ID: 1079245309

View in Genome Browser
Species Human (GRCh38)
Location 11:18747951-18747973
Sequence CTCACCCCACCCCAAAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079245309 Original CRISPR CTCACCCCACCCCAAAGAAC TGG (reversed) Intronic
900512000 1:3065165-3065187 CTCACCCCACCCCCAATACGTGG - Intergenic
900605138 1:3520530-3520552 CTCTTCCCACCCCAGAGACCGGG + Intronic
900720340 1:4171993-4172015 CTATCCCCACCCCAAAGCCCAGG + Intergenic
901068434 1:6505705-6505727 CTCACCCCGCCCGCAAGATCAGG - Intronic
901763963 1:11488330-11488352 CTCCCCCCACCCCACAGCAAGGG + Intronic
902374159 1:16022515-16022537 CTCTCCCCACCCAAATGAAGAGG - Intronic
902863449 1:19262010-19262032 TTTACCCCACCCAAAAGAACTGG + Intergenic
903070229 1:20723575-20723597 CTCTGCCCACCCCAAGGGACTGG + Intronic
903264471 1:22149268-22149290 ATCTCCCCACCCCAGAGAGCTGG + Intergenic
903268627 1:22173967-22173989 CCCAGCCCACCCCACAGAATGGG - Intergenic
904117828 1:28175461-28175483 CACACACCACCCCAAACACCTGG + Intronic
904355139 1:29933854-29933876 CCCACCCCAGCCCTAAGAGCTGG - Intergenic
904464445 1:30699565-30699587 CTCACACCACCCCACAGATGGGG - Intergenic
904480785 1:30791938-30791960 TTTACCCCACCCCAAACTACCGG - Intergenic
904499221 1:30904579-30904601 CTCACTCCTCCCCAGAGAGCAGG + Intronic
906499553 1:46331577-46331599 CTCACCACAAGACAAAGAACAGG + Intergenic
907043080 1:51280942-51280964 CTTACCCCATTCCCAAGAACAGG - Intergenic
908111753 1:60904852-60904874 CTCACCCCCACCCACAGAGCAGG + Intronic
908938911 1:69409317-69409339 CTCACTCCAGTCCACAGAACTGG - Intergenic
909248847 1:73326803-73326825 CTCACCCACCCCCAATGAAAAGG - Intergenic
909483743 1:76151907-76151929 CTCACCCAACTCTCAAGAACCGG - Intronic
909685052 1:78338770-78338792 CTCTGTCCACCCCAAAGGACTGG - Intronic
910454949 1:87387609-87387631 CTCACAACAGCCCAAAGAAGTGG - Intergenic
913176432 1:116276967-116276989 CTCACCCCATCCCAAAGAACAGG + Intergenic
913507549 1:119531869-119531891 CTCACCCCACCCAAGATAACTGG + Intergenic
914455865 1:147835704-147835726 CTCACCCCAACCCCAACAAATGG - Intergenic
914641177 1:149607740-149607762 CTCCCCCCACCCCCAAGTATGGG + Intergenic
914919117 1:151835727-151835749 GTCCCCCCACCCCAAAAAAGAGG + Intergenic
915773741 1:158459482-158459504 ATCACCCTGCCCCAAACAACTGG + Intergenic
916346151 1:163793568-163793590 CCCACCCCACCCCAAGAAGCTGG - Intergenic
916428260 1:164702563-164702585 ATCACCCTACCCCCATGAACAGG + Intronic
916479923 1:165205884-165205906 CTCACCCCACCCCAGATGCCTGG - Exonic
917115754 1:171601430-171601452 CTCACCACAAGACAAAGAACGGG - Intergenic
917376443 1:174352957-174352979 GTCACCCCTCCCCAAACACCAGG - Intronic
