ID: 1079239450

View in Genome Browser
Species Human (GRCh38)
Location 11:18712310-18712332
Sequence TTGTGTGCACATGAAGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 196}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079239450_1079239459 24 Left 1079239450 11:18712310-18712332 CCTTCCACTTCATGTGCACACAA 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1079239459 11:18712357-18712379 ACCCGGCCCTGTGGAGGCTTTGG 0: 1
1: 0
2: 0
3: 21
4: 265
1079239450_1079239462 28 Left 1079239450 11:18712310-18712332 CCTTCCACTTCATGTGCACACAA 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1079239462 11:18712361-18712383 GGCCCTGTGGAGGCTTTGGACGG 0: 1
1: 0
2: 2
3: 33
4: 295
1079239450_1079239456 15 Left 1079239450 11:18712310-18712332 CCTTCCACTTCATGTGCACACAA 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1079239456 11:18712348-18712370 AGGAACTCCACCCGGCCCTGTGG 0: 1
1: 0
2: 1
3: 22
4: 213
1079239450_1079239457 18 Left 1079239450 11:18712310-18712332 CCTTCCACTTCATGTGCACACAA 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1079239457 11:18712351-18712373 AACTCCACCCGGCCCTGTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 120
1079239450_1079239452 -5 Left 1079239450 11:18712310-18712332 CCTTCCACTTCATGTGCACACAA 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1079239452 11:18712328-18712350 CACAACTACCTGAGAGCTCCAGG 0: 1
1: 0
2: 2
3: 15
4: 115
1079239450_1079239454 7 Left 1079239450 11:18712310-18712332 CCTTCCACTTCATGTGCACACAA 0: 1
1: 0
2: 0
3: 11
4: 196
Right 1079239454 11:18712340-18712362 AGAGCTCCAGGAACTCCACCCGG 0: 1
1: 0
2: 1
3: 33
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079239450 Original CRISPR TTGTGTGCACATGAAGTGGA AGG (reversed) Exonic
900894556 1:5474152-5474174 TTGTGTCCTCATGTGGTGGAAGG - Intergenic
901916796 1:12506343-12506365 TTTTCTGAACATGAAGTGGATGG + Intronic
903523688 1:23975638-23975660 TTGTCTTCCCATGCAGTGGAAGG - Intronic
906425077 1:45704952-45704974 TTATGTGCAAATTAAGTGGTGGG - Intronic
906976633 1:50581435-50581457 TAGTGTGTACATGGAGTAGAGGG - Intronic
908116258 1:60943350-60943372 GTGTATGCAGATGAAGAGGAAGG + Intronic
911269617 1:95784838-95784860 TTTTTTGCACATGCAGTGAATGG + Intergenic
913124965 1:115778201-115778223 TTGTGTCCTCATGCAGTGGCAGG + Intergenic
914463846 1:147908931-147908953 GTGGGGGCACAAGAAGTGGAGGG + Exonic
916482340 1:165225850-165225872 TTGTGTGCACCTGCAGGGGTGGG - Intronic
916501438 1:165390769-165390791 TTGTGTCCTCATGTGGTGGAAGG + Intergenic
916851145 1:168705348-168705370 TCATGTGCACATCAATTGGAGGG - Intronic
917225771 1:172780568-172780590 ATGTCTGCAAATGAAGTGGATGG + Intergenic
920212531 1:204338776-204338798 TTCTGTGGAAATGAAGGGGATGG + Intronic
