ID: 1079245989

View in Genome Browser
Species Human (GRCh38)
Location 11:18752695-18752717
Sequence GTGGAGGCCCAGAAGTACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079245989 Original CRISPR GTGGAGGCCCAGAAGTACGA GGG Intronic
900243687 1:1628310-1628332 GTGGACGCCAAGAAGGAGGACGG + Exonic
901792542 1:11661917-11661939 GTGGAGCCCCAGAAGCTAGATGG + Exonic
902628723 1:17692121-17692143 GTGAAGGCTCAGAACTATGATGG - Intronic
903213978 1:21833113-21833135 GTGGAGGCCCAGAGGTCTGGGGG + Intronic
904018737 1:27444615-27444637 GTGGAGGCCAAGAAGTAGGTGGG + Intronic
916026454 1:160837645-160837667 GTGGAGACCCAGCAGCACGCAGG - Intronic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
1063199717 10:3776182-3776204 GTGGAGGCACAGAAGTGGCAGGG + Exonic
1064009797 10:11726687-11726709 GTGAAGGCCCTGAAGAAGGAAGG + Intergenic
1065351565 10:24800160-24800182 TTGGAGGACCAGAAATAAGAAGG - Intergenic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1069609716 10:69764814-69764836 GTGGCAGCCCAGAAGTGCCAGGG - Intergenic
1074981983 10:118627181-118627203 GGGGAGGCCCAGGAGTGGGATGG - Intergenic
1075158473 10:120001666-120001688 ATGGAGGCCAAGAAGTCCCATGG + Intergenic
1075714555 10:124548532-124548554 GTGGGGGCCCCGAGGTAGGAGGG - Intronic
1076228037 10:128796647-128796669 GTGGCTGCCCAGAGGCACGATGG - Intergenic
1076726008 10:132413666-132413688 CTGGAAGCCCGGAAGGACGATGG - Intronic
1079245989 11:18752695-18752717 GTGGAGGCCCAGAAGTACGAGGG + Intronic
1082759506 11:57113597-57113619 TTGGAAGCCAAGAAGTACTATGG - Intergenic
1089733468 11:120534108-120534130 GTGTGGGCCCAGAAGCACAAAGG + Intronic
1098659525 12:73075041-73075063 GTGGAGTCCAAGATGTAGGATGG + Intergenic
1099905955 12:88770176-88770198 GTGGAAGCCTATAAATACGAAGG + Intergenic
1100839489 12:98597856-98597878 GTGGACCCCCAAAAGTACAAGGG + Exonic
1101866586 12:108524873-108524895 GTGAAGGCACAGAAACACGAGGG - Intronic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1106006027 13:25770961-25770983 GTGGAGCCCCAGAACTGCAAAGG - Intronic
1106470207 13:30047505-30047527 GTGGATGCCCAAAGGTAGGAGGG + Intergenic
1114634742 14:24181156-24181178 GTGGTGGCCCAGAGGTACCCTGG + Intronic
1114696579 14:24632152-24632174 GTCGGGGCCCAGAAGTTCGTTGG - Intronic
1117571600 14:57054476-57054498 GCGAAGGCACAGAAGTATGATGG + Intergenic
1119586682 14:75842394-75842416 GAGGAGGCCGAGAAGCAGGAGGG + Intronic
1121492834 14:94372217-94372239 GTGGAGGGCCAGCAGCACCAAGG - Intergenic
1121979508 14:98442485-98442507 ATTGAGACCCAGAAGAACGATGG + Intergenic
1124186172 15:27531370-27531392 ATTGAGGCCCAAAAGTAGGAGGG + Intronic
1128803571 15:70513819-70513841 GAGGAGGCCCAGAAATCCCAGGG - Intergenic
1129457665 15:75684220-75684242 GTTGAGGCCCAGACGTGGGATGG - Intronic
1129726136 15:77902739-77902761 GTTGAGGCCCAGACGTGGGATGG + Intergenic
1137895868 16:52211591-52211613 GTGGAGGTCAAGATGTAGGAAGG + Intergenic
1143158224 17:4852528-4852550 GTGGAGACCCAGGAGTGAGAAGG + Intronic
1143253772 17:5540999-5541021 GAGGAGGCCCAGCAGGACCAGGG + Intronic
1143357401 17:6340599-6340621 GTGGAGGCCCACAAGCACTTGGG - Intergenic
1148382318 17:47209100-47209122 GTGGAAACCCAGAAGGACCAGGG - Exonic
1149983301 17:61328842-61328864 GTGAAGGCACAGAAAGACGATGG - Intronic
1160933144 19:1580214-1580236 GAGGGGGCCCAGAGGTACCACGG + Intronic
1163798234 19:19349390-19349412 GATGTGGCCCAGAAGCACGAGGG - Exonic
1166358076 19:42239208-42239230 GTTGAGTTCCAGAAGTAAGAGGG - Intronic
925961495 2:9021488-9021510 GTGAAGGCCAAGAAGTCCCATGG + Intergenic
928302864 2:30142114-30142136 GTGGAGGCCCAAATGTTCCAGGG + Intergenic
932910139 2:75797927-75797949 ATGGAGGCCCAGAAGTCCCACGG + Intergenic
937267180 2:120623863-120623885 GCGGAGGACCTGAAGTAAGATGG - Intergenic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
946452743 2:219794976-219794998 TTGGAGACCCAGAAGTACCTGGG - Intergenic
947280657 2:228450090-228450112 GTAGAGACACAGAAGTAAGATGG + Intergenic
1169648905 20:7845171-7845193 GTGAAGGGCCAGAAGTAAGTAGG - Intergenic
1172856654 20:38009471-38009493 GGGAAGGCCCAGAAGGAAGAAGG - Intronic
