ID: 1079238954

View in Genome Browser
Species Human (GRCh38)
Location 11:18708995-18709017
Sequence CCAGGGAGCCTGCTTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079238954_1079238956 -8 Left 1079238954 11:18708995-18709017 CCAGTCAGAAGCAGGCTCCCTGG 0: 1
1: 0
2: 2
3: 25
4: 221
Right 1079238956 11:18709010-18709032 CTCCCTGGACTTTGAATTTTCGG 0: 1
1: 0
2: 0
3: 23
4: 269
1079238954_1079238957 -7 Left 1079238954 11:18708995-18709017 CCAGTCAGAAGCAGGCTCCCTGG 0: 1
1: 0
2: 2
3: 25
4: 221
Right 1079238957 11:18709011-18709033 TCCCTGGACTTTGAATTTTCGGG 0: 1
1: 0
2: 3
3: 15
4: 322
1079238954_1079238959 -6 Left 1079238954 11:18708995-18709017 CCAGTCAGAAGCAGGCTCCCTGG 0: 1
1: 0
2: 2
3: 25
4: 221
Right 1079238959 11:18709012-18709034 CCCTGGACTTTGAATTTTCGGGG 0: 1
1: 0
2: 1
3: 17
4: 179
1079238954_1079238962 6 Left 1079238954 11:18708995-18709017 CCAGTCAGAAGCAGGCTCCCTGG 0: 1
1: 0
2: 2
3: 25
4: 221
Right 1079238962 11:18709024-18709046 AATTTTCGGGGAATTGATTTGGG 0: 1
1: 0
2: 0
3: 19
4: 169
1079238954_1079238961 5 Left 1079238954 11:18708995-18709017 CCAGTCAGAAGCAGGCTCCCTGG 0: 1
1: 0
2: 2
3: 25
4: 221
Right 1079238961 11:18709023-18709045 GAATTTTCGGGGAATTGATTTGG 0: 1
1: 0
2: 0
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079238954 Original CRISPR CCAGGGAGCCTGCTTCTGAC TGG (reversed) Intronic
900577690 1:3391813-3391835 CTTGGGAGCCTGCCTCTGGCCGG - Intronic
900607181 1:3529096-3529118 CCAGGGAGCAAGCTTCTGCAGGG - Intronic
900713708 1:4130669-4130691 CCAGCGACCCTGGTTCTGAAGGG + Intergenic
900793988 1:4696569-4696591 CCAGGGAGACGGCTTATGCCCGG + Intronic
901878167 1:12178933-12178955 CCAAGGAGCCTGCAGCTGGCAGG + Intronic
903053665 1:20620146-20620168 TCGGGGAGCCTGCTGCTGTCTGG + Intergenic
903695197 1:25201227-25201249 CCAGAGAGCCTGTTCCCGACAGG - Intergenic
904480264 1:30788899-30788921 CCAGGGAGCCTGGTCATGAAGGG + Intergenic
904824228 1:33264246-33264268 ACAGGGACCATTCTTCTGACTGG - Intronic
905156715 1:35990158-35990180 CCAGGGATCTTGCTTCTTAAGGG - Intronic
907194592 1:52676310-52676332 CCAGTGACCCTGCTTCTGTGAGG - Intergenic
907571964 1:55491966-55491988 CCAGGAAGCCTCCCTCAGACTGG - Intergenic
907927468 1:58968033-58968055 CCAGGGAGCCTGCTGCATCCTGG - Intergenic
910162755 1:84291821-84291843 CAAGTCAGCCTGCTCCTGACAGG + Intergenic
911311540 1:96297925-96297947 CCAGGGTGCCTGCTTTTGTGTGG + Intergenic
912978227 1:114348646-114348668 CCTGGGAGCCTGCTGAAGACTGG - Intergenic
913405160 1:118482954-118482976 CCAGGGTGCCTGATTCTAAGGGG - Intergenic
919817254 1:201449231-201449253 CCAGCGAGCCTCCTTGGGACAGG - Intergenic
921803916 1:219432807-219432829 ATAGTGAGCCTGCTTCTCACTGG - Intergenic