920303895 1:205006652-205006674 TTGTATCCACAGGAAGTGGCAGG + Intronic
924450581 1:244175258-244175280 TTGGGAGCACATAAAGGGGATGG - Intergenic
924591645 1:245409795-245409817 TTGTGTCCACATGAACTGCGAGG + Intronic
1063563969 10:7155842-7155864 TTGAGTGCACAGCAGGTGGAAGG - Intergenic
1069306707 10:66979980-66980002 TTGTGTTCAAAAGAAGAGGAAGG + Intronic
1069795031 10:71046498-71046520 TTTTGTGCACATAACGAGGAGGG - Intergenic
1073771059 10:106736408-106736430 CTGTGGGAACATGAAGAGGAAGG - Intronic
1076212025 10:128656704-128656726 GTCTGAGCACATGCAGTGGAAGG - Intergenic
1078012550 11:7584027-7584049 TTGTATGCACATGAATGGCAGGG - Intronic
1078266957 11:9762201-9762223 TTGTGTGAACATGGGGAGGATGG + Intergenic
1078593057 11:12662436-12662458 TTGGGAGTACATGAACTGGAGGG + Intergenic
1079239450 11:18712310-18712332 TTGTGTGCACATGAAGTGGAAGG - Exonic
1081167279 11:39821662-39821684 ATGTGTGCATCTTAAGTGGAGGG - Intergenic
1088326330 11:108604955-108604977 TTGGGTGGAGATGAATTGGATGG + Intergenic
1090463193 11:126910220-126910242 TTGAGTGCTCAAGCAGTGGAAGG + Intronic
1091855651 12:3737283-3737305 TTGTGTGTTCAAGAAATGGAAGG + Intronic
1092156779 12:6287683-6287705 TGGTGTGCACCTGAGGTGGGAGG + Intergenic
1095299378 12:40564851-40564873 TTGTGTGCACATCAAGTTTTGGG + Intronic
1098230788 12:68370187-68370209 TTGTTTGCACTTGAAATGGTCGG + Intergenic
1100295694 12:93258825-93258847 TTGTGTATGCATGAAGAGGAAGG - Intergenic
1100609096 12:96176192-96176214 TTGTGGGCACATGAGATGGGGGG + Intergenic
1101557368 12:105822931-105822953 TTGTGTACTCATGAGCTGGAGGG + Intergenic
1102115579 12:110400695-110400717 TCCTGTCAACATGAAGTGGATGG + Intronic
1104434288 12:128743424-128743446 TTATGTGCAAATTAAGGGGAGGG - Intergenic
1106248071 13:27965438-27965460 TTGTGGGCACATGTTGTAGAGGG + Intronic
1107342605 13:39424505-39424527 TTGTGTGAATGTGAAGTAGAAGG + Intronic
1109976694 13:69844830-69844852 TTTTGTACATATGAAGTGAAGGG - Intronic
1110896764 13:80762554-80762576 TTATGTGGCCATGAAGTAGATGG - Intergenic
1113587625 13:111476124-111476146 TTGTGTGAACATGAACTGACTGG + Intergenic
1113664582 13:112132309-112132331 TTGTGGAAGCATGAAGTGGAGGG + Intergenic
1116178756 14:41508864-41508886 TTGTGATGATATGAAGTGGAAGG + Intergenic
1117364994 14:55017921-55017943 TTGTGTGCAGCTGAGGTGGGAGG - Intronic
1118085778 14:62414906-62414928 TTCTGTGTACATGGATTGGAAGG + Intergenic
1121002876 14:90464775-90464797 TTGTGTGCACATCAAGGAGGTGG - Intergenic
1121729903 14:96179271-96179293 CTGGGTGAACATGAAGTTGAGGG - Intergenic
1124017508 15:25889819-25889841 TTATGTGCCCATTAAGTGGGAGG - Intergenic
1124439770 15:29677604-29677626 TTGGGTGTACATGAAGGGGTGGG + Intergenic
1125174844 15:36808879-36808901 GTGAGTGCACATGAAGAGAAAGG - Exonic
