTCACTACCTGGGTGATGGG - Intergenic
1020885697 7:13816795-13816817 ATGCTCAGAACTTGGGTGACCGG - Intergenic
1020907561 7:14083127-14083149 ATGCTCACTACCTGGGTGATGGG + Intergenic
1020929093 7:14370760-14370782 ATGCTCACTACCTGGGTGACAGG - Intronic
1021003928 7:15370001-15370023 ATGCTCACTACCTGGGTGATAGG - Intronic
1021037061 7:15812618-15812640 ATGCTCAGTACTTGGGTGAGGGG - Intergenic
1021122100 7:16807479-16807501 ATGCTCACTACCTGGGTGATGGG - Intronic
1021138622 7:16995904-16995926 ATGCTCACTACCTGGGTGATGGG - Intergenic
1021190029 7:17609590-17609612 ATGCTCAGTACCTAGGTGATGGG + Intergenic
1021383693 7:20001640-20001662 ATGCTCACTACCTGGGTGACGGG + Intergenic
1021448525 7:20759138-20759160 GTGCTCACTACCTGGGTGATGGG - Intronic
1021589732 7:22248019-22248041 ATGCTCAGTACCTGGGTGACGGG + Intronic
1021952803 7:25791569-25791591 ATGCTCACTACCTGGGTGATGGG - Intergenic
1022534742 7:31090509-31090531 ATGCTCACTACCTGGGTGACGGG - Intronic
1022667181 7:32422425-32422447 ATGCTCACTACCTGTGTGACTGG - Intergenic
1022765071 7:33402785-33402807 ATGCTCACTACCTGGGTGACAGG - Intronic
1022765107 7:33403186-33403208 ATGTTCACTACCTGGGTGACAGG - Intronic
1022771609 7:33479187-33479209 ATGCTCACTACCTGGGTGATGGG - Intronic
1022875751 7:34527585-34527607 GTGCTCACTACCTGAGTGACAGG - Intergenic
1022972921 7:35533811-35533833 ATGCTCACTACCTGGGTGATGGG - Intergenic
1023084020 7:36552002-36552024 ATGCTCAGTACCTGGGTGATGGG - Intronic
1023290737 7:38666259-38666281 CTGTTCAGTACCTGGGTGATGGG + Intergenic
1023497131 7:40809720-40809742 ATGCTCAGTACCTGGGTGATGGG - Intronic
1023740139 7:43273222-43273244 ATGCTCAGTACCTGGTTGACAGG + Intronic
1023865011 7:44234379-44234401 GAGCTCAGTACCAGGGCGGCAGG + Exonic
1024592981 7:50905752-50905774 TTGCTCACTACCTGGGTGATGGG + Intergenic
1024727373 7:52213256-52213278 ATGCTCATTACCCGGGTGACAGG + Intergenic
1024824272 7:53371292-53371314 ATCCTCACTACCTGGGTGGCAGG + Intergenic
1025038754 7:55620573-55620595 ATGCTCACTACCTGGGTGATGGG + Intergenic
1025043230 7:55666747-55666769 ATACTCACTACCTGGGTGACAGG + Intergenic
1025065930 7:55856090-55856112 ATGCTCAGTACCTGGGTGATGGG - Intronic
1025971449 7:66329999-66330021 GTGCTCACTACCTGGGTGACAGG + Intronic
1025972779 7:66343456-66343478 ATGCTCACGACCTGGGTAGCAGG + Intronic
1026133573 7:67640339-67640361 ATGCTCACTACCTGGGTGATGGG + Intergenic
1026388620 7:69877556-69877578 ATGCTTAGTACCTGGGTGACGGG - Intronic
1026652033 7:72224051-72224073 ATGCTCATTACCTGGGTGACAGG + Intronic
1027150341 7:75728977-75728999 ATGCTCACTACCTAGGTGACAGG + Intronic
1027194198 7:76017930-76017952 ATGCTCACTACCTGGGTGATGGG + Intronic
1027331476 7:77100084-77100106 ATGCTTAGTACCTGGGTGATGGG - Intergenic
1027454597 7:78373688-78373710 ATGCTCAGTACCTGGGTGATGGG - Intronic
1027541513 7:79472600-79472622 ATGCTCACTACCTGGATGACGGG - Intergenic
1027558841 7:79701717-79701739 ATGCTCACTACCTGGGTGGCAGG - Intergenic
1027935599 7:84598090-84598112 ATGCTTAGCACCTGGGTGACAGG + Intergenic
1027949378 7:84794847-84794869 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1028022045 7:85789326-85789348 ATGCTCACTACCTGGGTGACAGG + Intergenic
1028119075 7:87036831-87036853 ATGGTCAGTACCTGGGTGATGGG + Intronic
1028158593 7:87460381-87460403 ATGCTCACTACCTGGGTGACAGG - Intronic
1028163087 7:87508032-87508054 GTGCTCAGTACCTAGGTGACAGG + Intronic
1028185425 7:87779721-87779743 ATGCTCACTACCTGGGTGACAGG - Intronic
1028305072 7:89252921-89252943 ATGCTCAGTAACTGGGTGACGGG + Intronic
1028520973 7:91730469-91730491 TTGCTCAGTAACTTAGCGGCAGG - Intronic
1028561581 7:92181779-92181801 ATGCTCAGTACCTGGATGATGGG - Intergenic
1028642738 7:93061474-93061496 ATGCTCACTACTTGGGTGACAGG + Intergenic
1028675213 7:93452072-93452094 ATGCTCACTACCTGAGTGACAGG + Intronic
1028696702 7:93722032-93722054 ATGCTCATTACCTGGGTGATAGG + Intronic
1028700003 7:93766326-93766348 ATACTCAGTACCTGGGTGGTGGG + Intronic
1028713864 7:93941510-93941532 ATGCTCAGTACCTGGATGATGGG - Intergenic
1028748888 7:94359800-94359822 ATGCTCACTACCTGGATGGCAGG + Intergenic
1028904913 7:96142214-96142236 CTGCTCAGTACCTAGCTGACAGG - Intronic
1028921338 7:96313660-96313682 ATGCTCAGTACCTGGGTGATGGG + Intronic
1029131698 7:98336196-98336218 ATGCTCACCACCTGGGTGACAGG + Intronic
1029400384 7:100341462-100341484 TTGCTTAGTAACTGAGAGGCGGG + Intronic
1030259965 7:107553139-107553161 ATGCACACTACCTGGGTGACAGG + Intronic
1030682091 7:112444845-112444867 ATGCTCACTACCTAGGTGACGGG + Intronic
1030763245 7:113377465-113377487 ATGCTCACTACCTGGGTGACAGG - Intergenic
1030850394 7:114477544-114477566 ATGCTCTCTACCTGGGTGGTGGG + Intronic
1031128490 7:117803432-117803454 ATGCTCACTACTTGGGTGACAGG + Intronic
1031378521 7:121057385-121057407 ATGCTCAGTACCTGGGTGACAGG - Intronic
1031385858 7:121150146-121150168 ATGCTCATTACCTGGGTGGTGGG - Intronic
1031544375 7:123033819-123033841 GTGCTCACTACCTGGGTGACAGG + Intergenic
1031735381 7:125353044-125353066 GTGCTCACTACCTGGGTGATGGG + Intergenic
1031792774 7:126130837-126130859 ATGCTCACTACCTGTGTGACAGG + Intergenic
1031912295 7:127530913-127530935 ATGTTCAGTACCTGGGTGACAGG + Intergenic
1031950381 7:127885623-127885645 TTACTGAGTACCTGCCTGGCCGG - Intronic
1032482821 7:132260567-132260589 ATGCTCACTACCTGGGTGGTGGG + Intronic
1033084331 7:138328420-138328442 TTGCCCAGGGCCTGGGTGCCAGG + Intergenic
1033341939 7:140498963-140498985 TTCCTGAGTAGCTGGGTAGCTGG - Intergenic
1033356130 7:140601774-140601796 TTCCTGAGAACCTGGGAGGCGGG - Exonic
1033413509 7:141142021-141142043 ATGCTCAGTAACTGGGTGACAGG - Intronic
1033524961 7:142202406-142202428 ATGCTCACTGCCTGGGTGACGGG - Intronic
1033812602 7:145033808-145033830 GTACTCAGTACCTGGGTGATGGG - Intergenic
1033874594 7:145799188-145799210 ATGCTTACTACCTGGGTGACAGG + Intergenic
1033926489 7:146468330-146468352 ATGCTTAGTACCTGGGTGACTGG + Intronic
1033981272 7:147169370-147169392 ATGCTCACTACCTAGGTGACAGG - Intronic
1034112434 7:148550652-148550674 GTGCTCAGTACCTGGGTGACAGG - Intergenic
1034244622 7:149635044-149635066 AGGCTCAGTACCTGGAAGGCTGG + Intergenic
1035103675 7:156422736-156422758 ATGCTCAGTCCCTGGGCGGCAGG - Intergenic
1035348255 7:158222621-158222643 AGGTTCACTACCTGGGTGGCAGG + Intronic
1035463511 7:159061240-159061262 ATGCTCTGTAGCTGGGTGGCGGG + Intronic
1035593306 8:834757-834779 ATGCTTAGTACCTGGATGTCAGG + Intergenic
1035691008 8:1559811-1559833 GTGCCCAGGAACTGGGTGGCCGG + Intronic
1035980574 8:4366018-4366040 GTGCTCACTACCTGGGCGACAGG - Intronic
1036495126 8:9263305-9263327 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1036774660 8:11602282-11602304 GTGCTCACCACCTGGGTGACAGG - Intergenic
1036918977 8:12833455-12833477 ATACTCAGTACCTGAGTGACAGG - Intergenic
1036975380 8:13405234-13405256 ATGCTCACTACCTGGGTGACAGG - Intronic
1037125243 8:15340483-15340505 ATGGTCAGTACCTGGGTGATGGG - Intergenic
1037182246 8:16021791-16021813 ATGCTCAGTATCTGAGTGACGGG - Intergenic
1037385104 8:18331055-18331077 ATGTTCACTACCTGGGTGACAGG + Intergenic
1037816314 8:22114616-22114638 AGGCTCAGTCCCAGGGTGGCTGG + Exonic
1038041553 8:23727780-23727802 ATGCTCAGCTCCTGGGTGGCTGG + Intergenic
1038094241 8:24289975-24289997 ATGCTGAGTACCCGGGTGGCAGG - Intergenic
1038250269 8:25897454-25897476 ATGCTCACTACCTGGGTGACAGG - Intronic
1038453687 8:27657412-27657434 GGGCTCACTACCTGGGTGACAGG - Intronic
1038592889 8:28856810-28856832 ATGCTCACTACCTGGGTGACAGG - Intronic
