ID: 1079217858

View in Genome Browser
Species Human (GRCh38)
Location 11:18530515-18530537
Sequence AGGTTAATCCAGATGGAGTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079217858_1079217861 16 Left 1079217858 11:18530515-18530537 CCTAACTCCATCTGGATTAACCT 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1079217861 11:18530554-18530576 ATTTTTATTTTTTTAGAGACAGG 0: 81
1: 694
2: 4238
3: 32829
4: 60860
1079217858_1079217862 17 Left 1079217858 11:18530515-18530537 CCTAACTCCATCTGGATTAACCT 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1079217862 11:18530555-18530577 TTTTTATTTTTTTAGAGACAGGG 0: 145
1: 2063
2: 24751
3: 44032
4: 93868

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079217858 Original CRISPR AGGTTAATCCAGATGGAGTT AGG (reversed) Exonic
901027148 1:6284731-6284753 AGGTCCATCCAGGTGGGGTTGGG + Intronic
901788143 1:11638225-11638247 AGGTTGAGCAAGTTGGAGTTGGG - Intergenic
903834372 1:26193338-26193360 AGGTTAGGACAGATGGAGCTTGG + Intronic
904302252 1:29561848-29561870 AGGTGAATCCAGGTGGAATGAGG + Intergenic
905928902 1:41772382-41772404 AGGTTAAGCCAGCTGCAGGTGGG + Intronic
906004668 1:42458017-42458039 AGGTCATTCCAGGTGGAGTATGG + Intronic
908348237 1:63258159-63258181 AGTTTAGTCCACATGGAGTATGG - Intergenic
913247336 1:116881651-116881673 GGCTGAGTCCAGATGGAGTTGGG - Intergenic
918920895 1:190708439-190708461 AGTTTATTCCAGAAGTAGTTAGG - Intergenic
922670945 1:227508456-227508478 AGGTGAAACCAGATGCTGTTAGG - Intergenic
924243377 1:242060433-242060455 AGGTGAAACCAGATGCTGTTAGG - Intergenic
1063189956 10:3684173-3684195 AGGTTAAGCCTGATGAAGTCGGG - Intergenic
1065129967 10:22610659-22610681 AGTTTAATCCACAGGGAGTGTGG + Intronic
1068709532 10:60118509-60118531 TGGTTAATCCATATAGAATTTGG - Intronic
1070786211 10:79163644-79163666 TGGTTAATCCTGATGGACCTCGG - Intronic
1076248870 10:128968782-128968804 TAGTTTATCCAGATGGATTTTGG + Intergenic
1076630687 10:131850224-131850246 AAGTTAATGCAGATGGACCTCGG + Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG + Intronic
1078792815 11:14561632-14561654 AGGACAGTCCAGGTGGAGTTGGG - Intronic
1079217858 11:18530515-18530537 AGGTTAATCCAGATGGAGTTAGG - Exonic
1080870114 11:36229410-36229432 AGATTAACCCATATGGACTTTGG - Exonic
1083908745 11:65692657-65692679 AGGTTTATCCAGATGAACTGAGG + Intergenic
1086684722 11:89718259-89718281 AGGTTTATCCAGATGAAGGCAGG - Intergenic
1087908361 11:103725148-103725170 AGGTGAATTCAGATGGAGATGGG - Intergenic
1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG + Intronic
1098724209 12:73941852-73941874 AGCTTAATCCACTTGGAGTCTGG + Intergenic
1099927846 12:89039904-89039926 AATTTAAGCCAGATGGAATTTGG + Intergenic
1101794283 12:107958518-107958540 AGGTGAAACCAGGTGGAGGTGGG - Intergenic
1102708056 12:114899670-114899692 AGGTCATTCCAGGTGGAGTTGGG + Intergenic
1117389229 14:55247356-55247378 TGGTTTTTCCAGATGGGGTTGGG - Intergenic
1126543024 15:49842792-49842814 TAGTAAATCCAGATGGAGTGAGG - Intergenic
1126917054 15:53477536-53477558 AGGCTAATGCAGCTGGAGTGTGG + Intergenic
1131221809 15:90590749-90590771 AGGTTAAGCCAAATATAGTTTGG + Intronic
1132014877 15:98306667-98306689 AAGTTTATGCAGATGCAGTTGGG - Intergenic
