ID: 1079243152

View in Genome Browser
Species Human (GRCh38)
Location 11:18734949-18734971
Sequence ACTGCTAGTAAGTCAGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079243152_1079243158 29 Left 1079243152 11:18734949-18734971 CCTGATTCTGACTTACTAGCAGT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1079243158 11:18735001-18735023 TGTGCCTTATCTGTAATCTGGGG 0: 1
1: 0
2: 2
3: 31
4: 296
1079243152_1079243157 28 Left 1079243152 11:18734949-18734971 CCTGATTCTGACTTACTAGCAGT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1079243157 11:18735000-18735022 CTGTGCCTTATCTGTAATCTGGG 0: 1
1: 0
2: 4
3: 26
4: 260
1079243152_1079243156 27 Left 1079243152 11:18734949-18734971 CCTGATTCTGACTTACTAGCAGT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1079243156 11:18734999-18735021 CCTGTGCCTTATCTGTAATCTGG 0: 1
1: 0
2: 3
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079243152 Original CRISPR ACTGCTAGTAAGTCAGAATC AGG (reversed) Intronic
902404348 1:16174746-16174768 ACAGCAAGTCAGACAGAATCAGG - Intergenic
904619927 1:31769224-31769246 AGTCCTAGTAAGTCTGAAACGGG - Intergenic
904917355 1:33979817-33979839 ACAGCTAGTAAGTCAGAGCTGGG - Intronic
905141691 1:35850919-35850941 ACAGCTGGTAAGTCAGTAGCTGG - Exonic
905149851 1:35919120-35919142 ACAGCTGGTACGTCAGGATCTGG - Exonic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
910434204 1:87188629-87188651 ACTGCTTGAAAGGAAGAATCTGG - Intergenic
912259482 1:108096196-108096218 ACTCCCAGTACGTCAGAATGTGG + Intergenic
912316286 1:108670136-108670158 AGTGATAGGAAGTCAAAATCAGG - Intergenic
916948666 1:169757433-169757455 CCAGCTAGTAAGTTAGAATCTGG - Intronic
919467417 1:197939111-197939133 ACTGCAAATAAGTGATAATCAGG - Intergenic
920034431 1:203056674-203056696 ACTTCTATTAAGTCAGAACTGGG - Intronic
921777772 1:219122616-219122638 ACTACTAGAATTTCAGAATCAGG + Intergenic
924782224 1:247161052-247161074 ACTGCTAGAAAGTCTGTTTCAGG - Intronic
1068063625 10:52101257-52101279 ACTGCTAGTATTTCAGAGACAGG + Intronic
1068520510 10:58072132-58072154 ACTGTAAATAAGTCACAATCTGG - Intergenic
1071600586 10:86956945-86956967 ACTGCTGGGCAGTCAGAGTCAGG + Intronic
1074556798 10:114498880-114498902 ACTGTTATTAACTTAGAATCAGG - Intronic
1075901555 10:126046951-126046973 ACTACTTGTCAGTCAGTATCTGG - Intronic
1078935968 11:15950435-15950457 TCTGCTAGTAAGTGGTAATCTGG + Intergenic
1079243152 11:18734949-18734971 ACTGCTAGTAAGTCAGAATCAGG - Intronic
1080197307 11:29627410-29627432 ACTGCTAGCAGATCAGACTCAGG - Intergenic
1087355833 11:97093028-97093050 GCTGCTAGTAAGAAAGAATAGGG + Intergenic
1089188896 11:116640079-116640101 AGTGCTTGTAATTAAGAATCTGG - Intergenic
1089648638 11:119897108-119897130 ACTGTTACAAAGCCAGAATCTGG - Intergenic
1090062341 11:123475062-123475084 ACTGCTAGAAAGACGGAATATGG - Intergenic
1092650115 12:10625515-10625537 ACTGCTAGAAACTTGGAATCAGG - Intronic
1097940068 12:65294321-65294343 ACTGCAAGTTAGTGAGATTCAGG - Intronic
1100230916 12:92606314-92606336 ACTGGTAACAAGTCAGGATCTGG - Intergenic
1101944737 12:109128139-109128161 ATTGCTAGAATCTCAGAATCAGG - Intronic
1104061848 12:125275203-125275225 AATCCTAGGAATTCAGAATCTGG - Intronic
1104231561 12:126889569-126889591 ACTCCCAGTAATTCAGAATGAGG + Intergenic
1105770628 13:23608496-23608518 ACTGCTAGTAAGTAACAGTGCGG + Intronic
1106956781 13:34947954-34947976 TCTGTTAGTAAGTTCGAATCTGG + Intronic
1110893719 13:80722737-80722759 AGGGCTAGTAAGACAGATTCAGG - Intergenic
1111171112 13:84527953-84527975 GCTGCTAGCAAGTGAGAATGAGG - Intergenic
1112140560 13:96636675-96636697 ATTGCTAGAAACTCAGAATATGG + Intronic
1114408941 14:22482556-22482578 GTTTCTAGTAAATCAGAATCCGG + Intergenic
1116188229 14:41627497-41627519 GCTGCTAATAAATGAGAATCTGG - Intronic
1117490170 14:56239381-56239403 ACTGATAGTAAGTCAAAGTTAGG - Intronic
1123723459 15:23080294-23080316 CCAGCTAGTAAGTCATAATAGGG - Intergenic
1125790486 15:42361778-42361800 ACTGCTGGTGTGTCAGGATCTGG - Intronic
1126299576 15:47181197-47181219 ACTGCTAGTAAGTAAGAAGGAGG - Intergenic
1126587739 15:50306327-50306349 ACTGCCAGTAATTTAAAATCTGG + Intronic
1127286389 15:57537346-57537368 ACTGCTCCTCAGTCAGCATCAGG + Intronic
1129732537 15:77940323-77940345 ACTTCTAAGAAGACAGAATCTGG - Intergenic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1134311088 16:13075781-13075803 ACAGCTGGTAAGACAGAAGCAGG + Intronic
1156933099 18:42669081-42669103 ACTGCAAGCAAGTAAGACTCTGG - Intergenic
1157344292 18:46809924-46809946 ACTACTAGAAAGTCAGGGTCTGG + Exonic
1158237790 18:55338575-55338597 AATGCTAGTAAGTAAACATCAGG + Intronic
1161384053 19:3981678-3981700 AGTGCTTGTAAGTCAGAACTTGG - Intronic
926489770 2:13510647-13510669 ACTGTTAGTAATTCGAAATCTGG + Intergenic
927593799 2:24379621-24379643 ACTGATGGAAAGGCAGAATCAGG - Intergenic
928936129 2:36680075-36680097 ACTGCTGGGAAGACAGAATTGGG - Intergenic
931905048 2:66833517-66833539 ACTGGCAGTAAGGCAGATTCTGG - Intergenic
939391941 2:141579547-141579569 ACTAATAATAAATCAGAATCTGG + Intronic
940641219 2:156346223-156346245 ACTTCTCGTAAGTCAGAACAGGG + Intergenic
942292348 2:174485996-174486018 ACTGCTATTAAGTGAAAATGCGG + Intronic
943433956 2:187839863-187839885 AATTTTAGTAAGTTAGAATCTGG - Intergenic
946358266 2:219202676-219202698 CTTGCTACGAAGTCAGAATCTGG - Intronic
1175618601 20:60424277-60424299 ACTGCAAATAAGTCAGGGTCTGG + Intergenic
1177872871 21:26594471-26594493 ACTGCTAGTAAGCATTAATCAGG - Intergenic
1181643055 22:24214917-24214939 TCTGCAGGTGAGTCAGAATCAGG + Intergenic
950401177 3:12769927-12769949 ACAGCTGGTAAGTCACAGTCAGG - Intergenic
951799144 3:26575756-26575778 CCTGTTAGAAAGTCAGAATTGGG + Intergenic
952232620 3:31447779-31447801 GCTGCTCCCAAGTCAGAATCAGG - Intergenic