1038661949 8:29505196-29505218 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1038687706 8:29733746-29733768 GTGCTCACTACCAGGGTGACGGG - Intergenic
1038732896 8:30143062-30143084 GTGCTCACTACCTGGGTGATGGG + Intronic
1038892454 8:31741265-31741287 ATGTTCAGTACCTTGGTGCCAGG + Intronic
1038966321 8:32576911-32576933 ATGCTCAGTATCTGGGTGATGGG - Intronic
1039007501 8:33056290-33056312 ATGCTCACTACCTGGGTGACAGG - Intergenic
1039014925 8:33136750-33136772 ATGCTCAGTACCTGGGTAACAGG - Intergenic
1039073759 8:33670311-33670333 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1039090796 8:33827672-33827694 ATGCTCAGTACTTGGGTGACAGG + Intergenic
1039092778 8:33850180-33850202 ATGCTCAGTACCTGGATGAAGGG - Intergenic
1039451983 8:37682440-37682462 ATGCTCACTACCTGGGTGACAGG + Intergenic
1039783300 8:40809371-40809393 ATGCTCACTACCTGGGTGATGGG + Intronic
1039901182 8:41753630-41753652 GTGTTCACTACCTGGGTGACAGG - Intronic
1040011609 8:42665712-42665734 ATGCTCACTATCTGGGTGGTGGG + Intergenic
1040101190 8:43507408-43507430 ATGCTCACTACATGGGTGACGGG + Intergenic
1040624840 8:49135453-49135475 ATGCTAAGTACCTGGGTGGCAGG - Intergenic
1040762325 8:50864128-50864150 ATGCTCACTACCTGGGTGATGGG - Intergenic
1040947607 8:52900587-52900609 ATGCTTAGTACCTGGGTGGCAGG - Intergenic
1040985492 8:53289836-53289858 CTGCTTAGTACCTGGGTGATGGG + Intergenic
1041005442 8:53493297-53493319 TTGCTCAGTACCTGGGTGACAGG - Intergenic
1041127977 8:54664888-54664910 ATGCTTAGTACCTGGGTGATGGG + Intergenic
1041147004 8:54887527-54887549 ATGCTCAGTACCTGGATGATCGG - Intergenic
1041250788 8:55933012-55933034 ATGCTCACTACCTGGATGGTGGG + Intronic
1041343758 8:56873692-56873714 ATGCCCACTACCTGGGTGCCAGG + Intergenic
1041579275 8:59438757-59438779 GTGCTTAGTACCTGGGTGACAGG - Intergenic
1041715724 8:60930311-60930333 ATGCTCACTACCTTGGTGGTGGG - Intergenic
1041827121 8:62108683-62108705 ATGCTCACTACCTGGGTGATAGG + Intergenic
1041905950 8:63033719-63033741 GTGCTCACTACCTGGGTGACAGG - Intronic
1042094930 8:65204188-65204210 ATGCTCAGTACCTGGATGACAGG + Intergenic
1042181570 8:66092908-66092930 ATGCTCACTACCTGGGTGACAGG - Intronic
1042328185 8:67550134-67550156 ATGCCCAGTACCTGGGTGATGGG - Intronic
1042340607 8:67675074-67675096 ATGCTCACTACCTGGGTGATAGG + Intronic
1042421433 8:68594536-68594558 ATGCTCACTACCTGGGTGATGGG - Intronic
1042781916 8:72500609-72500631 GTGCTCACTACCTGGGTGATGGG + Intergenic
1042832508 8:73047077-73047099 GTGCTCACTACCTGGGTGACAGG + Intronic
1042850429 8:73211103-73211125 TTGCTCAATCCCTGGGTGGTGGG + Intergenic
1042868286 8:73374941-73374963 ATGGTCACTACCTGGGTGACAGG + Intergenic
1043005993 8:74819427-74819449 ATGCTCACTACCTGGGTGATGGG - Intronic
1043007535 8:74838507-74838529 ATGCTCACTACCTGGGTGATGGG - Intronic
1043135630 8:76520478-76520500 ATGCTCACTACCTGGGTGATGGG - Intergenic
1043322771 8:79010384-79010406 ATGCTCAGTACCTGAGTGATGGG - Intergenic
1043374733 8:79635799-79635821 ATGCTCAATACCTGGGTGATGGG + Intronic
1043533285 8:81173165-81173187 GTGCTCAGTACCTGGGTGATGGG + Intergenic
1043651997 8:82607879-82607901 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1043764369 8:84111198-84111220 ATGCTCACTTCCTGGGTGACAGG - Intergenic
1043917684 8:85941724-85941746 GTGGTCACTACCTGGGTGGTGGG - Intergenic
1043950107 8:86299221-86299243 ATGCTCACTACCTGGGTGATGGG - Intronic
1044033485 8:87268047-87268069 GTGCTCACTACCTGGGTGATGGG - Intronic
1044180715 8:89190853-89190875 ATGTTCACTACCTGGGTGACGGG + Intergenic
1044185696 8:89248980-89249002 ATGCTGACTACCTGGGTGACAGG - Intergenic
1044376959 8:91486417-91486439 ATGCTCATTACCTGGGTGACGGG - Intergenic
1044596388 8:93962810-93962832 ATGCTCACTACCAGGGTGACAGG - Intergenic