918581243 1:186132791-186132813 CTCCCCCCACCCCCCACAACAGG + Intronic
918893980 1:190316029-190316051 ATCCCCCCACCCCAAACAACTGG + Intronic
919316647 1:195979262-195979284 AGCACCCCTCCCCAAAGCACTGG - Intergenic
920069059 1:203289539-203289561 CTCACCCCATCCCCAAGCTCTGG - Intergenic
921758715 1:218887311-218887333 CTCCCCCCTCCACAAGGAACAGG - Intergenic
921907797 1:220513632-220513654 CCCACCCCACCCCAAAAAAAGGG - Intergenic
921953176 1:220955148-220955170 CTCACCCCACTCCCAAAGACAGG - Intergenic
923125862 1:231033910-231033932 CCCACCCCACACCAAAGACATGG + Intronic
923421124 1:233816269-233816291 CTTACCCCACCCCAGACAATTGG + Intergenic
923474610 1:234321040-234321062 CCCCCCCCACCCCAAAGGAATGG + Intronic
923520976 1:234734731-234734753 CTCACCCCTCCCCGAACCACTGG - Intergenic
923776453 1:236983051-236983073 CTCACACCTTCTCAAAGAACAGG + Intergenic
924296565 1:242592908-242592930 CCCACCCCGCCCCACCGAACAGG - Intergenic
1064429370 10:15257714-15257736 AACACCCCACCACAAAGCACAGG + Intronic
1067176045 10:43946317-43946339 GTGACCACACCCCAAGGAACTGG + Intergenic
1067250382 10:44581611-44581633 TTCACCCCATCCCAGAGGACAGG + Intergenic
1069939986 10:71948736-71948758 CTCACCCCACCCCACCCTACCGG - Intergenic
1071905497 10:90169467-90169489 GTCCCCCCACCCCAAAAAAGAGG - Intergenic
1074566368 10:114581980-114582002 CTCTCACCACTCCATAGAACTGG + Intronic
1075379150 10:122004578-122004600 CACACCCCATCCCCCAGAACTGG + Intronic
1075953236 10:126500022-126500044 CACAGACCACCACAAAGAACTGG + Intronic
1077170464 11:1163778-1163800 CTAACCCCACCCCAGGGACCCGG + Intronic
1077240834 11:1509636-1509658 ATCACCCCTCCCCAAAAAAAGGG + Intergenic
1077591202 11:3492349-3492371 CTCAGCCCCCCCCCAAGTACTGG + Intergenic
1079126600 11:17721846-17721868 CTCACGCCCCCCCAAATAACCGG - Exonic
1079245309 11:18747951-18747973 CTCACCCCACCCCAAAGAACTGG - Intronic
1080323137 11:31038067-31038089 CTCCCCCCTCCCCCAACAACAGG - Intronic
1080872501 11:36249323-36249345 CTCCCCCAACACCAAAGAGCTGG - Intergenic
1081472921 11:43393598-43393620 CTCTCCCCTCCCCGAAGGACAGG + Intronic
1081992584 11:47345791-47345813 CTCTCCACACCCAAAAGAAAAGG - Intronic
1084430036 11:69105911-69105933 CTCACCCCACCCCAAGCACAGGG - Intergenic
1089242275 11:117092032-117092054 CTCATGCCCCCCCAAAGCACTGG + Intronic
1089297940 11:117481093-117481115 CTAACTCCACCTCAAAGAGCAGG - Intronic
1090379275 11:126314074-126314096 ATCCCCACACCCCAAAGAAGGGG - Intronic
1090435047 11:126679775-126679797 CTCAACCCACTCCAAATAGCCGG + Intronic
1092602298 12:10080310-10080332 CTCCCCCCACCCCCAAAAAAAGG + Intronic
1092997172 12:13961343-13961365 CTCACCCCTCCCATAAGATCTGG - Intronic
1096476051 12:51909627-51909649 CTCATCTAACCCCAAACAACTGG + Intronic
1096517241 12:52163797-52163819 CTCACCCCAACCCCTAGATCTGG - Intergenic
1102452449 12:113052081-113052103 CCCTCCCCACCCCAGAGCACTGG - Intergenic
1102619574 12:114183291-114183313 CTCCCCCCACCCCCAACAAAAGG + Intergenic
1103364430 12:120370911-120370933 CTCTCCCCACCCCAACCATCAGG + Intergenic
1103428374 12:120859161-120859183 CGCCCCCCACCCCAAAAAAGAGG - Intronic
1103486902 12:121289074-121289096 CCCACCCCAACCAAAAGAGCGGG + Intronic
1104311907 12:127660882-127660904 CTCAGGCCACCCCAAAGCCCAGG - Intergenic
1105695525 13:22884526-22884548 CTCACCACAAGACAAAGAACGGG - Intergenic
1106379537 13:29223171-29223193 CTCACTCCAGTCCACAGAACTGG - Intronic
1106518416 13:30475319-30475341 TTCACCCCACCCCAAGTAGCTGG + Intronic
1106552551 13:30784721-30784743 CTCATCCCACCCCACAGACACGG - Intergenic
1107411479 13:40162400-40162422 CTCACCTTTCCCCAAAGCACTGG - Intergenic
1110078636 13:71282711-71282733 ATCCCTCCACCCCCAAGAACTGG - Intergenic
1110236350 13:73221591-73221613 CTCACCCCTCCACAGAGCACTGG + Intergenic
1111396366 13:87672970-87672992 CCCACCCCGCCCCAAAGAGAAGG - Intronic
1112375647 13:98837735-98837757 CGCCCCCCACCCCAAAAAAAAGG - Intronic
1112608519 13:100931746-100931768 CTCACCACTCCCCAGAGATCAGG - Intergenic
1114522259 14:23347024-23347046 CCCACCCCACCCCTGAGGACAGG - Intronic
1114566888 14:23639538-23639560 CTCACCCCACCCCCAGGCCCGGG + Intronic
1119103910 14:71906358-71906380 CTTACCCCAAACCAAAGGACTGG + Intergenic
1119406047 14:74400341-74400363 CTCACCCCAGCCCCAACACCAGG - Intergenic
1120740751 14:88106266-88106288 CTCACTCCACCCCCAAGCAGAGG - Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1122834104 14:104422743-104422765 CACACCCCACACCACAGAGCGGG - Intergenic
1122930717 14:104931996-104932018 CCCTCCCCACCCCAAGGTACTGG + Exonic
1124061315 15:26296151-26296173 CTCACCCCAGCCCCAGAAACTGG - Intergenic
1124244285 15:28056544-28056566 CCCACGTCACCCCAAAGGACAGG - Intronic
1124375072 15:29124567-29124589 CTCACCCCACCCCCGGGAATGGG - Intronic
1124407840 15:29407668-29407690 CTCCCCCCAACCCAAAAAAATGG - Intronic
1125237792 15:37536006-37536028 CCCTCCCCACCCCCAACAACAGG - Intergenic
1125646596 15:41277838-41277860 CTCAGCCTCCCCCAAGGAACTGG - Intronic
1125729749 15:41886497-41886519 GTACCCCCACCCCAGAGAACTGG + Intronic
1126197501 15:45948799-45948821 CTCACACCACCACAAAGAGAAGG - Intergenic
1126793759 15:52243631-52243653 CTCACAGCATCCCAAAGAAGGGG + Intronic
1128109046 15:65065018-65065040 CACAGCCCACCCCAGACAACTGG - Intronic
1128200977 15:65807695-65807717 CCCACCCCACCCCCAAGCCCAGG + Intronic
1129262713 15:74377608-74377630 CTCACCCCAGTCCAGAGACCTGG - Intergenic
1130045219 15:80438690-80438712 ATCCCCCCACCCCAAAAAAGAGG - Intronic
1130795835 15:87208528-87208550 CTGGGCCCAGCCCAAAGAACTGG - Intergenic
1130936586 15:88475979-88476001 CTCTCCCAACCCCAAACCACTGG - Intronic
1131473210 15:92714226-92714248 CTCTCCGCACCCCATAGAAGCGG - Intronic
1131714019 15:95088964-95088986 CTCACCACACACAAAAAAACTGG - Intergenic
1132121607 15:99180677-99180699 CCCACCCCATCCCCAAGAGCTGG - Intronic
1132576588 16:667091-667113 CTCACCCCACCCCAGAGACGAGG - Intronic
1135556037 16:23437345-23437367 CTCCCCCAACCCCACAGAACTGG + Intronic
1135558222 16:23454609-23454631 CTCCCCTCCCCCCAAATAACTGG - Intergenic
1136611866 16:31371341-31371363 CTCACCCCCACCCAGAGCACAGG - Exonic
1137334322 16:47533316-47533338 CTCACCCCAGTCCACAGGACTGG + Intronic
1138088555 16:54155584-54155606 CTCAGCCAACCCCAGAGAGCTGG + Intergenic
1138117788 16:54374145-54374167 CACACCACTCCCCAAAGACCCGG + Intergenic
1138416532 16:56874809-56874831 CTCACCCCCCCGCAAAAAAAAGG + Intronic
1139702126 16:68714292-68714314 CTCACCCCAGCACCAAGCACAGG + Intronic
1139875267 16:70140961-70140983 CTCACACCATCCCAAACAAAAGG - Intronic
1140129629 16:72148987-72149009 CTCAGCCAACCCCACAGAGCTGG - Intronic
1141835072 16:86532938-86532960 CTCATCCCACCCAAAGGTACAGG - Intronic
1141900731 16:86988659-86988681 CTGACCCCACCCCACAGCAATGG - Intergenic
1143784065 17:9243878-9243900 CCCACCCCCCCCCAAAAAAAAGG - Exonic
1144602354 17:16628264-16628286 CTCCCCCGACCCCAAAAAAAAGG + Intronic
1144726972 17:17506942-17506964 GTCACCCCAGCCCAGAGGACGGG + Intronic
1145251152 17:21297737-21297759 CTCACTCCACCCCTAGGGACAGG - Intronic
1145826771 17:27882844-27882866 CCCACCCCACCCCAAGGTGCAGG - Intronic
1146992276 17:37285696-37285718 CACCCCCCACCCCAAGTAACTGG - Intronic
1147041697 17:37724230-37724252 CACCCCCCACCCCAGGGAACTGG + Intronic
1147111896 17:38268855-38268877 CTCCCGCCTCCCCAAAGTACTGG + Intergenic
1147169178 17:38608159-38608181 CCCACCCCACCCCAAGCCACTGG - Intergenic
1147727073 17:42572456-42572478 TTCACCCCACCCCCAAGTCCTGG - Exonic
1148417677 17:47519946-47519968 CTCCCGCCTCCCCAAAGTACTGG - Intergenic
1148797562 17:50204368-50204390 CTCCCCACACCCCCAAGAAATGG + Intergenic
1148850066 17:50550320-50550342 CTGACCCCAGCCCAGAGAACAGG + Intronic
1151685274 17:75642589-75642611 CTCAGCCCCCTCCAAAGAATAGG + Intronic
1152096032 17:78272108-78272130 TTCTCTCCACCCCAAAGAAGGGG + Intergenic
1152566656 17:81103325-81103347 CTGACCCCAACCCACAGAAGCGG - Intronic
1152892985 17:82892986-82893008 CTGTCACCACCCCCAAGAACCGG + Intronic
1153929763 18:9867834-9867856 TTCCCCCCACCCCACAAAACAGG + Intergenic
1156527681 18:37782392-37782414 CTCTCCTCAACCCAAAGCACTGG - Intergenic
1161838083 19:6661312-6661334 TTCTCTCCACCCCAAAGAAGGGG + Intronic
1161861056 19:6798661-6798683 CCCCCCCCACCCAAAAGAAGGGG + Intronic
1162918017 19:13884674-13884696 CCTCCCCCACCCCACAGAACAGG + Intronic
1163408069 19:17136020-17136042 CCCACCCCACCCCTGAGGACAGG + Intronic
1163427414 19:17246844-17246866 CTCACCCCATCCCCCAGTACCGG + Intronic
1164449354 19:28346866-28346888 TTCACCCCACCCCAGAAAATTGG + Intergenic
1164488847 19:28688051-28688073 CCCACCCCACCCCAACATACAGG + Intergenic
1164839842 19:31384631-31384653 CTCAGCCCACCCCAAAAGAAGGG - Intergenic
1164880393 19:31727992-31728014 CCCACCCCTCCCCAAGGAAATGG + Intergenic
1165384952 19:35504905-35504927 CTAACCCCACCCCATGGAAATGG + Intronic
1168145951 19:54420324-54420346 CTCCCCCCACGCCAGAGAGCCGG - Intronic
925059963 2:883480-883502 CTCACACCAGCACTAAGAACGGG - Intergenic
925511009 2:4625432-4625454 TTCACCCCACCCCAAACCCCAGG - Intergenic
926695409 2:15767111-15767133 CTCACCACATGCCAGAGAACGGG - Intergenic
927411478 2:22831085-22831107 CCCACCCCCCCCCAAAAAAATGG + Intergenic
928553864 2:32402199-32402221 CCCACCCCACCACAAAAATCAGG - Intronic
929178005 2:39001571-39001593 CTGACCCTCCCCCAAAGAAGGGG + Intronic
929191215 2:39141843-39141865 CTCCCCCCACCCCAAACAGGTGG - Intergenic
929699911 2:44153014-44153036 CTCACCTCACGCCAAAGGAAAGG - Intergenic
931772540 2:65510623-65510645 CTAACCCCACCCCAAGTAGCTGG + Intergenic
931893227 2:66698775-66698797 CACACCCCACCCCATGCAACAGG + Intergenic
932437396 2:71710651-71710673 CCCACCACACCCCAAAGCCCAGG - Intergenic
933030078 2:77317679-77317701 CTCACCCCACCACAGTGCACTGG - Intronic
935059118 2:99592931-99592953 CTCCCCCCCCCCCAAAAAAAGGG + Intronic
936639601 2:114297362-114297384 CTCACCGAACCAGAAAGAACAGG - Intergenic
937230339 2:120394912-120394934 ATCAGCCCTCCCCAGAGAACAGG + Intergenic
938801873 2:134771269-134771291 CTCCCCCAGCCCCAAACAACTGG + Intergenic
939737032 2:145859470-145859492 CTAACTTCACCCCAAAGAAATGG - Intergenic
942210749 2:173667155-173667177 CTAACCCCACCCTTAAGCACTGG - Intergenic
946504538 2:220284853-220284875 CTTCCCCCACCCCAAATAGCAGG + Intergenic
1168928663 20:1603828-1603850 CTCAGCCCACCCGAAGGAGCAGG - Intronic
1168969715 20:1922605-1922627 CTCAGCCCACCCGAAGGAGCAGG + Exonic
1170401169 20:15985255-15985277 CTCACCACAAGACAAAGAACGGG + Intronic
1170847919 20:19977522-19977544 CTCACCTCACCCCTGTGAACAGG + Intronic
1172759961 20:37314855-37314877 CTCAGCCCACCCTACAGAAGAGG - Intronic
1173072158 20:39778878-39778900 CTCCCCCCACCTCACAGAAGAGG + Intergenic
1173135258 20:40433552-40433574 GTCACCCCACCCCACAGCCCAGG - Intergenic
1173159239 20:40640015-40640037 CTCCACCCACCCCAACTAACTGG + Intergenic
1173777959 20:45727195-45727217 TTCTCCCCACCACAAAGATCTGG + Intergenic
1175710581 20:61217261-61217283 CTTCCCCCACCCCAAAGCAGTGG - Intergenic
1176388321 21:6150721-6150743 CTCAGCCCACCCCAAACCCCTGG - Intergenic
1179194230 21:39150647-39150669 CTCTCTCCTCCCCAAAGGACGGG + Intergenic
1179735151 21:43387527-43387549 CTCAGCCCACCCCAAACCCCTGG + Intergenic
1180158773 21:45989980-45990002 TTCACCCCACCCCAGAGCAGGGG + Intronic
1180187531 21:46146878-46146900 CCCACCCCACCCCACAGAGACGG + Intronic
1182630541 22:31681988-31682010 CTCCCCCCACCCCAGGGAATGGG + Exonic
1183218031 22:36493798-36493820 CTCTCTCCTCCCCACAGAACAGG - Exonic
1184731508 22:46373473-46373495 CCCCCCCCACCCCAGAGCACTGG - Intronic
1185162993 22:49240620-49240642 CTCACGTCTCCACAAAGAACAGG + Intergenic
949891085 3:8734135-8734157 CCCACCCCACCCCCAAAAAAAGG + Intronic
950041130 3:9920158-9920180 CACACCCCTCCCCACAGAAGTGG - Intronic
950959977 3:17095025-17095047 CTTGCCCCACCCCAAAGAAAAGG + Intergenic
952249870 3:31642329-31642351 CTCCGCCCACCCCAAGGAAATGG - Intergenic
952918443 3:38267315-38267337 CCCACCCCACCCCACACCACAGG + Intronic
954263634 3:49457412-49457434 CTCACCCTACCCTAAGCAACAGG - Intergenic
954581021 3:51702983-51703005 CCCACCCCACCCCCAATGACTGG - Intronic
955330080 3:58040154-58040176 GTCACAGCACCCCAAAGATCTGG - Intronic
956754605 3:72372644-72372666 CGAAACCCACCCCAAATAACTGG - Exonic
958052139 3:88362444-88362466 CTCACTCTTCCCCAAAGAAAAGG + Intergenic
960283834 3:115805169-115805191 CTCACCCGACCCCAAAGCAAGGG - Exonic
960414390 3:117366387-117366409 CGCCCCCCACCCCACAGAAATGG + Intergenic
962276865 3:134021172-134021194 CACACCACAAACCAAAGAACAGG - Intronic
964484797 3:157176131-157176153 TTCACCCCCCACCAAAAAACAGG - Intergenic
964884389 3:161464606-161464628 CTCCCCACACCCCAAGGAACAGG - Intergenic
966667143 3:182484248-182484270 CTCACCTGTCCCCAAAGACCAGG + Intergenic
967584604 3:191196550-191196572 CTCACCCCACCCCTAGGTCCTGG - Intergenic
967890683 3:194362295-194362317 CTCACAACAGCCCCAAGAACGGG - Intronic
969546202 4:7830136-7830158 CTCGCCCCGCCCCATAGAAAGGG - Intronic
971354184 4:25879605-25879627 CACAACCCACCCCGAAAAACTGG + Intronic
974568414 4:63609920-63609942 CTCCCCCCACCGCACACAACAGG + Intergenic
976970566 4:91096791-91096813 CTCACCACAAAACAAAGAACAGG + Intronic
979052403 4:115951464-115951486 CTCACCACAAGACAAAGAACGGG - Intergenic
979513869 4:121584711-121584733 CTCAGCACACCCCCAAGAGCTGG + Intergenic
980093085 4:128462542-128462564 CTCCTCCCACCCTTAAGAACCGG + Intergenic
981947670 4:150367518-150367540 CACACCCCTCCCCCAAAAACAGG + Intronic
985025526 4:185736054-185736076 CCCACCCCACCCCTGAGACCTGG - Intronic