922190608 1:223315497-223315519 CCAGGGAGTCTGCTTGTGGGTGG - Intronic
922745060 1:228038793-228038815 ACAGGGAGACTGCTCCTCACTGG + Intronic
924071477 1:240284811-240284833 CCAGGGACACAGCTTCTGGCTGG + Intronic
924121335 1:240801668-240801690 CAAGGGAGGCTTCTTCTCACAGG + Intronic
1063819745 10:9820255-9820277 CCATGGTGCCTGCTTCTGTGTGG - Intergenic
1065493734 10:26308252-26308274 CCAGGGAGTCTGCTTCTAGGTGG - Intergenic
1066003599 10:31127481-31127503 TAAGGGAGAATGCTTCTGACAGG - Intergenic
1067263456 10:44714945-44714967 CCAGGGACCCTGGGACTGACTGG - Intergenic
1067956620 10:50798032-50798054 CTAGGGAGTTTGCTTCTGAGTGG - Intronic
1075529715 10:123219025-123219047 TCAGGGAGCCATCTTCTCACAGG + Intergenic
1075568641 10:123522335-123522357 CCAGGGAGCATGCTTCTGCCAGG - Intergenic
1077330678 11:1982647-1982669 CCAGGGACCCAGCCTCTGCCGGG + Intronic
1077405455 11:2380546-2380568 CCAGGGAGCCCAGTTCTCACTGG - Intronic
1077779860 11:5315411-5315433 CCATGGGGCCTGCTTCTTGCAGG - Intronic
1077781160 11:5331066-5331088 CCATGGAGCCTGCTTCCTCCAGG - Intronic
1077782944 11:5351780-5351802 CCATGGAGCCTGCTTCTCTCAGG + Exonic
1078211920 11:9276672-9276694 CCAGGGGCCCTGCAGCTGACAGG + Intergenic
1079238954 11:18708995-18709017 CCAGGGAGCCTGCTTCTGACTGG - Intronic
1080885245 11:36362187-36362209 CAAGGGAGAATGCTTCTGATGGG + Intronic
1081603115 11:44509081-44509103 CCAGGGAGCTATGTTCTGACAGG - Intergenic
1084442190 11:69180938-69180960 CCAGGGAGCCTGCTGGTCTCAGG - Intergenic
1090763323 11:129855871-129855893 TCAGGGAACCTGGTTCTGGCAGG + Exonic
1202813656 11_KI270721v1_random:37826-37848 CCAGGGACCCAGCCTCTGCCGGG + Intergenic
1091453446 12:587707-587729 CCAGGGACCCTGCGCCTCACAGG + Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1092783951 12:12011289-12011311 CCAGGAAGCCTTCTTGTCACTGG - Intergenic
1095970695 12:47900221-47900243 AGAGGGAGCCTCCTTCTGAGAGG + Intronic
1102484025 12:113244060-113244082 CCAGGGAGCCTGGAACTGGCAGG - Intronic
1103969929 12:124664102-124664124 CCCGGGAGCCTGGTTCAGACAGG + Intergenic
1107729165 13:43331083-43331105 CCAGGGAGCTTGCTTCAGTGTGG - Intronic
1108479431 13:50853566-50853588 CCAAGGAGTTTGCTTCTGAATGG - Intergenic
1112523876 13:100124423-100124445 CCAGGCAGCCTGCTGTTGAAAGG + Intronic
1113486625 13:110657485-110657507 CCAGGGAGGGCTCTTCTGACTGG - Intronic
1113925009 13:113936699-113936721 CAAGGGCGCTTGCTGCTGACTGG + Intergenic
1114259459 14:21026192-21026214 CCAGGGAGCCTTCCTCCGAGGGG - Intronic
1115092364 14:29593452-29593474 CCCAGGAGCCTGGCTCTGACTGG - Intronic
1120857848 14:89228038-89228060 CCAGGGAGACTGTTACTCACTGG + Intronic
1121010415 14:90517083-90517105 CCAGGGAGCCAACTTCTGCCTGG - Intergenic
1122721590 14:103725403-103725425 CCACAGAGCCTGCTTCTGAGGGG - Intronic