1044648875 8:94474261-94474283 ATGCTCACTACCTGGGTGACAGG + Intronic
1044768471 8:95603441-95603463 ATGCTCACCACCTGGGTGACGGG + Intergenic
1044910226 8:97050060-97050082 TTGCTTAGTACCTGAGTGGGAGG + Intronic
1045060458 8:98406390-98406412 ATGCTCACTACCTGGGTGATGGG - Intronic
1045191983 8:99892682-99892704 TCGCTCAGTATATGGGGGGCGGG - Intronic
1046019320 8:108645400-108645422 ATGCTCAGTGCCTGGGTGATGGG + Intronic
1046073516 8:109287678-109287700 ATGCTCAGTACCTGGGTGACAGG + Intronic
1046161703 8:110375384-110375406 GCTCTCAGTACCTGGGTGGCAGG - Intergenic
1046219522 8:111194949-111194971 ATCCTCACTACCTGGGTGGCAGG - Intergenic
1046478254 8:114778421-114778443 ATGCTCACTACCTGGGTGACAGG + Intergenic
1046577203 8:116045438-116045460 GTGCTCAGTTCCTGGGTGATGGG - Intergenic
1046597382 8:116276378-116276400 ATGCTCAATACCTGGGTGATGGG + Intergenic
1046772570 8:118130835-118130857 ATGCTTAGTACCTGGGTGCCAGG - Intergenic
1046776495 8:118169100-118169122 ATGCTCACTACCTGGGTGACAGG + Intergenic
1046842372 8:118873921-118873943 ATGCTCACTCCCTGGGTGACAGG + Intergenic
1046963114 8:120130811-120130833 ATGCTCACTACCTGGGTGATGGG - Intronic
1047016437 8:120728427-120728449 ATGCTCAGTACCTGGGTGACAGG - Intronic
1047066077 8:121284535-121284557 ATGCTCACAACCTGGGTGACAGG + Intergenic
1047117218 8:121857106-121857128 ATGCTCCCTACCTGGGTGACGGG + Intergenic
1047165162 8:122430564-122430586 ATGCTCAGTACCTCAGTGACTGG + Intergenic
1047177958 8:122559190-122559212 ATGTTCACTACCTGGGTGGCAGG + Intergenic
1047300170 8:123607216-123607238 ATGCTTAGTACCTGGGTGATGGG - Intergenic
1047540020 8:125755679-125755701 ATGCTCACTACCTGGGTGATGGG - Intergenic
1047630681 8:126704186-126704208 ATGCTCACTACCTGGGTGATGGG + Intergenic
1047632848 8:126727116-126727138 ATGCTCACTACCTGGGTGATGGG - Intergenic
1047686082 8:127305821-127305843 TTGTTGAGTAGCTGGGTGGATGG - Intergenic
1047823201 8:128544045-128544067 TCGCTCAATAACTGGGTGGAGGG + Intergenic
1047906929 8:129482411-129482433 ATGCCCAGTACCTGGGTGATGGG - Intergenic
1047919818 8:129623344-129623366 ATGCTCAATACCTAGGTGACGGG - Intergenic
1048124719 8:131621081-131621103 ATGCTCAGTACCTGGGTGATAGG + Intergenic
1048241458 8:132746068-132746090 ATGCTTAGTACCTGGGTGATGGG + Intronic
1048347860 8:133591208-133591230 TTCCTCAGTTGCAGGGTGGCAGG + Intergenic
1048665291 8:136654596-136654618 ATGCTCACTACCTGGGTGATGGG - Intergenic
1048804175 8:138224079-138224101 ATGCTCAGTACCTGGGTGACAGG + Intronic
1049986563 9:957042-957064 ATGCTCAGTACCTGGGTGACAGG - Intronic
1050539626 9:6659099-6659121 TTGCTCAATACCTAGGGGACTGG - Intergenic
1050677034 9:8067927-8067949 ATGCTCACTACCTGGGTGACGGG - Intergenic
1050764572 9:9116108-9116130 ATGCTCACTACCTGGGTAACGGG + Intronic
1050816500 9:9819602-9819624 ATGCTCAGTACCTGGGTGATAGG - Intronic
1050836949 9:10093987-10094009 ATGCTCACTACCTGGGTGATAGG + Intronic
1051098590 9:13495202-13495224 ATGCTCACTACCTGGGTGACAGG - Intergenic
1051933317 9:22412974-22412996 ATGCTTACTACCTGGGTGACAGG + Intergenic
1052164278 9:25304360-25304382 ATGCTCACTACCTGGGTGATGGG + Intergenic
1052190465 9:25655619-25655641 ATGCTCAGTGCCTGGGTGATGGG + Intergenic
1052279561 9:26717356-26717378 GTGGTCAGTACCTGGGTAACTGG - Intergenic
1052390277 9:27871413-27871435 ATGCTCAGTACCTGAGTGATGGG - Intergenic
1052489931 9:29152692-29152714 ATGCTCACTACCTGGGTGATGGG + Intergenic
1052532149 9:29700076-29700098 ATGCTCACTACCTGGGTGATGGG + Intergenic
1052601367 9:30636702-30636724 ATGCTCACTACCTGGGTGACAGG - Intergenic
1052607064 9:30718017-30718039 ATGCTCACTACCCTGGTGGCAGG - Intergenic
1052636785 9:31116752-31116774 ATGCTCAGTACCTGGGTGGCGGG - Intergenic
1053696914 9:40648065-40648087 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
