ID: 1079246032

View in Genome Browser
Species Human (GRCh38)
Location 11:18753023-18753045
Sequence AGGGATTGCCTGTGGATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079246028_1079246032 21 Left 1079246028 11:18752979-18753001 CCTCTAGTTCAGCTCTCTCATTA 0: 1
1: 0
2: 2
3: 13
4: 141
Right 1079246032 11:18753023-18753045 AGGGATTGCCTGTGGATATCTGG 0: 1
1: 0
2: 1
3: 11
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079246032 Original CRISPR AGGGATTGCCTGTGGATATC TGG Intronic
902981870 1:20129228-20129250 AGGGATTGCGTGTGCATACCTGG - Intergenic
904471620 1:30740000-30740022 AGGGGATGCATGAGGATATCAGG - Intronic
910199268 1:84681831-84681853 AGGGAATGTCTGTGGGAATCTGG + Intronic
913931735 1:124975912-124975934 AGGATTTGCAAGTGGATATCTGG - Intergenic
915807883 1:158873663-158873685 AGAGATTGCTTGTGGATAGTTGG - Intergenic
917579655 1:176362618-176362640 AGGGACTGACTGTGGAGACCAGG + Intergenic
917981777 1:180274009-180274031 TGGGTTGGCCTCTGGATATCAGG + Intronic
919947021 1:202327053-202327075 GGGGAGAGCCTGTGGATCTCCGG - Intergenic
920390451 1:205597107-205597129 AGGGCTAGCCTCAGGATATCAGG + Intronic
921796434 1:219350222-219350244 AGGGCATGCATGTGGATCTCAGG - Intergenic
922974816 1:229775434-229775456 AGGTATTGCCTGTGGAGCTTGGG + Intergenic
923683059 1:236134900-236134922 AGGGAGAGCCTGTGCATTTCTGG + Intergenic
923768524 1:236915651-236915673 AGTGACTGCCAGTGGGTATCAGG + Intergenic
1063701372 10:8388205-8388227 AGGGAGTGCCTGTGGTTAAGGGG + Intergenic
1064240821 10:13626720-13626742 AAGGGTTGCCTGTGGAGAGCTGG + Intronic
1066125456 10:32337423-32337445 AGGGACACCCTGTGAATATCTGG + Intronic
1066657497 10:37709841-37709863 GGGGATTTCCTGTAGAAATCTGG + Intergenic
1066823944 10:39538018-39538040 AGTGTTTGCATGTGGATATTTGG + Intergenic
1070158067 10:73848533-73848555 ATGGAAAACCTGTGGATATCTGG - Exonic
1071815961 10:89232926-89232948 AGGAATGGCCTGTGGACAGCTGG + Intronic
1074288203 10:112118422-112118444 ATCCTTTGCCTGTGGATATCCGG + Intergenic
1074902144 10:117826986-117827008 AGGGACTTCCTGTGTATGTCAGG - Intergenic
1074957544 10:118407112-118407134 TCAGATTCCCTGTGGATATCAGG + Intergenic
1076611645 10:131729667-131729689 TAGGATTGTCTGTGGATAACAGG - Intergenic
1078671693 11:13371370-13371392 TGGGATTTGCTGTGAATATCAGG - Intronic
1079149912 11:17888570-17888592 AGAGAAACCCTGTGGATATCAGG + Intronic
1079246032 11:18753023-18753045 AGGGATTGCCTGTGGATATCTGG + Intronic
1081300151 11:41441376-41441398 AGGGACTTCCTCTGGATATGAGG + Intronic
1081693792 11:45095349-45095371 AGGGGATGCCTGGGGAGATCAGG - Intergenic
1082156602 11:48826672-48826694 AGTAATTGCCAGTGGATATTTGG + Intergenic
1085048461 11:73367137-73367159 AGGAAGTGGCTGTGGAAATCAGG + Intronic
1089097625 11:115932352-115932374 AGGGCTGGCCTGTGGCTTTCAGG - Intergenic
1093975899 12:25421784-25421806 AGTGATGTCATGTGGATATCAGG - Intronic
1095032398 12:37308012-37308034 AGAAACTGCCTGTGGATATTTGG + Intergenic
1099129515 12:78809643-78809665 AGGGAATTCCTGTGGTTTTCTGG + Intergenic
1102030520 12:109737665-109737687 AGGGCTTGGCTGTGGATAAGGGG - Intronic
1103950027 12:124545466-124545488 AGGGATTGGGTGTGGACACCAGG - Intronic
1104097903 12:125576355-125576377 ATGGTTTGCTTGTGGATTTCTGG + Intronic
1104558710 12:129824918-129824940 AGGGATGGCCCCTGGATAACTGG + Intronic
1108119353 13:47166459-47166481 AGTGATTGCCTGTGGGTGGCGGG + Intergenic
1108784019 13:53872587-53872609 AGGTGTTGCTTGTGGATTTCAGG + Intergenic
1113893300 13:113747909-113747931 AGAGATTGCATCTGGAAATCAGG + Intergenic
1114036970 14:18638343-18638365 AGGGATTGCCAGTGAAATTCTGG + Intergenic
1114121670 14:19676701-19676723 AGGGATTGCCAGTGAAATTCTGG - Intergenic
1114849401 14:26365520-26365542 TGGAATTGCCTGGGGATATTGGG + Intergenic
1115335719 14:32242774-32242796 GGAGATTCCTTGTGGATATCAGG + Intergenic
1117767543 14:59098616-59098638 AGGGATTGCCTTTGCGTAGCAGG - Intergenic
1125385274 15:39130400-39130422 AGAGATTCCCTGTGGATCACTGG - Intergenic
1127216089 15:56824370-56824392 AGGGAATGCCTGTGGCTAGATGG + Intronic
1127923596 15:63515861-63515883 AGAGATTGTCTGTGGACAGCAGG - Intronic
1132639688 16:972103-972125 AGGGACTGACTGTGGACATCGGG + Intronic
1133169111 16:3969968-3969990 AGTGATTGCCTCTGGATGGCAGG - Intronic
1133977868 16:10612942-10612964 AGGGATTGGCTGTGGGTCTTTGG - Intergenic
1134345696 16:13389234-13389256 AGGGGTTGCCAGAGGATAGCAGG - Intergenic
1137056863 16:35750136-35750158 AGGGACTGCCTGGGGATACCAGG + Intergenic
1137591196 16:49695013-49695035 AGGGACTGGCTGTGGGTCTCAGG - Intronic
1138708237 16:58939655-58939677 AGGAATTGCATGTGCATAACTGG + Intergenic
1140805372 16:78527758-78527780 AGGGAATGCATGTCAATATCTGG + Intronic
1141946517 16:87314486-87314508 AGTGGTTGCCTGGGGATGTCAGG + Intronic
1145687559 17:26689537-26689559 AGGAACTGCATGTGGATATTTGG + Intergenic
1146553509 17:33802993-33803015 AAGCATTGCCTTTGGATAGCTGG + Intronic
1148446613 17:47741730-47741752 AGGAACTGCCTGTGGAGAGCTGG + Intronic
1151289732 17:73141048-73141070 ACAGATTGCCTGTGGACTTCAGG + Intergenic
1151990258 17:77570133-77570155 AGGGCCTGGCTGGGGATATCTGG + Intergenic
1152275291 17:79353028-79353050 AGGGACTGCCTCGGGACATCAGG + Intronic
1152491863 17:80640497-80640519 AGGGATTCCCAGTGGATAGGCGG + Intronic
1158867181 18:61649133-61649155 CAGGATTGGCTGTGGATTTCAGG - Intergenic
1160973028 19:1778273-1778295 AGGGATTTCTTGTAGATATGGGG + Exonic
1167002134 19:46751958-46751980 GTGGATCGCCTGTGGCTATCTGG + Intronic