1124503917 15:30255463-30255485 CCAGGCAACCTGCCTCTGAGGGG + Intergenic
1124739637 15:32283177-32283199 CCAGGCAACCTGCCTCTGAGGGG - Intergenic
1128872057 15:71166556-71166578 CCAGGGAAACTTCTTCTCACGGG - Intronic
1129140976 15:73597624-73597646 CCAGTGGGCTTGCTTCTGCCTGG - Intronic
1129977512 15:79834505-79834527 CCAGGGTGTCTGATTCTGCCAGG - Intronic
1130017459 15:80198714-80198736 CCGGGGAGCTTGCTTAAGACAGG - Intergenic
1131541778 15:93280594-93280616 CCAGAGTGCCTGCCTCTGCCTGG + Intergenic
1133062558 16:3184050-3184072 GGAGGGAGCCTGCTGCTGGCAGG - Intergenic
1133134974 16:3704615-3704637 CGAGGGAGCCTCCTCCTGCCTGG - Intronic
1133148653 16:3809508-3809530 GCAGGGAGCCAGCACCTGACAGG + Intronic
1133230937 16:4366212-4366234 CCTGGGAGCATGCTGCTGGCAGG - Intronic
1133772762 16:8877173-8877195 CCAGGAAGCATCCTTCTGCCAGG + Intergenic
1134103737 16:11470808-11470830 CCAGGAAGGCTGCCTCTGAGGGG + Intronic
1134386805 16:13780976-13780998 CCAGTGAGCTTGCTTCTCTCCGG + Intergenic
1135663839 16:24318858-24318880 CCAGGGAGCCTCCTACTGGTGGG - Intronic
1137419050 16:48315420-48315442 TCAAGGTGCCAGCTTCTGACAGG + Intronic
1138094772 16:54203009-54203031 CCAGGGAGCCTCCATTTGAGAGG - Intergenic
1138401533 16:56748923-56748945 CCCGGGAGGCTGCTTCTGAAAGG + Intronic
1139741276 16:69037185-69037207 CCAGGCAGGATGCTTCTGCCTGG + Intronic
1141203420 16:81914395-81914417 CCAGGTGGCATGATTCTGACAGG + Intronic
1141824916 16:86472148-86472170 CCAGGGGGCCATGTTCTGACTGG - Intergenic
1141947380 16:87319931-87319953 CCAGGAACCCTGCTTCTGTCTGG - Intronic
1142225015 16:88872978-88873000 CCAGGAAGCCTTCCTCTGAGAGG - Intergenic
1143508671 17:7383625-7383647 CCAGGGAGCCCGCTTCATCCAGG + Intronic
1145903384 17:28502154-28502176 ACAGTGAGACTGCTTCTGGCGGG - Intronic
1146533923 17:33633482-33633504 ACAGGGAGCCTGTTTCTGCTGGG + Intronic
1146671232 17:34739440-34739462 CCAGGCAGTCTGCTTCAGGCTGG + Intergenic
1146671436 17:34740809-34740831 CCAGAGAGCATGCTTCTGCATGG - Intergenic
1148049676 17:44763549-44763571 CCAGGGAGCCTGCAGCCGAGGGG + Intronic
1148874357 17:50677941-50677963 CGAGGGAGGCGGCTTCTGACCGG - Exonic
1149116988 17:53109367-53109389 CCAGGGAGCCTCCTTCATCCAGG + Intergenic
1150389091 17:64780625-64780647 CCAGGAAGGCTGCGTCTGAAGGG + Intergenic
1151195827 17:72430632-72430654 CCAGGGAGCCTGACTCTGTCCGG + Intergenic
1151383387 17:73740782-73740804 CCAGGGAGCCTGCAACTGCATGG + Intergenic
1151485268 17:74395035-74395057 CCAGGAAGCCTGGGTTTGACAGG + Intergenic
1151494043 17:74449022-74449044 CCGGGGAGCCTGCTCCTCCCAGG + Intronic
1152330161 17:79668094-79668116 CCAGTGCCCCTGCTTCTGAAAGG + Intergenic
1152363020 17:79841070-79841092 CCACGGAGGCTGCTGCTGCCCGG + Intergenic