1053943312 9:43278199-43278221 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
1054262665 9:62883421-62883443 ATGCGCAGTACCTGGGTGATGGG - Intergenic
1054308166 9:63447298-63447320 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
1054406902 9:64771289-64771311 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
1054440526 9:65256755-65256777 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
1054489881 9:65765169-65765191 TTGCTCAGAACCTGGCTTGCAGG - Intergenic
1055239104 9:74162982-74163004 ATGCTCAGTACCTGGATGACAGG + Intergenic
1055434895 9:76282720-76282742 ATGCTCACTACCTGGGTGATGGG - Intronic
1055496902 9:76864347-76864369 ATGCTCACTACCTGGGTGACAGG + Intronic
1055915159 9:81393260-81393282 ATGCTTAGTACCTGGGTGACAGG + Intergenic
1055978696 9:81978818-81978840 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1056106734 9:83354551-83354573 ATGCTTAGTACCTGGGTAACAGG + Intronic
1056112572 9:83410241-83410263 ATACTCAGTACCTGGGTGATGGG - Intronic
1056182992 9:84103486-84103508 ATGCTCAGTACCTGGGTGACGGG + Intergenic
1056423914 9:86457042-86457064 TAGCTCAGTAACTGCGTGGATGG - Intergenic
1056465769 9:86852939-86852961 GTGCACACTACCTGGGTGACGGG - Intergenic
1056565426 9:87768518-87768540 ATGCTCAGTATTTGGGTGACTGG - Intergenic
1056597649 9:88020917-88020939 GTGCTCAGTACCTGGGTGATAGG - Intergenic
1056894266 9:90527267-90527289 ATTCTCAGTACCTGGGTGATGGG - Intergenic
1057116743 9:92530793-92530815 ATGCTCAGTACCTGGGTGATGGG - Intronic
1057510220 9:95672355-95672377 ATGCTCAGTACCTGGGTGCCAGG + Intergenic
1057516230 9:95723838-95723860 ATGCTCACTACCTGGGTGATGGG + Intergenic
1057940943 9:99283632-99283654 GTGCTCAGTACCTGGGTGACAGG + Intergenic
1057985874 9:99713233-99713255 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1058061962 9:100506961-100506983 ATACTCACTACCTGGGTGGCAGG - Intronic
1058106210 9:100974985-100975007 GTGCTCACTACCTGGGTGACAGG - Intergenic
1058245777 9:102624332-102624354 ATGCTCACTACCTGGGTGATAGG - Intergenic
1058392814 9:104515658-104515680 ATGCTCACTACCTGGGTGATGGG + Intergenic
1058441234 9:105009683-105009705 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1059066194 9:111087256-111087278 TTGCTCAGTACCTGGGTGATGGG + Intergenic
1059115113 9:111594394-111594416 ATGCTCACTGCCTGGGTGACAGG + Intronic
1059129792 9:111734914-111734936 ATGCTCAATACCTGGGTGATGGG - Intronic
1059807404 9:117817662-117817684 ATGCTTACTACCTGGGTGACAGG - Intergenic
1060314067 9:122492096-122492118 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1060321520 9:122565660-122565682 ATGCTCACTACCTGGGTGACGGG - Intergenic
1061303393 9:129719025-129719047 TTACTGAGCACCTGTGTGGCAGG - Intronic
1061569133 9:131465341-131465363 ATGCTCAGTACCTGGGTGATAGG - Intronic
1061861051 9:133469023-133469045 CTGCTCAGTGCCCAGGTGGCAGG - Exonic
1062043665 9:134415489-134415511 ATGGTCAGTCCATGGGTGGCTGG + Intronic
1062617875 9:137406348-137406370 CTGCACAGAACCAGGGTGGCTGG + Intronic
1202779367 9_KI270717v1_random:21724-21746 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
1203547646 Un_KI270743v1:140397-140419 TTGGTCAGTACCTGGCCTGCTGG - Intergenic
1203586432 Un_KI270747v1:8104-8126 TTGCTCAGAACCTGGCTTGCAGG + Intergenic
1203617032 Un_KI270749v1:75093-75115 TTGCTCAGAACCTGGCTTGCAGG - Intergenic
1185532955 X:836320-836342 ATGCTCACTACCTGGGTGATGGG + Intergenic
1185533181 X:838359-838381 ATGCTCAGTGCCTGGGTGATGGG + Intergenic
1185727234 X:2431802-2431824 GTGCTGACTACCTGGGTGACGGG + Intronic
1185885119 X:3775686-3775708 ATGCTCAGTATCTGGGTGATGGG - Intergenic
1185887988 X:3799946-3799968 AGGCTCACTACCTGGGTGACAGG - Intergenic