1168409147 19:56127725-56127747 AGGGAATGCCTGTGGCTACCTGG - Intergenic
931761520 2:65421469-65421491 AGGGATTCCCTGGGGAAATCTGG - Intronic
933585701 2:84177516-84177538 AGGACTTGTCTGTGGATTTCTGG - Intergenic
934470815 2:94532285-94532307 AGAATTTGCCTGTGGATATTTGG - Intergenic
935400404 2:102654144-102654166 AGTGATTGCATTTGGATATTAGG + Intronic
936328233 2:111523842-111523864 ATGGCTTGCCTGTGGAAAGCAGG - Intergenic
936926658 2:117743880-117743902 ACAGATTTCCTGTGGATGTCTGG - Intergenic
938441546 2:131339184-131339206 AGGGATTGCCAGTGAAATTCTGG + Intronic
942430231 2:175903092-175903114 AGGCATTGCCTCTAGATCTCTGG - Intergenic
945071874 2:205998846-205998868 AGGGATTCCTTGTGGAAATTAGG - Exonic
945888110 2:215398753-215398775 AAGGTTTCCCTGTGGATATCTGG - Intronic
1169761260 20:9097351-9097373 AGGGAGTGCCTGTGGAGACTGGG + Intronic
1171574660 20:26294849-26294871 AGGGTTTGCAAGTGGATATTTGG + Intergenic
1171723498 20:28592069-28592091 AGGCATTGCCTCTGGAAAGCAGG - Intergenic
1171754558 20:29090998-29091020 AGGCATTGCCTCTGGAAAGCAGG + Intergenic
1171788095 20:29491548-29491570 AGGCATTGCCTCTGGAAAGCAGG - Intergenic
1171859845 20:30387859-30387881 AGGCATTGCCTCTGGAAAGCAGG + Intronic
1175602794 20:60288603-60288625 AGGGATTGCCTCTGGATGGATGG + Intergenic
1176666669 21:9693953-9693975 AGGAAATGCCAGTTGATATCTGG - Intergenic
1180297060 22:10950751-10950773 AGGCATTGCCTCTGGAAAGCAGG - Intergenic
1180411553 22:12614814-12614836 AGGCATTGCCTCTGGAAAGCAGG + Intergenic
1180461094 22:15565391-15565413 AGGGATTGCCAGTGAAATTCTGG + Intergenic
1180504322 22:15979189-15979211 AGAGTCTGCCTGTGGATATTTGG + Intergenic
1182086550 22:27565064-27565086 AGAGTTTGCCTGTGGGTTTCTGG + Intergenic
1203334257 22_KI270739v1_random:43323-43345 AGAGTCTGCCTGTGGATATTTGG - Intergenic
949775139 3:7624310-7624332 AGGGATGCCATGTGGACATCAGG + Intronic
950236890 3:11330115-11330137 AAGGATGTCATGTGGATATCAGG - Intronic
961452328 3:127008006-127008028 AGGGAGCACCTGTGGATGTCTGG + Intronic
962450496 3:135512331-135512353 AGTGGTTGCCTGTGGACAACAGG + Intergenic
963393382 3:144699007-144699029 AAGAATTACCTGTGGATGTCTGG + Intergenic
964513542 3:157479717-157479739 AGTGATTGCCTGTGAAGAGCTGG - Intronic
965339744 3:167474525-167474547 AGGAGTTTCCTGTGGATATAAGG + Intronic
965688574 3:171331249-171331271 AGGGAGTGGCTGTGGATCTGGGG - Intronic
966845645 3:184127590-184127612 AGGGCTGGTCTGTGCATATCTGG + Intergenic
969449392 4:7264504-7264526 TGTGATTTCCTGTGGATAGCCGG - Intronic
972798804 4:42450336-42450358 AGTGATTGCCAATGGATATGGGG + Intronic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
977644067 4:99391538-99391560 ATTTTTTGCCTGTGGATATCCGG - Intergenic
982488492 4:155998847-155998869 AGGGATGGCCTGTGGATACTGGG + Intergenic