1134107228 16:11493795-11493817 AGCTAAATCGAGATGGAGGTAGG + Exonic
1135689801 16:24527077-24527099 AGATTAATCCAGATTAAATTTGG - Intergenic
1138996313 16:62457465-62457487 TGGTGAATCTAGATGGATTTGGG + Intergenic
1139709581 16:68765527-68765549 TGATTAATCCATCTGGAGTTTGG + Intronic
1139934071 16:70555049-70555071 AGGTCTATCCAGATGGCATTCGG + Exonic
1141115373 16:81304249-81304271 AAGTTTATCCAGATACAGTTGGG - Intergenic
1142042049 16:87900451-87900473 AGGCTGGTCCAGATGGAGCTGGG - Intronic
1144350951 17:14395738-14395760 AGGTTAACCCCTATGGAGTGCGG + Intergenic
1144472496 17:15557245-15557267 AGCTTAATCTATATGGAGGTAGG - Intronic
1144836722 17:18160277-18160299 TGGCTAAACCAGATTGAGTTGGG - Intronic
1144923983 17:18787443-18787465 AGCTTAATCTATATGGAGGTAGG + Intronic
1146589991 17:34120667-34120689 AGGTTATACTAGATGGAGTAAGG + Intronic
1147892964 17:43730246-43730268 AGATTAATCCAGGTGGATTGGGG + Intergenic
1150226037 17:63524866-63524888 AAGCTCATTCAGATGGAGTTTGG + Intronic
1150816669 17:68397256-68397278 TGGTTAATGCAGCTGGAGTCAGG + Intronic
1152759442 17:82100326-82100348 ATGGGAATCCAGACGGAGTTGGG - Intergenic
1153599740 18:6768725-6768747 AGGCTAAGGCAGATGGAATTTGG - Intronic
1157291582 18:46413335-46413357 AGGCTAATGCAGATAGATTTGGG - Intronic
1158836748 18:61338401-61338423 AAGTTAATCCATATGTAATTAGG - Intronic
1159184582 18:64952256-64952278 ACATTAAACCAGATGGAGTAGGG + Intergenic
1159405159 18:67992417-67992439 AGGTTTATCCTGATGAGGTTTGG + Intergenic
1159729715 18:72010281-72010303 AGGTTCATCCTAATGGTGTTTGG + Intergenic
1167695036 19:51010169-51010191 AGGGAAATCCAGGTGGAGTGAGG + Intergenic
1167880377 19:52452879-52452901 AGGTTAATTCATCTGAAGTTTGG + Intergenic
925124193 2:1442209-1442231 AGACTAATACAGATGGAGTAGGG + Intronic
925599300 2:5591431-5591453 AGCTCAGGCCAGATGGAGTTTGG + Intergenic
926077810 2:9955830-9955852 AGGTGAATCCAGAAGGAGAGCGG - Intronic
926466662 2:13198542-13198564 AGGTTAATCCAGGCTGAGATTGG + Intergenic
935436804 2:103044458-103044480 AGGTTTATGGAGATGGAATTAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938196904 2:129336299-129336321 ATGTGAATCCAGCTGAAGTTGGG - Intergenic
939687545 2:145217240-145217262 GGATTAATACAGATGGATTTTGG + Intergenic
941789477 2:169535635-169535657 ATGTTAATCAGGATTGAGTTGGG - Intronic
1168958408 20:1850647-1850669 TGGTTAATGTAGACGGAGTTAGG - Intergenic
1169897573 20:10520745-10520767 ATGTTCATACAGATGGTGTTGGG - Intronic
1171060048 20:21947681-21947703 ACTCAAATCCAGATGGAGTTTGG + Intergenic
1174451230 20:50621808-50621830 AGCTTAAGCCAGCTGGAGTTGGG + Intronic
1177352878 21:19967670-19967692 AGGTCATTGCAGATGTAGTTAGG + Intergenic
1182253371 22:29019929-29019951 AGGATAATCAAGATGGGGGTGGG - Intronic
951454233 3:22872634-22872656 CAGTTAATCCAGACTGAGTTAGG + Intergenic
952826465 3:37529270-37529292 AGGTGATTCCAGATGGTGGTAGG + Intronic
956168204 3:66412424-66412446 TGGTTGATGGAGATGGAGTTTGG - Intronic
958654866 3:96987627-96987649 AGTTTTACCCAGATGGATTTGGG + Exonic
959090799 3:101900543-101900565 AGGTTATTGCAAATGGAGGTAGG + Intergenic
960780977 3:121316296-121316318 AGGTAAATTCAGAAGGAGCTAGG + Intronic
964736288 3:159922055-159922077 AAGTTAGTCCAGAGGGATTTTGG - Intergenic
967268965 3:187717432-187717454 ATGTAAATACATATGGAGTTGGG - Intronic