1185889606 X:3812702-3812724 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1185927548 X:4163983-4164005 GTGCTCAATACCTGGGTGATGGG + Intergenic
1185969770 X:4649492-4649514 ATGTTCAGTACCTGGGTGACAGG + Intergenic
1186091714 X:6055534-6055556 ATGCTCACTACCTGGGTGACAGG + Intronic
1186148669 X:6650943-6650965 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1186600784 X:11034588-11034610 GTGCTCACTACCTGGGTGACGGG + Intergenic
1186666957 X:11726940-11726962 ATGCTCAGTACCTGGTTGACAGG - Intergenic
1186677073 X:11829462-11829484 ATGCTCACTATCTGGGTGACGGG + Intergenic
1186698118 X:12059558-12059580 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1186938667 X:14479480-14479502 ATCCTCAGTACCTGGATGACGGG - Intergenic
1187089916 X:16085338-16085360 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1187114890 X:16339395-16339417 ATGTTCACTACCTGGGTGACAGG - Intergenic
1187269053 X:17763125-17763147 ATGCTCACCACCTGGGTGACGGG + Intergenic
1187320474 X:18233531-18233553 ATGCTCACCACCTGGGTGACGGG - Intergenic
1187728139 X:22224804-22224826 TTGCTTGATACCTGGGTGACTGG + Intronic
1187772888 X:22721638-22721660 ATGCTCACTACCTGGGTGACGGG - Intergenic
1187778253 X:22788048-22788070 CTGCTCACTACCTGGGTGACAGG + Intergenic
1187853700 X:23616328-23616350 ATGCTCACTACCTGGGTGACAGG + Intergenic
1187929850 X:24284020-24284042 TTGCTGAGTTCATGGGTGGATGG - Intergenic
1187991834 X:24882418-24882440 ATGCTCACTACCTGGGTGACAGG - Intronic
1188018091 X:25126983-25127005 ATGCTGACTACCTGGGTGACAGG + Intergenic
1188025909 X:25209275-25209297 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1188029798 X:25251668-25251690 ATGCTCATTACCTTGGTGACGGG - Intergenic
1188326933 X:28816336-28816358 ATGCTCAGTAACTGGGTGATGGG - Intronic
1188384705 X:29541825-29541847 ATGCTCAGTACCTGTGTGAGAGG + Intronic
1188406223 X:29813680-29813702 ATGCTCACTACCTGGGTGATGGG - Intronic
1188429195 X:30086375-30086397 ATGCTCTTTACCTGGGTGACAGG + Intergenic
1188485198 X:30674772-30674794 ATGCTCACTAACTGGGTGACGGG - Intronic
1188557934 X:31432993-31433015 ATACTCACTACCTGGGTGACAGG - Intronic
1188605495 X:32023986-32024008 ATGCTCGCTACCTGGGTGGTGGG + Intronic
1188676108 X:32941704-32941726 ATACTCAGTACCTGGGTGACAGG + Intronic
1188697728 X:33216498-33216520 ATGCTCACTACCTGGGTGACTGG + Intronic
1188716022 X:33459836-33459858 ATGCTCAATACCTGAGTGACAGG + Intergenic
1188759255 X:34005372-34005394 ATGCTCATTACCTGAGTGACAGG - Intergenic
1188761169 X:34032015-34032037 ATGCTCATTACCTAGGTGACAGG - Intergenic
1188877821 X:35453393-35453415 ATACTCAGTACCTGGGGGACAGG - Intergenic
1188974228 X:36654039-36654061 ATGCTCAGTACCTGGGCGATGGG - Intergenic
1189125807 X:38445025-38445047 ATGCTCAGTACCCGGGTGATGGG - Intronic
1189173183 X:38929151-38929173 ATGCTCAGTACCAGGGTGACAGG + Intergenic
1189422722 X:40870920-40870942 ATGCTCAGTGCCTGGGGGACAGG - Intergenic
1189424613 X:40886924-40886946 ATGCTCATTACCTGGGTGATAGG - Intergenic
1189542994 X:42012041-42012063 ATGCTCACTACCTGGGTGACGGG + Intergenic
1189547829 X:42060841-42060863 TTGCTCAGTACCTGGGTGACAGG - Intergenic
1189598680 X:42597809-42597831 ATGCTCAGTACCTAGGTGATAGG + Intergenic
1189812024 X:44789671-44789693 GTGCTCACTATCTGGGTGACGGG + Intergenic
1189936275 X:46072332-46072354 ATGCTCATTACCTGGGTGATGGG - Intergenic
1190002475 X:46702380-46702402 ATGTTCACTACCTGGGTGACAGG - Intronic
1190027711 X:46941030-46941052 ATGCTCACTGCCTGGGTGACAGG - Intronic
1190132891 X:47767811-47767833 ATGCTCACTACCTGGGTGATGGG - Intergenic
1190227707 X:48559075-48559097 ATGCTCAGAACCAGGGTGCCAGG - Intronic
1190407631 X:50103448-50103470 TTGCTCAGTAACTCAGAGGCAGG + Intergenic
1190409663 X:50123832-50123854 GTGCTCACTACCTGGGTGACAGG - Intergenic
