ID: 1079241341

View in Genome Browser
Species Human (GRCh38)
Location 11:18724216-18724238
Sequence CCGGCTGTGAATGGTTGTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079241336_1079241341 5 Left 1079241336 11:18724188-18724210 CCATGGACACGTGCTCCTGCAGC 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1079241341 11:18724216-18724238 CCGGCTGTGAATGGTTGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 80
1079241338_1079241341 -10 Left 1079241338 11:18724203-18724225 CCTGCAGCATCTGCCGGCTGTGA 0: 1
1: 0
2: 0
3: 16
4: 168
Right 1079241341 11:18724216-18724238 CCGGCTGTGAATGGTTGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079241341 Original CRISPR CCGGCTGTGAATGGTTGTCA TGG Exonic
914992133 1:152507955-152507977 CCGGCTCTGAATGATGGCCAAGG + Intergenic
916031468 1:160881118-160881140 CTGGCTGGGACTGGTTTTCATGG - Intronic
917669361 1:177257604-177257626 ACGTCTGTGAATGGCAGTCAAGG + Intronic
918082126 1:181215763-181215785 CGGGCTGTGAATGGAAGTAATGG + Intergenic
923236740 1:232040857-232040879 CAGGCTGTGAGTGGTTTTCCTGG - Intronic
1064167329 10:12997685-12997707 CTGACTGTGTATGATTGTCATGG - Intronic
1073811739 10:107159874-107159896 CTGGCTGTGAATGCTTGACTTGG - Intronic
1077714580 11:4568797-4568819 AGGGATGTGAATGGTTGACAAGG + Intergenic
1077914277 11:6601132-6601154 CCAGCGGTGAATGGGGGTCAGGG - Exonic
1079241341 11:18724216-18724238 CCGGCTGTGAATGGTTGTCATGG + Exonic
1080700079 11:34637260-34637282 CAGGCTGTGCATGGTGGTCAGGG + Intronic
1082772655 11:57220357-57220379 CCGAAAGTGGATGGTTGTCAAGG - Intergenic
1082943607 11:58734850-58734872 AAGGCTGAGATTGGTTGTCATGG - Intergenic
1083339449 11:61949691-61949713 CTGGCTGTGATTGGCTGGCAGGG - Intergenic
1083464899 11:62838994-62839016 ACGGCTTTGAATGGGTGACAGGG - Intronic
1083695591 11:64440167-64440189 CCTCCTCTGAATGGTTGTCATGG + Intergenic
1084671417 11:70608718-70608740 TCGGCTGTGAATGGGTTTCCGGG - Intronic
1084865568 11:72053727-72053749 CCTACTGTAATTGGTTGTCAGGG - Intronic
1087976022 11:104547724-104547746 CTGTATGTGAATGGTTGTTAAGG - Intergenic
1089778930 11:120859591-120859613 CTGGCTGGGCATGGTTGGCAGGG - Intronic
1092287346 12:7136351-7136373 CCCGCTCTGAGTAGTTGTCACGG - Exonic
1107483287 13:40803020-40803042 CTGGCATTGAATGGGTGTCAGGG + Intronic
1111652854 13:91114711-91114733 GCTGCTATGAATGATTGTCAAGG + Intergenic
1113566474 13:111322495-111322517 CCGTCTGTGAGGGGCTGTCAGGG + Intronic
1117236238 14:53779999-53780021 GCGACTGTGAATGGCTTTCAAGG - Intergenic
1120863592 14:89276589-89276611 CGGGCTGTGAGTGGTTGAGAGGG + Intronic
1133514339 16:6493434-6493456 CCAGCTGTGTGTGTTTGTCAGGG + Intronic
1135035664 16:19074933-19074955 CAGGTTGAGAATCGTTGTCAGGG - Intronic
1138309882 16:56014511-56014533 CCGGAAGTGAATGCTAGTCAAGG - Intergenic
1139168045 16:64594345-64594367 CTGGTTTTGAATGGTTGCCATGG - Intergenic
1139817952 16:69691900-69691922 CTGGGTTTGAATAGTTGTCAGGG - Exonic
1141697186 16:85625683-85625705 CCTGCTGTGAATGGGGGTGACGG - Intronic
1150477489 17:65486122-65486144 TCCCCTGTGAATGGTTGGCAAGG - Intergenic
1159542634 18:69797959-69797981 TCGGCTTTGAATCTTTGTCAAGG - Intronic
1160038364 18:75321694-75321716 CAGGCTGTGTGTGGGTGTCAAGG + Intergenic
1162180728 19:8867099-8867121 CCACCTGTGAATGGTTGTCCTGG - Intronic
1162298547 19:9829895-9829917 CCGGCTGTGAATGGATGAGAGGG + Intronic
1163892256 19:20027423-20027445 CCTGCTGTGCTTGGTTTTCATGG - Intronic