982713126 4:158778761-158778783 AGGTATCGCCTGTGGATAAGAGG + Intronic
985408349 4:189658388-189658410 AGGAAATGCCAGTTGATATCTGG + Intergenic
985571377 5:647426-647448 AGGGAGGGCCTGTGGGTTTCGGG - Intronic
988977838 5:36533050-36533072 AGTGGTTGCCTGGGGATTTCGGG + Intergenic
989881861 5:46800498-46800520 AGAATCTGCCTGTGGATATCTGG + Intergenic
989882204 5:46807313-46807335 AGAATCTGCCTGTGGATATCTGG + Intergenic
989882563 5:46814471-46814493 AGAATCTGCCTGTGGATATCTGG + Intergenic
989882837 5:46819755-46819777 AGAATCTGCCTGTGGATATCTGG + Intergenic
989883158 5:46825888-46825910 AGGATCTGCTTGTGGATATCTGG + Intergenic
989883339 5:46829641-46829663 AGAATCTGCCTGTGGATATCTGG + Intergenic
989883449 5:46831515-46831537 AGGATCTGCTTGTGGATATCTGG + Intergenic
989883642 5:46835612-46835634 AGAATCTGCCTGTGGATATCTGG + Intergenic
989883751 5:46837486-46837508 AGGATCTGCTTGTGGATATCTGG + Intergenic
989883909 5:46840897-46840919 AGAATCTGCCTGTGGATATCTGG + Intergenic
989884018 5:46842771-46842793 AGGATCTGCTTGTGGATATCTGG + Intergenic
989884175 5:46846181-46846203 AGAATCTGCCTGTGGATATCTGG + Intergenic
989884437 5:46851462-46851484 AGAATCTGCCTGTGGATATCTGG + Intergenic
989884543 5:46853336-46853358 AGGATCTGCTTGTGGATATCTGG + Intergenic
989884712 5:46856917-46856939 AGAATCTGCCTGTGGATATCTGG + Intergenic
989884821 5:46858791-46858813 AGGATCTGCTTGTGGATATCTGG + Intergenic
989885083 5:46863904-46863926 AGGATCTGCTTGTGGATATCTGG + Intergenic
989885186 5:46866118-46866140 AGAATCTGCCTGTGGATATCTGG + Intergenic
989885295 5:46867993-46868015 AGGATCTGCTTGTGGATATCTGG + Intergenic
989885464 5:46871574-46871596 AGAATCTGCCTGTGGATATCTGG + Intergenic
989885572 5:46873448-46873470 AGGATCTGCTTGTGGATATCTGG + Intergenic
989885853 5:46878902-46878924 AGGATCTGCTTGTGGATATCTGG + Intergenic
989886022 5:46882484-46882506 AGAATCTGCCTGTGGATATCTGG + Intergenic
989886130 5:46884358-46884380 AGGATCTGCTTGTGGATATCTGG + Intergenic
989886298 5:46887939-46887961 AGAATCTGCCTGTGGATATCTGG + Intergenic
989886412 5:46889813-46889835 AGGATCTGCTTGTGGATATCTGG + Intergenic
989886636 5:46894244-46894266 AGGATCTGCTTGTGGATATCTGG + Intergenic
989886737 5:46896459-46896481 AGAATCTGCCTGTGGATATCTGG + Intergenic
989886849 5:46898332-46898354 AGGATCTGCTTGTGGATATCTGG + Intergenic
989886987 5:46901232-46901254 AGAATCTGCCTGTGGATATCTGG + Intergenic
989887096 5:46903106-46903128 AGGATCTGCTTGTGGATATCTGG + Intergenic
989887268 5:46906687-46906709 AGAATCTGCCTGTGGATATCTGG + Intergenic
989887377 5:46908561-46908583 AGGATCTGCTTGTGGATATCTGG + Intergenic
989887537 5:46911971-46911993 AGAATCTGCCTGTGGATATCTGG + Intergenic
989887645 5:46913846-46913868 AGGATCTGCTTGTGGATATCTGG + Intergenic