1190441631 X:50480657-50480679 ATGCTCACTACCTGGATGACAGG - Intergenic
1190464332 X:50710562-50710584 ATGCTTAGTACCTAGGTGACGGG + Intronic
1190585805 X:51940501-51940523 ATGTTCACTACCTGGGTGACAGG - Intergenic
1190600030 X:52082161-52082183 ATGCTCACTACCTGGGTGATAGG - Intergenic
1190870087 X:54417550-54417572 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1190897605 X:54636466-54636488 ATGCTCACTACCTGGGTGATGGG - Intergenic
1191164292 X:57371186-57371208 ATGCTCACTAGCTGGGTGACAGG - Intronic
1191164358 X:57371742-57371764 ATGCTCACTACCTGGGTAACAGG - Intronic
1191182292 X:57576493-57576515 ATGCTCAATACCTGGGTGATGGG + Intergenic
1191215270 X:57927016-57927038 ATGCTCAATACCTGGGTGATGGG - Intergenic
1191784816 X:64906013-64906035 TTGCTTAGTACCAAGGCGGCTGG + Intergenic
1191826729 X:65374323-65374345 ATGCTCACTACCTGGGTGACAGG + Intronic
1191916255 X:66205012-66205034 ATGCTCACTACCTGGATGACAGG - Intronic
1191964188 X:66739053-66739075 ATGCTCATTACCTGGGTGACTGG - Intergenic
1192724389 X:73732636-73732658 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1192884841 X:75325813-75325835 CTGCTCACTACCTGGGTGACAGG - Intergenic
1192903883 X:75528908-75528930 ATGCACAGTACTTGGGTGACAGG - Intergenic
1192930291 X:75799508-75799530 TTGCTGAGTTCCTGGGGGGAGGG - Intergenic
1193032600 X:76915540-76915562 ATGCTAAGTACCTGGGTGATGGG + Intergenic
1193173568 X:78365044-78365066 ATGCTCACTACCTGGGTGATGGG - Intergenic
1193181255 X:78459856-78459878 ATGCTCAGTACCAGGGTGATGGG - Intergenic
1193280660 X:79645321-79645343 ATGCTCACTACCTGGGTGATGGG - Intergenic
1193308490 X:79977015-79977037 GTGCTCACTACCTGGGTGGCGGG + Intergenic
1193313446 X:80036552-80036574 ATGCTCAGTACGTGGGTGACGGG - Intergenic
1193326564 X:80184877-80184899 TGGCTTAGTACCTGGGTGATGGG - Intergenic
1193478255 X:81994552-81994574 TTGTTCAGTACCTGTGTGATGGG - Intergenic
1193609141 X:83607278-83607300 ATGCTCACTACCTAGGTGACAGG + Intergenic
1193620492 X:83747851-83747873 CTGCTCACTACCTTGGTGACAGG - Intergenic
1193725533 X:85034559-85034581 ATGCTCACTACCTGGGTGATGGG - Intronic
1193847483 X:86492545-86492567 ATGCTTACTACCTGGGTGACAGG - Intronic
1193895111 X:87104345-87104367 ATGCTCACTACCTTGGTGACAGG - Intergenic
1194030818 X:88811536-88811558 ATGCTGAGTACCTTGGTGACAGG - Intergenic
1194096488 X:89645819-89645841 ATGCTCACTACCTGGGTGATGGG + Intergenic
1194285974 X:92010818-92010840 GTGCTCACTACTTGGGTGACGGG - Intronic
1194359737 X:92934931-92934953 ATGTTCAGTACCTGGGTGGTGGG + Intergenic
1194753708 X:97712575-97712597 ATGTTCAGTACCTGGGTGACAGG + Intergenic
1194780120 X:98014217-98014239 ATTCTCAGTACCTGGGTGATGGG - Intergenic
1194902324 X:99527954-99527976 GTGCTCAGTACCTGGGTAATGGG + Intergenic
1194904068 X:99551655-99551677 ATGCTCACTACTTGGGTGACAGG - Intergenic
1194908513 X:99609546-99609568 CTGCTAAGTAGCTGGGTAGCTGG - Intergenic
1194922758 X:99787474-99787496 ATGCTCACTACCTGGGTGACTGG - Intergenic
1195015310 X:100773767-100773789 ATGCTCACTACCTGGGTGATAGG - Intergenic
1195058865 X:101174708-101174730 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1195105836 X:101600710-101600732 TTGATCAGGCCCTGGGAGGCAGG - Intergenic
1195107047 X:101613057-101613079 TTGATCAGGCCCTGGGAGGCAGG + Intergenic
1195121657 X:101760257-101760279 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1195298568 X:103504227-103504249 ATGCTCACTACCTGGGTGATGGG + Intronic
1195413985 X:104600614-104600636 ATGCTCAGTATCTTGGTGACAGG - Intronic
1195420570 X:104670692-104670714 ACGCTCACTACCTGGGTGACAGG - Intronic
1195500679 X:105594937-105594959 ATGCTCACTACCTGCGTGACAGG + Intronic
1195588577 X:106597272-106597294 ATGCTCACTACCTGGGTGATGGG + Intergenic