1128445167 15:67752719-67752741 TTTTGTGTTCATGAAGTGGGAGG + Intronic
1128773739 15:70302990-70303012 ATGGGTGAATATGAAGTGGATGG + Intergenic
1128773763 15:70303137-70303159 ATGGGTGGATATGAAGTGGATGG + Intergenic
1128773801 15:70303390-70303412 ATGGGTGGATATGAAGTGGATGG + Intergenic
1128773817 15:70303502-70303524 GTGGGTGGATATGAAGTGGAGGG + Intergenic
1128773841 15:70303642-70303664 ATGGGTGGATATGAAGTGGATGG + Intergenic
1129526300 15:76217484-76217506 TTGTGTGCTAATGCAGTGGCCGG + Intronic
1133295788 16:4751621-4751643 CTGGGTGCACATGAATTTGAGGG - Exonic
1133479840 16:6159515-6159537 CTGTGTGCACTGGAACTGGATGG - Intronic
1137857429 16:51808872-51808894 CTCTGTGCACATGAAGAGGGAGG + Intergenic
1138196485 16:55056028-55056050 TGGTGGGCATATGAAGTGCATGG - Intergenic
1139011038 16:62634321-62634343 ATGTGTGTACTTGAAGAGGAGGG - Intergenic
1139519719 16:67474040-67474062 TTGAGTGCACAGTAAGTGCAGGG - Intronic
1139674744 16:68515735-68515757 TTGTGTCCTCATGTGGTGGAAGG + Intergenic
1141075632 16:81004546-81004568 TTGTGTGCATACACAGTGGATGG - Intronic
1143302550 17:5921746-5921768 CTGTGTGCGCATTAAATGGATGG + Intronic
1143533883 17:7524083-7524105 TGGTTTGCACAAGGAGTGGAAGG + Intergenic
1150216271 17:63472154-63472176 CTGTGAGCAAATGAGGTGGAGGG - Intergenic
1150346897 17:64411486-64411508 GAGTGGGCACATGCAGTGGATGG + Intronic
1151125325 17:71838525-71838547 TTGTGTTTACATGGAGAGGATGG - Intergenic
1153981107 18:10311404-10311426 GTTTGTGCACATGTAGAGGATGG - Intergenic
1154950699 18:21206713-21206735 TTGTGGGAACATGTAGGGGAGGG - Intergenic
1155409581 18:25528237-25528259 TTGTGTGCACTTGAAAAGAAAGG - Intergenic
1157492394 18:48133264-48133286 ATGGGTGCGGATGAAGTGGAAGG + Intronic
1157792144 18:50542196-50542218 CTGTGTGCTCATGCAGGGGAGGG - Intergenic
1157819477 18:50754933-50754955 TTGTGGTAACATGCAGTGGAGGG - Intergenic
1158193983 18:54863897-54863919 TTGTTTACACATTCAGTGGATGG + Intronic
1160419031 18:78731687-78731709 TTGTGTGCAGCTGGGGTGGAGGG - Intergenic
1161380583 19:3963138-3963160 TTGTGTGCACATGTAGTCCCAGG + Intronic
1161666188 19:5578405-5578427 TAGTGGGCACATGGAGTAGAGGG + Intergenic
1162235229 19:9303717-9303739 TTGTGTGCTCATGAGATGGTTGG - Intronic
1164449173 19:28345167-28345189 GTGTAAGCACAGGAAGTGGAAGG + Intergenic
1164800462 19:31071779-31071801 TTTTGTGCGCGTGAAGTGGGTGG - Intergenic
1165404582 19:35621925-35621947 TTCTGTGCACATGGAGAGGTAGG + Intronic
926983159 2:18593100-18593122 TGTTGTTCACATGAAGTCGATGG - Intergenic
927461140 2:23299207-23299229 TTGTGTGCAGATGAAGTTCAAGG + Intergenic
928162817 2:28944297-28944319 TTGTGTTAACATGTAATGGATGG + Intronic
928697024 2:33859648-33859670 ATGTCTGCTCATTAAGTGGAAGG - Intergenic
931138657 2:59433012-59433034 TTGTGCACACATGCAGTGGGGGG + Intergenic