989887804 5:46917256-46917278 AGAATCTGCCTGTGGATATCTGG + Intergenic
989888013 5:46921345-46921367 AGAATCTGCCTGTGGATATCTGG + Intergenic
989888205 5:46925269-46925291 AGAATCTGCCTGTGGATATCTGG + Intergenic
989888414 5:46929359-46929381 AGAATCTGCCTGTGGATATCTGG + Intergenic
989888522 5:46931234-46931256 AGGATCTGCTTGTGGATATCTGG + Intergenic
989888693 5:46934815-46934837 AGAATCTGCCTGTGGATATCTGG + Intergenic
989888912 5:46939074-46939096 AGAATCTGCCTGTGGATATCTGG + Intergenic
989889021 5:46940947-46940969 AGGATCTGCTTGTGGATATCTGG + Intergenic
989889190 5:46944528-46944550 AGAATCTGCCTGTGGATATCTGG + Intergenic
989889299 5:46946402-46946424 AGGATCTGCTTGTGGATATCTGG + Intergenic
989889467 5:46949983-46950005 AGAATCTGCCTGTGGATATCTGG + Intergenic
989889734 5:46955265-46955287 AGAATCTGCCTGTGGATATCTGG + Intergenic
989889841 5:46957140-46957162 AGGATCTGCTTGTGGATATCTGG + Intergenic
989890105 5:46962601-46962623 AGAATCTGCCTGTGGATATCTGG + Intergenic
989890231 5:46965156-46965178 AGAATCTGCCTGTGGATATCTGG + Intergenic
989890424 5:46969076-46969098 AGAATCTGCCTGTGGATATCTGG + Intergenic
989890535 5:46970950-46970972 AGGATCTGCTTGTGGATATCTGG + Intergenic
989890639 5:46973165-46973187 AGAATCTGCCTGTGGATATCTGG + Intergenic
989890913 5:46978623-46978645 AGAATCTGCCTGTGGATATCTGG + Intergenic
989891022 5:46980497-46980519 AGGATCTGCTTGTGGATATCTGG + Intergenic
989891133 5:46982882-46982904 AGAATCTGCCTGTGGATATCTGG + Intergenic
989891266 5:46985607-46985629 AGAATCTGCCTGTGGATATCTGG + Intergenic
989891499 5:46990209-46990231 AGAATCTGCCTGTGGATATCTGG + Intergenic
989891610 5:46992082-46992104 AGGATCTGCTTGTGGATATCTGG + Intergenic
989891772 5:46995494-46995516 AGAATCTGCCTGTGGATATCTGG + Intergenic
989891834 5:46996687-46996709 AGAATCTGCCTGTGGATATCTGG + Intergenic
989891944 5:46998561-46998583 AGGATCTGCTTGTGGATATCTGG + Intergenic
989892111 5:47002143-47002165 AGAATCTGCCTGTGGATATCTGG + Intergenic
989892220 5:47004017-47004039 AGGATCTGCTTGTGGATATCTGG + Intergenic
989892350 5:47006744-47006766 AGAATCTGCCTGTGGATATCTGG + Intergenic
989892460 5:47008618-47008640 AGGATCTGCTTGTGGATATCTGG + Intergenic
989892631 5:47012199-47012221 AGAATCTGCCTGTGGATATCTGG + Intergenic
989892744 5:47014073-47014095 AGGATCTGCTTGTGGATATCTGG + Intergenic
989892847 5:47016289-47016311 AGAATCTGCCTGTGGATATCTGG + Intergenic
989893038 5:47020210-47020232 AGAATCTGCCTGTGGATATCTGG + Intergenic
989893141 5:47022083-47022105 AGGATCTGCTTGTGGATATCTGG + Intergenic
989893310 5:47025665-47025687 AGAATCTGCCTGTGGATATCTGG + Intergenic
989893456 5:47028392-47028414 AGAATCTGCCTGTGGATATCTGG + Intergenic