1195714178 X:107802507-107802529 ATGTTCAGTACCTGGATGACAGG - Intergenic
1195957355 X:110345625-110345647 CTGCTCACTACCTGGGTGACGGG + Intronic
1196044021 X:111237757-111237779 ATACTCAGTACCTGGGTGACAGG - Intergenic
1196314496 X:114207225-114207247 ATGCTCACTTCCTGGGTGACAGG + Intergenic
1196526582 X:116734946-116734968 ATGCTCACTACCTGGGTGACAGG - Intergenic
1196652742 X:118185215-118185237 CTGCTTAGTACCTGGGTGACGGG + Intergenic
1196760381 X:119195627-119195649 ATGCTCACTATCTGGGTGGCAGG + Intergenic
1196976564 X:121164127-121164149 ATGCTCACTACCCGGGTGGTGGG - Intergenic
1197145951 X:123172458-123172480 ATGCTCACTACTTGGGTGACAGG + Intergenic
1197321016 X:125031055-125031077 CTGCCCAGTACCTGGATAGCAGG - Intergenic
1197439102 X:126468867-126468889 TTGGTCAGTTCCTGGGAGGTGGG - Intergenic
1197473218 X:126888895-126888917 TTCCTAACTACCTGGGTGACAGG + Intergenic
1197491688 X:127124597-127124619 ATGCTCACTACCTGGGTGATGGG + Intergenic
1197682185 X:129397409-129397431 GTGCTCATTACCTGGGTGACAGG + Intergenic
1197703017 X:129614026-129614048 ATGCTCACTACCTGGGTGACAGG + Intergenic
1198029922 X:132745048-132745070 TTGCTCAGTACCTGGGTGATGGG - Intronic
1198106334 X:133465216-133465238 ATGCTCAATATCTGGGTGGCAGG - Intergenic
1198132220 X:133707258-133707280 ATGCTCACTACCTGGGTGATGGG + Intronic
1198277204 X:135106339-135106361 ATGCTCACTAGCTGGGTGACAGG - Intergenic
1198558293 X:137819614-137819636 ATGCTCAGTACCTGGGTGACGGG + Intergenic
1198712448 X:139520324-139520346 ATGCTCACTACCTGGGTGGTGGG - Intergenic
1198718061 X:139583651-139583673 ATGCTCACTACCTGGGTGACAGG + Intronic
1198718705 X:139591790-139591812 ATGCTCAGTACCTGGGTGATGGG + Intronic
1198721692 X:139628522-139628544 ATGCTCACTACCTGGGTGACAGG + Intronic
1198914866 X:141658748-141658770 ATACTCACTACCTGGGTGACAGG + Intronic
1199192877 X:144992711-144992733 ATGCTCAGCGCCTGGGTGACAGG - Intergenic
1199216003 X:145261069-145261091 ATGCTCACTACCTGGGTGATGGG - Intergenic
1199236030 X:145493582-145493604 ATGCTCACTACCTGGGTGATGGG + Intergenic
1199304804 X:146255022-146255044 ATGCTCAGTACCTGGGTGATGGG + Intergenic
1199383650 X:147199331-147199353 TGCCTCAGCTCCTGGGTGGCTGG - Intergenic
1199405813 X:147458244-147458266 ATGCTCACTATCTGGGTGACAGG + Intergenic
1199406591 X:147469141-147469163 ATGCTCAGTACCTGGGTAACAGG - Intergenic
1199410576 X:147517970-147517992 ATGCTCAGCACCAGGGTGACAGG - Intergenic
1199458194 X:148053127-148053149 ATGCTCAGTACTTGGGTGATGGG - Intergenic
1199461628 X:148091884-148091906 ATGCTCACTACCTGGGTGATGGG - Intergenic
1199498568 X:148483467-148483489 ATGATCACTACCTGGGTGGCGGG + Intergenic
1199560321 X:149155869-149155891 ATGCTCACTACCTGGGTTGTGGG - Intergenic
1199597778 X:149521727-149521749 ATGCTCACTACCTGGGTGACAGG + Intronic
1199945513 X:152663124-152663146 GTGCTCAGCACCTGGATGACGGG - Intergenic
1199981360 X:152922302-152922324 TTCCTCAGTGACTGAGTGGCAGG - Intronic
1200373247 X:155750327-155750349 ATGCTCACTACCTGGGTGACGGG + Intergenic
1200374275 X:155763199-155763221 CTGCTTACTACCTGGGTGACAGG + Intergenic
1200449500 Y:3307201-3307223 ATGCTCACTACCTGGGTGATGGG + Intergenic
1200603526 Y:5235359-5235381 GTGCTCACTACTTGGGTGACGGG - Intronic
1200667932 Y:6050756-6050778 ATGTTCAGTACCTGGGTGGTGGG + Intergenic
1200772577 Y:7140745-7140767 ATGCTCAGTACCTGGGTGATGGG - Intergenic
1200942060 Y:8794316-8794338 ATGCTCACTACCTGGGTGACAGG + Intergenic
1201194639 Y:11480005-11480027 ATGCTCAGAACCTGGCTTGCAGG + Intergenic
1201222370 Y:11784260-11784282 ATGCTCAGTACCTGGGTAACAGG + Intergenic
1201288685 Y:12401354-12401376 GTGCTGAGTACGTGGGTGGGGGG - Intergenic
1201717288 Y:17059570-17059592 ATGCTCAGTACCTGGGTAAAAGG + Intergenic