ID: 1079226935

View in Genome Browser
Species Human (GRCh38)
Location 11:18614910-18614932
Sequence GAACTAACTGAACCACTGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079226933_1079226935 -9 Left 1079226933 11:18614896-18614918 CCAAGGGTCTTGCAGAACTAACT 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1079226935 11:18614910-18614932 GAACTAACTGAACCACTGATGGG 0: 1
1: 0
2: 0
3: 3
4: 118
1079226931_1079226935 4 Left 1079226931 11:18614883-18614905 CCACGAGAGCTGCCCAAGGGTCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1079226935 11:18614910-18614932 GAACTAACTGAACCACTGATGGG 0: 1
1: 0
2: 0
3: 3
4: 118
1079226927_1079226935 14 Left 1079226927 11:18614873-18614895 CCGGCCAGGGCCACGAGAGCTGC 0: 1
1: 0
2: 1
3: 18
4: 329
Right 1079226935 11:18614910-18614932 GAACTAACTGAACCACTGATGGG 0: 1
1: 0
2: 0
3: 3
4: 118
1079226932_1079226935 -8 Left 1079226932 11:18614895-18614917 CCCAAGGGTCTTGCAGAACTAAC 0: 1
1: 0
2: 1
3: 2
4: 99
Right 1079226935 11:18614910-18614932 GAACTAACTGAACCACTGATGGG 0: 1
1: 0
2: 0
3: 3
4: 118
1079226928_1079226935 10 Left 1079226928 11:18614877-18614899 CCAGGGCCACGAGAGCTGCCCAA 0: 1
1: 0
2: 2
3: 16
4: 176
Right 1079226935 11:18614910-18614932 GAACTAACTGAACCACTGATGGG 0: 1
1: 0
2: 0
3: 3
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079226935 Original CRISPR GAACTAACTGAACCACTGAT GGG Exonic