989893742 5:47033599-47033621 AGAATCTGCCTGTGGATATCTGG + Intergenic
989893852 5:47035472-47035494 AGGATCTGCTTGTGGATATCTGG + Intergenic
989894064 5:47039565-47039587 AGGATCTGCTTGTGGATATCTGG + Intergenic
989894172 5:47041951-47041973 AGAATCTGCCTGTGGATATCTGG + Intergenic
989894453 5:47047406-47047428 AGAATCTGCCTGTGGATATCTGG + Intergenic
989894562 5:47049279-47049301 AGGATCTGCTTGTGGATATCTGG + Intergenic
989894725 5:47052689-47052711 AGAATCTGCCTGTGGATATCTGG + Intergenic
989894833 5:47054563-47054585 AGGATCTGCTTGTGGATATCTGG + Intergenic
989895148 5:47060700-47060722 AGAATCTGCCTGTGGATATCTGG + Intergenic
989895280 5:47063187-47063209 AGAATCTGCCTGTGGATATCTGG - Intergenic
989895488 5:47067277-47067299 AGAATCTGCCTGTGGATATCTGG - Intergenic
989895619 5:47074438-47074460 AGAATCTGCCTGTGGATATCTGG - Intergenic
989895749 5:47076996-47077018 AGAATCTGCCTGTGGATATCTGG - Intergenic
989897368 5:47108962-47108984 AGAATCTGCCTGTGGATATCTGG + Intergenic
989897591 5:47113050-47113072 AGAATCTGCCTGTGGATATCTGG + Intergenic
989897812 5:47117140-47117162 AGAATCTGCCTGTGGATATCTGG + Intergenic
989898113 5:47122764-47122786 AGAATCTGCCTGTGGATATCTGG + Intergenic
989898334 5:47126854-47126876 AGAATCTGCCTGTGGATATCTGG + Intergenic
989898555 5:47130943-47130965 AGAATCTGCCTGTGGATATCTGG + Intergenic
989898990 5:47139121-47139143 AGAATCTGCCTGTGGATATCTGG + Intergenic
989899207 5:47143038-47143060 AGAATCTGCCTGTGGATATCTGG + Intergenic
989899432 5:47147127-47147149 AGAATCTGCCTGTGGATATCTGG + Intergenic
989899656 5:47151218-47151240 AGAATCTGCCTGTGGATATCTGG + Intergenic
989908034 5:47289699-47289721 AAAGTTTGCCTGTGGATATTTGG + Intergenic
989913760 5:49694550-49694572 AGGATCTGCATGTGGATATCAGG + Intergenic
990195621 5:53311761-53311783 AGGTATTGCCTTCTGATATCTGG - Intergenic
990764950 5:59171610-59171632 ATGGAATGCCTGTCCATATCAGG - Intronic
992122621 5:73610266-73610288 AGGGGTTGCCTGTGGTTATCAGG - Intergenic
992656978 5:78920544-78920566 AGGTATGGCCTGTGGCTAGCAGG - Intronic
994115249 5:96054571-96054593 AGTGATTTCCTGTGGAAATTTGG + Intergenic
998795683 5:145816041-145816063 AAGGATTGGTTGTGGATATGTGG - Intronic
1202771295 5_GL000208v1_random:18-40 AGAATCTGCCTGTGGATATCTGG - Intergenic
1004339684 6:14797603-14797625 ATGGCTTGCCTGTGTATTTCAGG + Intergenic
1005258682 6:24033297-24033319 ATGAATTCACTGTGGATATCAGG - Intergenic
1005910502 6:30305300-30305322 AGGGATTGCTTCTGGTTCTCTGG - Intergenic
1006927309 6:37664203-37664225 AGGAATGGCCTGGGGAGATCTGG - Intronic
1010563024 6:77374111-77374133 AAGGTTTGCCTCTGGTTATCTGG - Intergenic
1011177073 6:84575520-84575542 AGAGATTTCCTGTGGTTAACTGG + Intergenic
1011384048 6:86775047-86775069 TGGGATTATCTGTGGGTATCAGG - Intergenic
