ID: 1079231842

View in Genome Browser
Species Human (GRCh38)
Location 11:18655850-18655872
Sequence TTTTGGATTTTTAGTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079231842_1079231845 18 Left 1079231842 11:18655850-18655872 CCATCTTCACTAAAAATCCAAAA No data
Right 1079231845 11:18655891-18655913 AGCTCTGACATGTGATCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079231842 Original CRISPR TTTTGGATTTTTAGTGAAGA TGG (reversed) Intergenic
No off target data available for this crispr