1152791741 17:82283767-82283789 CCAGGGAACATGCTTGGGACTGG - Intergenic
1154323847 18:13375775-13375797 CCAGGGAGCCTGCACCTGGTGGG + Intronic
1156916924 18:42472640-42472662 CCAGGTGGCCTGCTTGTGTCAGG + Intergenic
1157295193 18:46437345-46437367 CTAGAGAGGCTGCTTCTGCCAGG + Intronic
1158404683 18:57150927-57150949 CCAGGGGGCGTGCCTGTGACAGG - Intergenic
1159375871 18:67592212-67592234 ACAAGGAGCCTGGCTCTGACTGG - Intergenic
1161130469 19:2585561-2585583 CCAGGCTGCCTGTTTCTAACTGG - Intronic
1161221797 19:3121230-3121252 CCACGGAGCCTGCGGCTGCCGGG + Exonic
1162014904 19:7840107-7840129 ACAAGGGGCCTGCTTCTGTCAGG + Intronic
1162805872 19:13137772-13137794 CCAGGGAGCCTGTGTCAGGCAGG + Intronic
1164462431 19:28460579-28460601 TCAGAGAGCCTGCTTAGGACTGG - Intergenic
1164593948 19:29521451-29521473 CCGGGGGGCTTGCTTCTGCCAGG - Intergenic
1165013392 19:32864393-32864415 CCAGGGAGCCTTCCTCCCACCGG + Intronic
1167255016 19:48422106-48422128 CCAAGGAGCCTGCTCCTGGGAGG - Intronic
1167282227 19:48576211-48576233 CCTGGGAGGCTACTTCTGGCAGG - Intronic
1168502796 19:56907820-56907842 CCAGAGAGCCTGCCTCTTCCAGG + Intergenic
1168722355 19:58561156-58561178 CCAGTGAGCCTGGTTCTGGGAGG - Intergenic
925289606 2:2738605-2738627 ACAGGGAGGCTGCTTCTCAAAGG + Intergenic
925731333 2:6921309-6921331 CCAAGGAGCTTGCTTTTGTCTGG - Intronic
926202957 2:10814336-10814358 CCAGGGAGGCTGCTTGTCCCGGG + Intronic
926314522 2:11699557-11699579 CCAGAGAGGCTGCATCTAACAGG - Intronic
927860572 2:26557824-26557846 CCAAGGAGCCTGCATCTGTTGGG - Intronic
928260482 2:29762277-29762299 ACAATGGGCCTGCTTCTGACAGG - Intronic
928706931 2:33959989-33960011 ACAGGCAGCCTGCTTATGACTGG + Intergenic
928854490 2:35788336-35788358 CCAGGCAGCCTACTTGTGCCTGG - Intergenic
929414860 2:41737019-41737041 CCAGGGAGCCTCTTTCTGTCAGG - Intergenic
930113291 2:47697222-47697244 CCAGGGAGCCTATTTCTGGGTGG - Intronic
930773017 2:55146597-55146619 CCAGCTAGCATGCTTCTAACAGG - Intergenic
931392320 2:61854601-61854623 ACTGGGAGCCTCCTTCTGATTGG - Intergenic
931889985 2:66661416-66661438 CCAGGGTGCCTGCCTCTGTGCGG + Intergenic
932345189 2:70990804-70990826 CAGGGGAGCCTGCTGCTGAGGGG + Intronic
935824638 2:106932832-106932854 CCAGGGAGCCCTCTTGTGGCAGG - Intergenic
938685652 2:133735112-133735134 CCAGGGAAGCTGCCTCTGAGAGG + Intergenic
940293564 2:152099654-152099676 CCAGCCAGCCTGAGTCTGACGGG + Intergenic
941219150 2:162753437-162753459 CCAGGGAGCAGGCATCTGAATGG - Intronic
942488934 2:176470264-176470286 CCAGAGAAGCTGCTTCTGCCAGG - Intergenic
943073776 2:183171742-183171764 CCAGGGGTCCTGCTTATGCCTGG - Intergenic
947217926 2:227766535-227766557 CCAGGGAGCCGGCTCCTGGCTGG - Intergenic
947445638 2:230160711-230160733 CCAGGGTGCCTGCTGCTCTCAGG + Intergenic
947945461 2:234097992-234098014 CCAAGGTGCCTGCCTGTGACTGG + Intergenic
948363991 2:237442812-237442834 CAAGGGAGCCTGCAGCTCACAGG - Intergenic
948647153 2:239412570-239412592 CCAAGCAGTCTGCTTCTGCCTGG + Intergenic
948778126 2:240300544-240300566 CCAGGGAGCCTTTGACTGACAGG + Intergenic
948883526 2:240871960-240871982 CCAGGGAGGGTCCTTCTGACAGG + Intronic
1169017986 20:2307254-2307276 CCAGGGAGCCTGCATTTTACTGG + Intronic
1169358264 20:4925847-4925869 CCTGGGAACCTTCATCTGACCGG + Intronic
1170495792 20:16923861-16923883 TCATGGATCCTGCTTCTGAGAGG - Intergenic
1172224499 20:33296251-33296273 CAGGGGAGCCTGTTTCTCACCGG - Intronic
1172276719 20:33684143-33684165 CCAATGAGCCTGCCCCTGACAGG + Intronic
1174146002 20:48453108-48453130 CCAGGAAGCCTGGTGCTGATGGG + Intergenic
1175163239 20:57024202-57024224 CCAGAGATCCTGCTTCTGATTGG - Intergenic
1175182215 20:57156640-57156662 CCAGGGACCCATCTTCTGAGGGG + Intergenic
1175662096 20:60822333-60822355 CCAGGGTGCCTTCTACTAACTGG - Intergenic
1175722107 20:61293809-61293831 CCAGAGTGCCTGCTTCTTCCTGG + Intronic
1175759905 20:61555215-61555237 CCAGGCAGCCTCCTTGTGAGTGG + Intronic
1176263784 20:64197942-64197964 CCAGGTTGCCTGTTTCTCACGGG + Intronic
1176293809 21:5059969-5059991 CCAGGGAGTCTGCTTCTGGGTGG - Intergenic
1177207028 21:18022054-18022076 CCAGAGAGCTTGCTTCTCTCAGG + Intronic
1178500748 21:33123861-33123883 CCAGGGACCCTGGTTCTGGTTGG - Intergenic
1179863450 21:44203679-44203701 CCAGGGAGTCTGCTTCTGGGTGG + Intergenic
1181863831 22:25840016-25840038 CCAGGGGGACAGCTTCAGACAGG - Intronic
1182454190 22:30439349-30439371 CAATGGGGCCTGCTGCTGACTGG + Intergenic
1182517437 22:30867070-30867092 CATGGGAGCCTGCCTATGACGGG + Intronic
1183050081 22:35253793-35253815 CCAGAGGGCCTGCTTCTCTCTGG + Intergenic
1183474368 22:38027715-38027737 ACAGGGAGCCGGCTGCTCACAGG - Intronic
1183513209 22:38247966-38247988 TCAGGGAGCCTCCTGCTGCCAGG - Exonic
1183597875 22:38823128-38823150 CCAGGCAGCCAGGTTCTCACCGG + Exonic
1184233262 22:43169623-43169645 GCAGGCAGCCTGCTACTGCCTGG + Intronic
1184257148 22:43293866-43293888 CCAGGGAGCTTCCTCGTGACAGG - Intronic
1185146042 22:49137239-49137261 CCAGGGAGCCTGCTGAGGGCTGG - Intergenic
951452704 3:22856951-22856973 CCTGGGAGACTGCTTCTGCTGGG + Intergenic
953018736 3:39100617-39100639 CCAGGGATCCTGAGGCTGACCGG - Intronic
953885870 3:46714096-46714118 CCAGGGAGCCTGCCGCTCCCGGG - Intronic
954122485 3:48507663-48507685 CCAGGGAGGCTACATCTGATTGG - Intergenic
954304979 3:49720873-49720895 CCAGGGAGGCAGCTGCTGCCTGG - Exonic
954434978 3:50491142-50491164 GCAAGGAGGCTGCTTCTGATGGG - Intronic
956779609 3:72593689-72593711 CCAGGGAGCTTGCTTTGGCCAGG - Intergenic
958510470 3:95040276-95040298 CCTGGGAGGCAGCATCTGACTGG + Intergenic
959811786 3:110628319-110628341 CCAGGGAGTCTGCTTCTATATGG - Intergenic
960936579 3:122907894-122907916 CCAGGGTGCCTGCTTCAGAAGGG - Intergenic
966424531 3:179766893-179766915 CCAGGTGGCCTGGATCTGACTGG - Intronic
967920288 3:194609331-194609353 GCAGGGAGCCTGCCTGGGACAGG + Intronic
968526650 4:1061451-1061473 CCAGGGAAGCTGCCTCTGTCTGG - Intronic
968657722 4:1785847-1785869 CCCGGGCGCCTGCCTCTGCCTGG + Intergenic
968802517 4:2752549-2752571 CCAGGGTTCCTGCTCCTAACGGG + Intronic
973583735 4:52370831-52370853 CCAGGGAGCCTCCTTCTAACTGG - Intergenic
975845011 4:78515791-78515813 CCAGGAACCCTGCCTCTGCCAGG - Intronic
978936971 4:114389385-114389407 CCACGGAGCCAGCTGCTGAGAGG - Intergenic
980146192 4:128986946-128986968 ACAGAGAGACTCCTTCTGACTGG + Intronic
981673210 4:147311319-147311341 CCAGGCCCCTTGCTTCTGACTGG + Intergenic
982679491 4:158411571-158411593 CCAGGGAGACTGTTTTTGGCAGG + Intronic
984253261 4:177359930-177359952 CCAGGCAGCCTGTTTCTTGCAGG + Intronic
985709393 5:1419856-1419878 CCAGGGAGGCAGCAGCTGACAGG - Intronic
986735020 5:10662100-10662122 CCACGGAGCCTGCCTCTCCCAGG - Intergenic
987402467 5:17492046-17492068 GCAGGCAGTCTGTTTCTGACTGG + Intergenic
987403605 5:17502651-17502673 CCAGGCAGCCTGGCTCTGGCTGG + Intergenic
988526665 5:31993121-31993143 CCAGGGAGGATGTTTCTGAATGG + Intronic
992162521 5:74016757-74016779 CCAGGAAGCTTTCTTCTGCCTGG + Intergenic
993498834 5:88640325-88640347 CCAGCCACCCTGGTTCTGACTGG + Intergenic
994858218 5:105153347-105153369 CCAGGGAGGCTGTTTCTTATGGG + Intergenic
997442336 5:133917595-133917617 CCAGGGACTCTGCTGCTGCCAGG + Intergenic
1001055573 5:168446991-168447013 TCTGGGATCCTGTTTCTGACCGG + Intronic
1001432442 5:171673589-171673611 GCAGGGAGCCTGCAGCTCACAGG + Intergenic
1002796540 6:475443-475465 TCAGCGAGCATGCTTTTGACAGG + Intergenic
1002865195 6:1115634-1115656 CCAGGGATCCCACTTCTGAAGGG - Intergenic
1003925645 6:10875161-10875183 CCAGGTAGGATGCTTCTGAGTGG + Intronic
1005001925 6:21250058-21250080 CCAGGGACCATCCTTATGACAGG + Intergenic
1006509819 6:34515738-34515760 CCAGGGAGCAGGCCTCTGATGGG + Intronic
1006793447 6:36717963-36717985 TCTGGGAGCCTGCTGCTGGCAGG - Intronic
1007214220 6:40223975-40223997 CCTGGGAGCCTTCCTCTAACAGG - Intergenic
1008040384 6:46791353-46791375 ACTGGGGGCCTGCTTCTGATGGG - Intergenic
1011755754 6:90496871-90496893 CCAGGAAGACTGCTGCTGTCAGG + Intergenic
1012931441 6:105321684-105321706 CCAGGGAGGCCGCTTCTTCCAGG - Intronic
1013393866 6:109714148-109714170 TCAGGGAGTCTCCTTCTGTCAGG + Intronic
1013590952 6:111619294-111619316 CAGGGGAGCCTGCTTCCGACTGG + Intergenic