931287339 2:60843611-60843633 GTGTGCGCACATGCACTGGAAGG - Intergenic
933383275 2:81578347-81578369 GTTTGTGGAGATGAAGTGGAAGG + Intergenic
933385023 2:81599272-81599294 TTGTGTGTACATGGTGTGTATGG + Intergenic
935070075 2:99686360-99686382 GAGTGTGCACCTGAAGTGGTAGG - Intronic
937261809 2:120591402-120591424 TTGTGTACAGATGAAGAGGCTGG - Intergenic
937710478 2:124975155-124975177 TTGTGTGGAAATGAGGTAGAAGG - Intergenic
938400328 2:130986100-130986122 TTGTGTGTGCATGTAGTGCATGG + Intronic
938406387 2:131035362-131035384 TAGTGAGCACATGGGGTGGAAGG - Intronic
938893016 2:135724170-135724192 TTCTGTGCAGCTGAAATGGAGGG - Exonic
943610313 2:190025359-190025381 TTGTGCACACATGATGTGGGGGG - Intronic
943922994 2:193733918-193733940 ATGTTTTCACATGAAGGGGAGGG + Intergenic
945342270 2:208670689-208670711 TTGTGTTCACAAGAGGTGGTGGG - Intronic
946799418 2:223395160-223395182 TTATGTGCACATGAGTTGAAAGG - Intergenic
948668369 2:239550677-239550699 TTGTGTCCTCATATAGTGGAAGG + Intergenic
1169140575 20:3225289-3225311 TTGTGTGCTAATGAGGTGGCTGG + Intergenic
1169618131 20:7472827-7472849 TTATGTGCAGATTAAGTGAAAGG - Intergenic
1173173667 20:40747780-40747802 TTGTGTTCATATGAAATGGTGGG - Intergenic
1177832949 21:26159524-26159546 CTGTGTGCAGATGAGGGGGAAGG - Intronic
1178233902 21:30820238-30820260 TTGTGTGCACATAAAGTTTCAGG - Intergenic
1179039030 21:37785245-37785267 TTTTGTGCCCAAGAAGTGGGAGG + Intronic
950135508 3:10577892-10577914 TTTTCTGCACAGGAAGTGGATGG - Intronic
950569528 3:13791540-13791562 TAATGTGCACTTGCAGTGGATGG + Intergenic
951227942 3:20142780-20142802 TTGTGGGCACATGAACAGGTAGG + Intronic
952193538 3:31048431-31048453 TGGTGTGTGCATGGAGTGGAAGG + Intergenic
952799577 3:37276106-37276128 TTCTGTGCAGTTGAAGTGTAGGG + Intronic
953381138 3:42473665-42473687 TTGCGTGCATGTGAAGTGGCTGG + Intergenic
957861113 3:85951714-85951736 AAGTGTGCACATGAAGAGCAAGG - Intronic
959675660 3:109032418-109032440 TTGTATGAAAATGAACTGGAAGG + Intronic
959689218 3:109180458-109180480 TTGAATGCAGATGAAGAGGATGG - Intergenic
959709366 3:109369794-109369816 ATGTGTGCACATGTATTGGAGGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964817613 3:160733205-160733227 TTGTGTCCACATGTGCTGGATGG - Intergenic
964833144 3:160908621-160908643 GTGTGTTCATATTAAGTGGAAGG - Intronic
965143421 3:164867711-164867733 GTGTGTACACATTAAGTGTAGGG + Intergenic
965703599 3:171483568-171483590 AGGTGTGCACAGGAAGTGTATGG - Intergenic
966353794 3:179058181-179058203 CTGTGTGGACATGACGTGAACGG + Intronic
968115423 3:196085661-196085683 ATGTGGGCTCATGAAGAGGAAGG + Intergenic
968859666 4:3156704-3156726 TGGTGTGCTCATGAAGTTGTTGG + Intronic
969030187 4:4205645-4205667 CTGTGTGCCCATGATGTGGGAGG - Intronic
969244110 4:5921442-5921464 TTATGTGCACATATAGGGGAAGG + Intronic
971146038 4:23977273-23977295 TTTAGTGCACATGCAGAGGAAGG - Intergenic
971970581 4:33614136-33614158 TTGTGTACATATTAAGAGGAAGG + Intergenic
973560100 4:52126828-52126850 TTGTGTGTATATGATGTGGGGGG + Intergenic
976459954 4:85298889-85298911 ATGTGTCCTCATGTAGTGGAAGG - Intergenic
978740507 4:112132496-112132518 TTGTGTCCTCATGGGGTGGAAGG + Intergenic
983167925 4:164499685-164499707 TTGTGTGGAAATGAGCTGGATGG - Intergenic
983529540 4:168795033-168795055 CTGTGTGCTCATGCGGTGGAAGG + Intronic
985479446 5:99358-99380 TTGTGTGTTCATGAATTGGGAGG - Intergenic
986623444 5:9700962-9700984 TTGTGTGCAAGTGAAGTGTGGGG + Intronic
988697218 5:33634392-33634414 CGGTGTGCACATGAAGAGAAGGG + Intronic
989755221 5:44944209-44944231 TTGTGGACACTTGATGTGGATGG + Intergenic
989836370 5:45998683-45998705 TTGTGAGCACATGAGGTCTATGG + Intergenic
990590366 5:57256564-57256586 TAGTGTGGACATGAAGATGAAGG + Intronic
991594079 5:68284548-68284570 TTGAGTGCAGATAAAGTGGATGG - Intronic
992568880 5:78031285-78031307 TTATGTGGACATGAAGTTGGAGG + Intronic
994963830 5:106640415-106640437 TTGTGTTCAAATGAAGAAGACGG - Intergenic
998525510 5:142839741-142839763 CTCTGTGCAAATGAAATGGATGG + Intronic
1000922556 5:167156022-167156044 TAGTGGGCAAATGAAGTGGTAGG + Intergenic
1002332617 5:178455026-178455048 TTGTGTGCACGTCACGTGCATGG - Intronic
1003030862 6:2599355-2599377 GTGTGTGCACATACAATGGATGG + Intergenic
1004084275 6:12429266-12429288 TTGTGTGTGCATGAAGAGGGTGG + Intergenic
1005404190 6:25468011-25468033 TTTTGTAAACATGAAGTGCAAGG + Intronic
1007326542 6:41065542-41065564 TTTTGTCCACATAAAGTTGAAGG - Exonic
1008044267 6:46835517-46835539 CTGTGTGAACGTGAAGGGGATGG + Exonic
1011084816 6:83527971-83527993 TTGTGTCCTCATGTAGTGGATGG + Intergenic
1011674491 6:89718904-89718926 GTGTGTGCAGATGAGCTGGATGG - Exonic
1011868892 6:91867705-91867727 TTGACTGCAAATGGAGTGGAGGG - Intergenic
1012357015 6:98327106-98327128 TTTTCTGCACATGAAGAGAAAGG - Intergenic
1013618086 6:111863424-111863446 TTGTGTGGAAATGAAGTTGTTGG + Intronic
1013760589 6:113513111-113513133 TTGTGTGCAGTGGAAATGGAGGG + Intergenic
1015375139 6:132501568-132501590 GTGTGTGAACATGAACTGGAAGG - Intronic
1017078077 6:150638383-150638405 TTCTGTGTACTTGAGGTGGAAGG - Intronic
1017667758 6:156738085-156738107 TTGTGTGCACTAGAAGTAGTAGG - Intergenic
1017838444 6:158201716-158201738 TTCTGTGGACATGGAATGGAAGG + Intergenic
1019355752 7:577945-577967 TTATGTGCACATTAAGGGGTGGG + Intronic
1019814733 7:3191175-3191197 TTGTGTCCTCATGCGGTGGAAGG - Intergenic
1020559349 7:9710496-9710518 TAGTGTGCACAAAAATTGGACGG - Intergenic
1023336947 7:39180436-39180458 CTGTGTGCCCAAGAAGTGGTGGG - Intronic