985545276 5:505915-505937 CTAACCCCACCCCAAAGTGAGGG - Intronic
985883991 5:2662099-2662121 CTCCTTCCACCCCAAAGATCTGG - Intergenic
987378648 5:17262409-17262431 CTCACACCTCCACAAATAACTGG + Intronic
988346374 5:30042302-30042324 CTCACTCCAGTCCACAGAACTGG - Intergenic
988561371 5:32284565-32284587 CTCCCACCACCCCAAAGAATAGG - Intronic
988936361 5:36086978-36087000 CCCACCCCACCCCAACTCACAGG + Intergenic
989245339 5:39248367-39248389 CTCTCCCCACCTCAAAGAACTGG - Intronic
992298362 5:75350593-75350615 CTGAAAACACCCCAAAGAACAGG - Intronic
994503107 5:100605404-100605426 CTCACCCCATCCCAAAGTGCTGG + Intergenic
995809136 5:116085198-116085220 CCCACCCCACCCCACTCAACCGG - Intronic
999244184 5:150144615-150144637 CTGCCCCCACCCCCAAGCACAGG - Intronic
1001194068 5:169655559-169655581 CTCACCACAACCCACAGGACAGG + Intronic
1003338223 6:5195185-5195207 CTCACCTCACCCTAGAGACCTGG + Intronic
1004428660 6:15523933-15523955 CTTGACCCAGCCCAAAGAACTGG + Intronic
1006216203 6:32445062-32445084 CCCACCGCCACCCAAAGAACTGG - Intergenic
1006831540 6:36971051-36971073 CTCACCTCACCCCACAGGCCAGG - Intronic
1007074706 6:39059094-39059116 CTCACCTCTCCCCAAGGAGCAGG + Intronic
1007752815 6:44080659-44080681 CTCCCCCCACCCCAGAGGCCAGG - Intergenic
1011544953 6:88473020-88473042 CTAAACCAACCCCAAAGAGCTGG + Intergenic
1013831334 6:114276107-114276129 CCCACCCCACCCCAAATAAAAGG + Intronic
1016395286 6:143617497-143617519 CTGACCCCACTCCAAAGTCCCGG - Intronic
1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG + Intergenic
1018519055 6:164623708-164623730 CTCACCCCACACCACAGATTTGG - Intergenic
1019731108 7:2630169-2630191 CCCACCCCACCCCAAATTTCTGG + Intergenic
1020638772 7:10729776-10729798 CTGACACTACCCCAATGAACAGG + Intergenic
1021267421 7:18541985-18542007 GGCACCCCACAACAAAGAACTGG - Intronic
1031936200 7:127738176-127738198 CTCCTCCCACCCCCAAGGACTGG + Intronic
1031949868 7:127881228-127881250 CTCACCCCTCCCCTATGAAAAGG + Intronic
1032192211 7:129771684-129771706 CTCACTCCACCCTAAAGGGCAGG - Intergenic
1032485354 7:132282991-132283013 CTCAGCCCCCCCCAAGTAACTGG + Intronic
1034329184 7:150268427-150268449 CTCACTCCTCCCCAAAGTAACGG + Intronic
1034668870 7:152841433-152841455 CTCACTCCTCCCCAAAGTAACGG - Intronic
1035397220 7:158542972-158542994 CTCACCGCACCCCAAAGACAGGG + Intronic
1035889023 8:3324210-3324232 CACACCCAACCCCAGAGACCCGG + Intronic
1037607828 8:20452492-20452514 CTCGTCCCACCCCAAACACCTGG - Intergenic
1038083956 8:24173266-24173288 CTCAGCACACCCCAAATCACTGG - Intergenic
1043395245 8:79829082-79829104 CTCACCCCTCCCTAGAGAAGAGG + Intergenic
1046982060 8:120346986-120347008 CTCACAACACACCAAAGATCTGG + Intronic