1017745834 6:157446294-157446316 ATGGATTGCATGTGGCTATGTGG - Intronic
1018357026 6:163028490-163028512 AGGGCTTGCTTCTGGATCTCAGG + Intronic
1020033699 7:4951077-4951099 GGGAGTTGCCTGTGGACATCAGG - Intronic
1024876367 7:54028737-54028759 TGGGTTTGCCTGTGCATATCTGG - Intergenic
1027430477 7:78107151-78107173 ATGAATTCCCTGTGGATATCTGG + Intronic
1031963432 7:128009981-128010003 AGGGAATGGCTTTGGATCTCTGG + Intronic
1032166067 7:129545950-129545972 AGGGATTGCCTCTGGGTGGCAGG - Intergenic
1034102053 7:148458394-148458416 AGGGAATGCCTGGGGCTACCAGG + Intergenic
1035053364 7:156017521-156017543 AGGCATTGCTTGTGGATCTAAGG - Intergenic
1035054168 7:156022842-156022864 AGGGATGGCTGGTGGAGATCGGG + Intergenic
1036396739 8:8377058-8377080 AGGCATTACCTGTGCATACCTGG + Exonic
1036762580 8:11519916-11519938 AGAGATTGCCTCTGGGTATTGGG + Intronic
1038840868 8:31183570-31183592 GGGGTTTGCCTGTGGTTATCTGG - Intergenic
1042285965 8:67110557-67110579 AGGGACCTCCTGTGGATTTCTGG + Intronic
1046367369 8:113253184-113253206 AGGGATTGGCTGGGGACATCAGG + Intronic
1046921232 8:119731629-119731651 GGGGACTGCCAGTGGATATGAGG + Exonic
1047338477 8:123957860-123957882 AGGGCTGGCCTGTGGACAGCAGG - Intronic
1047510780 8:125513669-125513691 AGGGGTGGCCTCTGGATTTCTGG - Intergenic
1049491984 8:142909994-142910016 AGGGATTGTCTCTGGCTGTCTGG - Intronic
1052638246 9:31130289-31130311 AGGGATTGCCTCTGGGCAGCAGG + Intergenic
1053201311 9:36153388-36153410 AGGCACTGCCTGTTGGTATCTGG - Intronic
1053726601 9:41008283-41008305 AGGCATTGCCTCTGGAAAGCAGG + Intergenic
1054339339 9:63843522-63843544 AGGCATTGCCTCTGGAAAGCAGG - Intergenic
1057897878 9:98924327-98924349 AGGGGTTCCCTGTGGCTAACAGG - Intergenic
1059726393 9:117012601-117012623 AGGCATTGTCTTTGGATATAAGG + Intronic
1060855777 9:126914477-126914499 AGGGATTTACGGGGGATATCGGG + Intergenic
1062028792 9:134352689-134352711 AGGGCTTGCCTGGGACTATCTGG + Intronic
1202803911 9_KI270720v1_random:31948-31970 AGGCATTGCCTCTGGAAAGCAGG - Intergenic
1203448711 Un_GL000219v1:88996-89018 AGGCATTGCCTCTGGAAAGCAGG - Intergenic
1203659430 Un_KI270753v1:27808-27830 AGGAAATGCCAGTTGATATCTGG + Intergenic
1188548687 X:31338130-31338152 AGTCATTGGCTGTGGATTTCTGG - Intronic
1189556361 X:42149514-42149536 TGGGCTTGCCTGTGGTTATATGG + Intergenic
1190300624 X:49054920-49054942 AGGGATGGCAAGTGGATATTAGG - Intronic
1193202605 X:78709655-78709677 AGTGATTGCCTCTGGAAAGCAGG - Intergenic
1194211647 X:91077213-91077235 AGGGATTGGATGTGGGCATCAGG + Intergenic
1197358608 X:125468996-125469018 TGGGATTGCCTATGGAAACCTGG + Intergenic
1200078741 X:153565194-153565216 AGGGTTTCCCTGTGGGTGTCGGG - Intronic
1201486374 Y:14498676-14498698 AGGGATATCCTGTGCATTTCAGG - Intergenic