1023580611 7:41678358-41678380 TTGTGTACACATGAAGAAGTAGG - Intergenic
1023593117 7:41799758-41799780 TTGTGTGCCCATGATGAAGAGGG - Intergenic
1024611633 7:51069724-51069746 TTGTGTGAATAAGAAGTGGTAGG - Intronic
1024936280 7:54715173-54715195 TTGTGTCCCCTTGAAGTTGAAGG + Intergenic
1028700583 7:93774396-93774418 TAGTGTGCATTTGAAGAGGAGGG - Intronic
1032024182 7:128428610-128428632 ATGTGTGGAGATGAAATGGAAGG - Intergenic
1035849934 8:2908424-2908446 TTGTGTAAACATAAATTGGAAGG - Intergenic
1039073423 8:33666874-33666896 TTGAGTCCAGATGAAGTGGGTGG - Intergenic
1043017411 8:74957187-74957209 TTATGTGGACATGGAGTGGTAGG + Intergenic
1043138712 8:76560188-76560210 TGGTGTGGAGATGAAGTAGAAGG + Intergenic
1048000897 8:130378825-130378847 ATGTGTGCACATTTATTGGAAGG - Intronic
1048223560 8:132564662-132564684 GTGGGTGCACATGGAGTAGAGGG + Intergenic
1048698488 8:137056478-137056500 TTGTGAGAAAATGAGGTGGATGG - Intergenic
1051307349 9:15726151-15726173 TTGTGTCCACATGAAGGGGTTGG + Intronic
1052449503 9:28610563-28610585 CTGTGTTCACAGGTAGTGGAAGG - Intronic
1052958852 9:34276984-34277006 CTGTGTAAACATGAAGTGAAAGG - Intronic
1053653337 9:40191474-40191496 CTGTGTGAACCTGAAGTGGGTGG - Intergenic
1053903739 9:42820764-42820786 CTGTGTGAACCTGAAGTGGGTGG - Intergenic
1054698325 9:68385618-68385640 ATGTGTGCACATGCATGGGATGG + Intronic
1055566912 9:77578899-77578921 TTGGATGCCCATCAAGTGGAAGG - Intronic
1055738957 9:79364658-79364680 TTGTGTGGACTTGAAGTTCAGGG - Intergenic
1056461557 9:86814069-86814091 TTGTGTCCTCACAAAGTGGAAGG + Intergenic
1056468113 9:86878831-86878853 ATGTGTGCACATGATGGGGAAGG - Intergenic
1056834805 9:89945619-89945641 ATGAGTGCACAGGAAGTGGAGGG + Intergenic
1058217407 9:102252554-102252576 TTGCGTGCACATCAAGATGATGG + Intergenic
1058693902 9:107543060-107543082 GTGTGAGCAAATGAGGTGGAGGG + Intergenic
1058716355 9:107725771-107725793 TTGTGTGCCCATGAGGTGCCAGG + Intergenic
1058809298 9:108624175-108624197 TTGAGTGGACATGGACTGGATGG - Intergenic
1059241729 9:112811743-112811765 TTGTGGACACACGATGTGGAAGG + Intronic
1060623500 9:125089628-125089650 TTGTGTGCACATTAAGTTTGAGG + Intronic
1062172723 9:135144451-135144473 CTGTGCCCACATGGAGTGGAAGG - Intergenic
1190084540 X:47383757-47383779 CTTTGTGCACATGAAATGGGTGG + Intronic
1192850115 X:74946369-74946391 ATGTGTGGAAATTAAGTGGAAGG - Intergenic
1193239030 X:79144164-79144186 GTGGGTGGACAGGAAGTGGAAGG + Intergenic
1195321153 X:103723176-103723198 TTCTGTGAACATCTAGTGGATGG + Intronic
1197853246 X:130887500-130887522 TTTTGTGTAAGTGAAGTGGATGG - Intronic
1198591750 X:138190757-138190779 TTTGGTGCACATAGAGTGGATGG - Intergenic
1200629889 Y:5570182-5570204 TTATATGCACAGGAAGAGGAGGG - Intronic
1201517610 Y:14835096-14835118 GTTTGTGGAGATGAAGTGGATGG + Intronic