1047968435 8:130064619-130064641 CTCACCCCACCACCAAGCAGCGG + Intronic
1048612302 8:136036106-136036128 CTCTGACCACCCCAAAGAGCAGG + Intergenic
1048963574 8:139599202-139599224 ATCCCCCCACCCCAAGGAACTGG - Intergenic
1050386226 9:5093996-5094018 ATCACCACACACCCAAGAACAGG + Intronic
1050419716 9:5450683-5450705 CTCTCTCCATCCCAAAGAAAGGG - Intronic
1053308925 9:37002967-37002989 CTCCCCCCATCGCAGAGAACTGG - Intronic
1054825877 9:69572936-69572958 CTCTCCCCACCCCAAAACAAGGG - Intronic
1054842241 9:69755639-69755661 CTCCCACCCCCCAAAAGAACTGG + Intronic
1055816203 9:80209896-80209918 CACCCCCATCCCCAAAGAACAGG + Intergenic
1056568981 9:87799418-87799440 CTCATACCACCTCCAAGAACTGG + Intergenic
1057451691 9:95168266-95168288 CTCTTCCCCTCCCAAAGAACAGG + Intronic
1057479318 9:95432244-95432266 CTCACCCCAGCCCTCAGAACAGG + Intergenic
1060142468 9:121222020-121222042 CTCCTCCCATCCCAAAGGACTGG + Intronic
1060281845 9:122220336-122220358 CTAACCCCACCTCAAGGATCTGG - Intronic
1060400190 9:123344154-123344176 CACAACCCACCCCAAAGCTCAGG + Intergenic
1060972304 9:127745159-127745181 CGCACCCCTTCCCAAAGAACAGG + Intronic
1062347874 9:136123683-136123705 CCCACCCCACCCCAGAGACATGG - Intergenic
1062583403 9:137238008-137238030 CTGATCCCCCCCCAAAGGACAGG - Intergenic
1062652241 9:137583947-137583969 GTGACCCCACCACAAAGAGCCGG + Intronic
1062652261 9:137584037-137584059 GTGACCCCACCACAAAGAGCTGG + Intronic
1186891792 X:13966262-13966284 CTCACCCCTGCCCAAGGCACGGG + Intergenic
1187394280 X:18906441-18906463 CGCACCCCACCCCAACCACCCGG - Intronic
1188874446 X:35412802-35412824 CCCACCCCACCCCCAAAGACAGG - Intergenic
1188921255 X:35980443-35980465 TTCCCCAAACCCCAAAGAACAGG + Intronic
1190308416 X:49100079-49100101 CTCACCCCAGGGCAATGAACTGG + Intronic
1193753398 X:85375660-85375682 CACACCCCTCCCCACAGAACGGG + Intronic
1194947146 X:100082770-100082792 CTCACTCCATTCCAAAGAACTGG + Intergenic
1195011958 X:100741403-100741425 CCCACCCCACCCCTAAGCCCTGG + Intergenic
1196092659 X:111762756-111762778 CTCACCTCTCCCCCAACAACAGG - Intergenic
1196327680 X:114426974-114426996 CTCCACCCACCTCAAAGAAAAGG + Intergenic
1197854648 X:130902439-130902461 CTCTCCCCACTTCAAAGACCTGG + Intronic
1198531312 X:137551304-137551326 CTCCACACACCCCAAAGACCCGG + Intergenic
1198667675 X:139043129-139043151 CTTACCCCACCCCAAGGAGGAGG + Intronic
1199073832 X:143508694-143508716 CCCACCCCACACCAGACAACAGG + Intergenic
1199744729 X:150765334-150765356 CTGCCCCCACCCCAAAGGAAGGG + Intergenic
1200427185 Y:3034548-3034570 GTCACCCCACCCCCAACAATAGG - Intergenic
1201681037 Y:16643822-16643844 CTCACCACATAACAAAGAACAGG + Intergenic