1017671363 6:156772271-156772293 CCAAGGAGCCTGATGCAGACTGG - Intergenic
1018810585 6:167295239-167295261 CCAGGGACCCTGGTTGTGCCAGG + Intronic
1019541997 7:1555762-1555784 GCAGGGAGCCTGCTTCTTAGGGG + Intronic
1020079006 7:5276545-5276567 CCAGGGAGCCAGCTGGTGAGTGG - Intronic
1023555131 7:41414203-41414225 CCAGGTACCCTGATTCTAACTGG + Intergenic
1025199890 7:56955633-56955655 CCAGGGAGCCAGCTGGTGAGTGG + Intergenic
1025672056 7:63621299-63621321 CCAGGGAGCCAGCTGGTGAGTGG - Intergenic
1026274883 7:68867847-68867869 CCAGGGAGTCTACTTCTGGGTGG + Intergenic
1027262058 7:76471773-76471795 CCAGGGCTCCACCTTCTGACTGG + Intronic
1027313440 7:76969868-76969890 CCAGGGCTCCACCTTCTGACTGG + Intergenic
1028504110 7:91552751-91552773 ACAGGGAACCTGCCTCTGAATGG - Intergenic
1029421310 7:100473055-100473077 CCAGGCTGCCTGCTTCTCCCCGG - Intronic
1032163295 7:129526807-129526829 CCAGGGACGCTGCTTCAAACTGG - Intergenic
1035614119 8:989798-989820 CCAGGGTCCCTGCTAATGACTGG + Intergenic
1035710295 8:1708618-1708640 CCAGTGAGCCTGCAACTGCCAGG + Intergenic
1035722278 8:1801211-1801233 CCAGGGAGTCCGCTTCTGAGTGG - Intergenic
1037319574 8:17630566-17630588 CCATGGAGCCTGCATGTGACAGG - Intronic
1038575698 8:28701784-28701806 CCGGGGAGGCTGCTGCTGCCCGG + Intronic
1038869611 8:31479952-31479974 CCAGGGAGTCCGCTTCTGGGTGG - Intergenic
1039768534 8:40658790-40658812 CCAGCCAGCTTGCTGCTGACTGG + Intronic
1040522560 8:48191023-48191045 CCAGGCTGCCTGCTTCTGTCAGG + Intergenic
1044537979 8:93379405-93379427 CCAGAGTGCCTACTCCTGACAGG + Intergenic
1044698267 8:94944414-94944436 CCAGGAAGGCAGCTTCTGCCTGG + Intronic
1046895198 8:119464091-119464113 CCAGGGTGCCTGCCTCTGTGTGG - Intergenic
1047521998 8:125602100-125602122 CCAGGAGGCCTGCTGCTGAAGGG + Intergenic
1048254621 8:132896407-132896429 CCATGAAGCCTGTTTCTGAAAGG + Intronic
1049672313 8:143875386-143875408 CCAGGCATCCTGCTGCTGACAGG + Intronic
1061263960 9:129495154-129495176 CCAGGGAGGCGGCTTCTCTCTGG - Intergenic
1061651615 9:132054899-132054921 AAAGGGTGACTGCTTCTGACAGG - Intronic
1061732337 9:132625407-132625429 CTGGGGAGCCTGCTGCTGTCTGG + Intronic
1062183163 9:135202088-135202110 CCAGGGAGCCTGCTGATGCCTGG + Intergenic
1190290290 X:48988016-48988038 CCAGGGATCCTGCTTCCCCCAGG - Intronic
1190874982 X:54453361-54453383 GCAGATGGCCTGCTTCTGACAGG - Intronic
1193250853 X:79289159-79289181 CCAGGGTGCCTGCCTCTGTGCGG - Intergenic
1199851642 X:151728102-151728124 CCAGGGACCCAGCTACTGGCAGG - Intergenic
1200954673 Y:8931212-8931234 CCAGCGAGTCTGCTGCTGGCTGG + Intergenic
1201787474 Y:17801507-17801529 GCAGGCAGCCTGCTTCAGCCCGG + Intergenic
1201814079 Y:18104481-18104503 GCAGGCAGCCTGCTTCAGCCCGG - Intergenic