1165158741 19:33803631-33803653 CCGGCTGTGCTTGGCTGTCTCGG - Intronic
925719159 2:6811459-6811481 CCCCCTGAGAATGGTGGTCATGG - Intergenic
937040459 2:118816563-118816585 ACTGCTGTGAATGGAGGTCATGG - Intergenic
937446587 2:121963409-121963431 CAGGGTTTGAATGGTAGTCAGGG + Intergenic
937555589 2:123151378-123151400 CAGGCTGTGAAAGGTGGTCTAGG - Intergenic
941178236 2:162226924-162226946 CAGGCAGTGAAGAGTTGTCAAGG + Intronic
945566018 2:211400619-211400641 GAGGCTGGGAATGGTAGTCAAGG + Intronic
946013291 2:216583760-216583782 CCAGCTGTGTCTGTTTGTCAAGG - Intergenic
1171533567 20:25867566-25867588 CCGGTTGTCAATCGTTTTCACGG - Intronic
1172010175 20:31841997-31842019 CCGGAGGTGAATGTTGGTCATGG + Intergenic
1173870417 20:46338194-46338216 TCGGCTGTGACTGGTGGTGATGG - Intergenic
1176667051 21:9697306-9697328 CAGGCTGAGAATGGTTTTTATGG + Intergenic
1185285629 22:49998640-49998662 CTGCCTGTGCATGGGTGTCATGG + Intronic
953477543 3:43218460-43218482 CAGGCTGAGAATGTTTGACATGG + Intergenic
954326814 3:49868504-49868526 CTGCCTGTGAATGGTGGCCAGGG + Intronic
954604178 3:51895750-51895772 GTGGCTATGAACGGTTGTCAGGG - Intronic
969504829 4:7578929-7578951 CTGGCTGTGGGTGGATGTCAGGG + Intronic
971236434 4:24846476-24846498 TCAGCTGTGGATGTTTGTCATGG - Intronic
977120396 4:93092546-93092568 CCATCTGTGAATGGTAGACACGG + Intronic
984868949 4:184310355-184310377 ATGGCTGTGAATGGTGGCCACGG + Intergenic
985407962 4:189655031-189655053 CAGGCTGAGAATGGTTTTTATGG - Intergenic
985711757 5:1433364-1433386 GTGGCTGTGGATGGCTGTCAAGG - Intronic
985947515 5:3197893-3197915 GCAGCTGAGAATGGTCGTCACGG - Intergenic
989099161 5:37808537-37808559 CAGGCTGTGTCTGGGTGTCACGG + Intergenic
993861440 5:93141614-93141636 CTGGGTGTCAATGGTTGTAATGG + Intergenic
997237631 5:132282780-132282802 CTTCCTGTGAATGGTTGGCAAGG - Intronic
999735456 5:154509692-154509714 CCGGCTGGGAGTGGGTGGCAAGG + Intergenic
1000186815 5:158866569-158866591 CGGGCTTTGAATTGTTGACAAGG - Intronic
1001996788 5:176167979-176168001 CCAGCTCTGAAGGGTTGTCAGGG + Intergenic
1006814602 6:36841281-36841303 CCAGCTGTGCCTGGCTGTCAGGG - Intergenic
1007754276 6:44088842-44088864 CTTGCTGTGACTGGTTGTAAGGG - Intergenic
1010236719 6:73580798-73580820 CCTGCTGTGAGTGGTTTTTAGGG + Intergenic
1019184038 6:170210527-170210549 CCGGCTGTTAATGGGGGTAAGGG + Intergenic
1019187414 6:170228918-170228940 GTGGCGGTGAATGTTTGTCATGG - Intergenic
1028475501 7:91249097-91249119 CCGGCTGAAAATGGCTGTCATGG - Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1032709690 7:134451008-134451030 GATGCTGTGAATGGTTGTGAGGG + Intronic
1034545606 7:151786704-151786726 GCGGATGTGCATGGTGGTCAGGG - Intronic
1042522913 8:69733472-69733494 CCGGCAGTGAATGGATTCCACGG + Intronic
1046232630 8:111376802-111376824 CCAGCTGTGTCTAGTTGTCAGGG + Intergenic
1046906079 8:119574412-119574434 CAGGCTGAGAATGCCTGTCATGG + Intronic
1047508808 8:125500453-125500475 GCTGCTGTGAATGGTTGTGCGGG - Intergenic
1056177599 9:84050477-84050499 CAGGCAGTGATAGGTTGTCAAGG + Intergenic
1058274048 9:103017717-103017739 CCGTCTGTGGTTTGTTGTCATGG - Intronic
1062403251 9:136381640-136381662 CTGGCTGTGACTGGGTGTCCTGG + Intronic
1203659045 Un_KI270753v1:24456-24478 CAGGCTGAGAATGGTTTTTATGG - Intergenic
1195562805 X:106303509-106303531 GAGGCTGAGAATGGTAGTCAGGG - Intergenic
1196212246 X:113009142-113009164 CTGGCTGTGACTGGTTTTGACGG + Intergenic
1197007052 X:121514431-121514453 CAGGAAGTGAATGGTTTTCAAGG + Intergenic