1177031972 21:15992162-15992184 GTGGAGGCTGAGAAGTCCCAAGG + Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183591526 22:38781870-38781892 GTGGAGGCCCAGAGCGATGAGGG - Intronic
955761933 3:62294947-62294969 CTGGAGGACCAGAAGTGCTAAGG + Exonic
961724708 3:128919832-128919854 CTGGAGGCCTAGAGGTACCAGGG - Intronic
967096342 3:186180446-186180468 AGGGAGCCCCAGAAGTACTATGG - Intronic
969494081 4:7515953-7515975 ATGGAGGCCCAGAAGTCTCAAGG + Intronic
971364371 4:25965834-25965856 GTGGAGCCACAGAAGTTCGCGGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972817900 4:42665017-42665039 GTGGAGGCCCAGAAATATTTGGG - Intergenic
973789586 4:54365764-54365786 GAGCAGGCCCAGAAGTCCCAGGG + Intergenic
975079998 4:70265679-70265701 GTGTATACCCAGAAGTAGGATGG - Intergenic
976593308 4:86870851-86870873 GTGGAAGCCCAGAAACAGGAAGG + Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
982164443 4:152602313-152602335 GTAGAGGACCAGAAATTCGAGGG + Intergenic
985472062 5:52896-52918 GTGGAGGCGCAGTAGTGCTAGGG - Intergenic
986233282 5:5885882-5885904 GTGGTGGCCCAGAAGGCTGATGG - Intergenic
988322132 5:29712522-29712544 GTGGAGGCACAGAGGTACACAGG + Intergenic
988787438 5:34577939-34577961 GTGGAGGCTGAGAAGTCCCACGG - Intergenic
994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994486518 5:100390370-100390392 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994486855 5:100392008-100392030 GCTGAGGCCCAGAAATATGAGGG - Intergenic
995329013 5:110925868-110925890 GTTGAGGATCAGAAGTAGGATGG - Intergenic
1000971582 5:167720784-167720806 GTGGAAGCCCAGAGGAAGGAAGG + Intronic
1002339498 5:178505756-178505778 ATGGAGGCCCAGGAGGACTATGG + Intronic
1002382220 5:178839142-178839164 CTGGAGGCCCTGAAGTAGCAAGG + Intergenic
1004910304 6:20276672-20276694 GTGGAGGCCCGGAAAGACAAGGG + Intergenic
1006025363 6:31143317-31143339 GAGGAGGCCCGGAAGGAGGAGGG - Exonic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1012526073 6:100179124-100179146 GAGGAGACCCAGAGGTCCGAGGG - Intergenic
1015638370 6:135303643-135303665 TTGGAGGCCCAGAGTTACCAAGG + Intronic
1015898089 6:138036243-138036265 CTGGAGGCCTAGGAGTATGACGG - Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1019215925 6:170443755-170443777 GTGGAGGCACAGAAGTCTGGAGG - Intergenic
1023542093 7:41276431-41276453 GTAGAGGCCCAGATGTGTGAAGG - Intergenic
1023789602 7:43742928-43742950 GTAGATTCCCAGAAGTAGGATGG - Intergenic
1025148175 7:56523136-56523158 ATGGAGGCCAAGGAGTACTAAGG + Intergenic
1031365538 7:120896001-120896023 GTGGAGGGTCAGAAGTAGGTGGG - Intergenic
1031365701 7:120898168-120898190 GTGGAGGGTCAGAAGTAGGTGGG - Intergenic
1035304368 7:157921736-157921758 GTGGAGGCTGGGAAGTCCGAGGG - Intronic
1036085467 8:5608539-5608561 GTGCTGGCCCAGGAGGACGAGGG + Intergenic
1036645085 8:10607754-10607776 GGGGAGGCCCAGAAGGCAGAAGG - Exonic
1040137698 8:43874438-43874460 GTGGGGTCCCAAAAGTACCATGG - Intergenic
1042699828 8:71600122-71600144 GTGGCTGCTCAGAAGTAGGAAGG + Intergenic
1042750588 8:72153709-72153731 GTGGAGCCCCAGGAGAAGGAAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1046366985 8:113246981-113247003 GTGGAGGACCAGAAGTAGTAAGG + Intronic
1046494960 8:115001181-115001203 GTGAAGGCCCAGAATTATTACGG + Intergenic
1048329968 8:133464687-133464709 GTGGAGGCACAGCAGGACCACGG + Intronic
1049569558 8:143362793-143362815 ATGGAGGCTCAGAAGACCGAAGG - Intergenic
1051123474 9:13777353-13777375 TTGGGGGCCCACAAGTATGAGGG - Intergenic
1052169060 9:25371726-25371748 GTGGAGTCCCTGAAGTCCAAAGG + Intergenic
1056269243 9:84930506-84930528 GTGTAAGCCCTGAAGTACCAGGG + Intronic
1058876616 9:109250214-109250236 ACGGAGGCCCAGAAGTAGGAAGG + Intronic
1062605569 9:137347175-137347197 GTGGAAGTCCAGAAGTCCGGTGG + Intronic
1185515913 X:698955-698977 GTGGGGGCCCAGTGGTAAGAAGG + Intergenic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1188295106 X:28437566-28437588 GTGGAAGTCCAGAGGTAGGAAGG - Intergenic
1192043590 X:67648533-67648555 GGGGAGGCCCAGAATTAAGCCGG - Intronic
1192937224 X:75872780-75872802 GTGGAGGACCAAAAGTTCCAGGG + Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1201672048 Y:16533941-16533963 GTGGATACCCAGTAGTAGGATGG + Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic