ID: 1079229241

View in Genome Browser
Species Human (GRCh38)
Location 11:18635096-18635118
Sequence CTCCAAAAGAAGTCAGGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079229241_1079229244 -2 Left 1079229241 11:18635096-18635118 CCTAGTCCTGACTTCTTTTGGAG No data
Right 1079229244 11:18635117-18635139 AGAGTTATCTTGGATCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079229241 Original CRISPR CTCCAAAAGAAGTCAGGACT AGG (reversed) Intergenic
No off target data available for this crispr