967736617 3:192959766-192959788 AGACTAATACAGATGGAGTAGGG - Intergenic
970155482 4:13137444-13137466 AGGTTGAAGCAGATGGAGTTAGG + Intergenic
978320788 4:107493118-107493140 AGGTTAAACTAGAAGTAGTTGGG - Intergenic
982707732 4:158728623-158728645 AGTTTCATCCAGATGGAGTGGGG + Intergenic
994056343 5:95421001-95421023 AGGATTAACCAGATGGAGATGGG - Intronic
994136442 5:96292897-96292919 TGATTAAGCCAGCTGGAGTTTGG + Intergenic
996335933 5:122384050-122384072 AGGGTAATTCATTTGGAGTTAGG + Intronic
997705186 5:135943845-135943867 AGCTTAACAGAGATGGAGTTGGG + Intronic
999024362 5:148209314-148209336 AGCTCACTCCAGATGGAGTCAGG - Intronic
1003168798 6:3704162-3704184 AGGTGAAGCCAGCTGGACTTCGG - Intergenic
1004271304 6:14198382-14198404 AGGTAAATCCAGATGTATTCAGG + Intergenic
1010374995 6:75157597-75157619 AGGGGAATCCAGATGGAGGCTGG + Intronic
1013352643 6:109319308-109319330 AGGTTTTTCCAGAGGAAGTTAGG + Intergenic
1013398212 6:109765140-109765162 AGTTTGATACAGATGCAGTTAGG + Exonic
1015379104 6:132546622-132546644 AGGGTAAACCAGAGGGAATTTGG - Intergenic
1019507159 7:1397443-1397465 AGGTTCAGCCAGTGGGAGTTTGG + Intergenic
1019547752 7:1586622-1586644 AGGTTAATTCAATTGGACTTGGG + Intergenic
1022640299 7:32176167-32176189 TAGTTAATTCAGATGTAGTTAGG - Intronic
1026685110 7:72503319-72503341 GGCTTAATCTACATGGAGTTTGG - Intergenic
1030804864 7:113903687-113903709 ATATTAATCCAGAAAGAGTTTGG - Intronic
1033236971 7:139645879-139645901 TGGTTATTCCAGCAGGAGTTAGG + Intronic
1035055619 7:156034015-156034037 AGGTAATTCTAGATGGAGTAAGG + Intergenic
1038244202 8:25839364-25839386 AGTTTAATCAAGAAGGACTTAGG - Intergenic
1039147362 8:34463924-34463946 ATGTTACTGCAAATGGAGTTTGG - Intergenic
1039271836 8:35890583-35890605 TGCCTAATCCAGTTGGAGTTGGG + Intergenic
1039658970 8:39441725-39441747 ATGTTATTCCAGACAGAGTTAGG - Intergenic
1041429649 8:57764946-57764968 AGATTAATCCATATGAGGTTTGG - Intergenic
1041522391 8:58770839-58770861 AGGTTAATGCAGTTAGATTTAGG + Intergenic
1041841506 8:62277688-62277710 AGGTAAGTTCAGATGGATTTTGG + Intronic
1042211517 8:66385937-66385959 AGATTAATCCAGAAGGGATTTGG - Intergenic
1046776991 8:118174785-118174807 ATGTTAATACTGATGGATTTGGG - Intergenic
1047513362 8:125532276-125532298 AGGTTTAGCAAAATGGAGTTGGG + Intergenic
1048063284 8:130942901-130942923 AGGTTGATCAAGATGGTGGTGGG + Intronic
1050779454 9:9313133-9313155 AGGCTAATTGAGATAGAGTTAGG - Intronic
1053654872 9:40207235-40207257 GGATTAATTCAGATGGTGTTGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053905258 9:42836444-42836466 GGATTAATTCAGATGGTGTTGGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054366987 9:64353451-64353473 GGATTAATTCAGATGGTGTTGGG + Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054529728 9:66169080-66169102 GGATTAATTCAGATGGTGTTGGG - Intergenic
1054674615 9:67843192-67843214 GGATTAATTCAGATGGTGTTGGG + Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1189270248 X:39746502-39746524 AGGTTATTCCATTTGGAGGTGGG - Intergenic
1189943312 X:46151216-46151238 AGTTTAATTTTGATGGAGTTTGG + Intergenic
1190927296 X:54921445-54921467 AGGTTCATACAGTTGGATTTGGG + Intronic
1196112047 X:111956750-111956772 GGGTTATTCTAGATGGACTTTGG - Intronic