953794032 3:45969385-45969407 ACAGCTGGTAGGTGAGAATCAGG + Intronic
954865938 3:53729551-53729573 ACTGCTAGTGGGTAAGAAACAGG + Intronic
963714789 3:148790713-148790735 ACTGAAAATAAGTCAGTATCTGG - Intergenic
964874464 3:161350412-161350434 ACTTCTAGAACATCAGAATCAGG + Intronic
968166938 3:196474084-196474106 TATGCTAGTAAGGCAGCATCAGG - Intronic
976206715 4:82629286-82629308 GCTGCTGGTGAGTGAGAATCAGG + Intergenic
984374566 4:178911108-178911130 CCAGGTTGTAAGTCAGAATCAGG + Intergenic
985898523 5:2766102-2766124 ACTGCAAGCAAGTCAGAAAAGGG - Intergenic
986862799 5:11947857-11947879 ACCCCTAGTATGTCAGAATGTGG - Intergenic
988626015 5:32875549-32875571 AATGCTATTAAGTCAGTATAGGG + Intergenic
992029195 5:72703595-72703617 TCTGCTATTTAGTCAAAATCAGG + Intergenic
993099808 5:83523835-83523857 ATTGCCAGTAAGTCGGAATGAGG + Intronic
997069149 5:130598837-130598859 ACAGACAGTAAGTCAGAAACAGG - Intergenic
998307681 5:141095696-141095718 ACTGCTTTTAAGACAGAAACTGG + Exonic
999086108 5:148891700-148891722 ACTGCTAGTAATTGAGAAACAGG - Intergenic
1000309298 5:160026008-160026030 ATAGCTAGTAAGTCAGAATTCGG + Intronic
1000485742 5:161841166-161841188 ATGGCTTATAAGTCAGAATCTGG - Intergenic
1004366536 6:15017895-15017917 CCTGCCAGTGAGTCTGAATCTGG - Intergenic
1006176027 6:32122129-32122151 GCAGCTTGGAAGTCAGAATCTGG - Intronic
1008018909 6:46553543-46553565 ACTGCTATTAAGTCCCAGTCAGG + Intronic
1008166494 6:48145258-48145280 ACTGCTAGTCAGTCTGAGGCAGG + Intergenic
1009044482 6:58221395-58221417 ACTGCAAGTAAGTCAGGAATAGG - Intergenic
1013278267 6:108607962-108607984 ACTGCTCTGAAGTAAGAATCTGG - Intronic
1013579906 6:111523381-111523403 AATGCTAAAAAGACAGAATCAGG - Intergenic
1021117048 7:16755351-16755373 ATGGCTAGTTAGTAAGAATCTGG + Intronic
1022829552 7:34051818-34051840 AGTGTAAGTAAGACAGAATCGGG - Intronic
1025814237 7:64895457-64895479 ACTGTTAGTGAATCGGAATCTGG - Intronic
1027422304 7:78028948-78028970 TAAGCTAGTAAGTGAGAATCAGG + Intronic
1027698726 7:81442462-81442484 ACTGCTAGTAATCCAGAAAGCGG - Intergenic
1033026135 7:137774633-137774655 ACTACTAGCAACTCAGAATGTGG - Intronic
1033778769 7:144644820-144644842 ACTCCTATTAACTCAGAATGAGG - Intronic
1037507919 8:19550984-19551006 ATTGCTGGGAAGTCAGAATAAGG - Intronic
1040857387 8:51961962-51961984 ACTCCCAGTAACTCAGAATGGGG - Intergenic
1044842192 8:96346011-96346033 ACTGTTTGCAAGTCAGAAGCTGG - Intergenic
1048095424 8:131287025-131287047 ACAGCTAGTCAGTCAGAAGCAGG - Intergenic
1048817904 8:138351210-138351232 ACTCCTAGTACCTCAGAATGTGG + Intronic
1052310408 9:27061309-27061331 ACTGCTTGTAAGTTACAAACTGG + Intronic
1186299886 X:8189044-8189066 ACAGCTAGAAAGTCAGAAATAGG + Intergenic
1196574591 X:117303078-117303100 ACTGCTAGTAAGACTGAGCCTGG - Intergenic
1197095453 X:122589175-122589197 TCTGCTAGTTAGGCATAATCAGG - Intergenic