ID: 1079249158

View in Genome Browser
Species Human (GRCh38)
Location 11:18774507-18774529
Sequence TACTCTGAGGAGGAGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 512}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079249145_1079249158 18 Left 1079249145 11:18774466-18774488 CCAAAGGTCCAGTATGAACTGAA 0: 1
1: 0
2: 1
3: 10
4: 107
Right 1079249158 11:18774507-18774529 TACTCTGAGGAGGAGGGGGCTGG 0: 1
1: 0
2: 4
3: 43
4: 512
1079249147_1079249158 -9 Left 1079249147 11:18774493-18774515 CCAGCTTCCCCCTGTACTCTGAG 0: 1
1: 0
2: 2
3: 32
4: 275
Right 1079249158 11:18774507-18774529 TACTCTGAGGAGGAGGGGGCTGG 0: 1
1: 0
2: 4
3: 43
4: 512
1079249146_1079249158 10 Left 1079249146 11:18774474-18774496 CCAGTATGAACTGAATTTACCAG 0: 1
1: 0
2: 0
3: 8
4: 195
Right 1079249158 11:18774507-18774529 TACTCTGAGGAGGAGGGGGCTGG 0: 1
1: 0
2: 4
3: 43
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079249158 Original CRISPR TACTCTGAGGAGGAGGGGGC TGG Intronic
900222214 1:1515184-1515206 TACTCTGAGGCTGAGGTGGGAGG - Intronic
900320381 1:2080625-2080647 TACGCTGACCAGGAGGGAGCAGG - Intronic
900932487 1:5746029-5746051 GACCCTAAGGAGGAGGGCGCTGG + Intergenic
902776218 1:18676554-18676576 TCCTCTTAGGAGAAGGGGGTGGG - Intronic
903391987 1:22971215-22971237 CATTTTGAGGAGGAGGGGGGTGG - Intergenic
903605063 1:24569420-24569442 AAGTCTGGGGAGGAGGGGGTGGG - Intronic
903857242 1:26344520-26344542 TCCACTGAGGAAGATGGGGCAGG + Exonic
904474164 1:30754104-30754126 CACTCTGGGGAAGAGGGGTCAGG + Intronic
904607337 1:31705007-31705029 AGCTCTGAGGAGGAAGGAGCCGG + Intergenic
905044293 1:34984215-34984237 AAATCCCAGGAGGAGGGGGCTGG + Intronic
905300959 1:36985926-36985948 CACAGTGAGGAGGAGGGGGAGGG - Intronic
905708664 1:40082070-40082092 CATTTTGAGGAGGTGGGGGCTGG - Intronic
906240876 1:44241498-44241520 TACTCAGAGGAGTAATGGGCTGG - Intronic
906983043 1:50652070-50652092 TGCTCTGGGGAGGTGTGGGCAGG + Intronic
907228157 1:52969059-52969081 TAGGCTGAGGAGGAAGGGGAAGG + Intronic
907317817 1:53583729-53583751 TATTGCGAGGAGGAGGGGCCGGG + Intronic
907663874 1:56417353-56417375 GCCTCTGAGTGGGAGGGGGCAGG - Intergenic
907947728 1:59151144-59151166 TCCTCTGGGGAGGAAGGGGAGGG + Intergenic
908489943 1:64633440-64633462 TACGCTGAGGAGGAGAGGGGTGG + Intronic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
910077442 1:83297914-83297936 TACTTTGAGAAGGAGGGAGCTGG + Intergenic
911713444 1:101101280-101101302 TACTGTGGGGAGGAGAGGGCAGG - Intergenic
911930490 1:103896684-103896706 TAAGCTGAAGAGGAGGAGGCAGG - Intergenic
912412749 1:109489681-109489703 TCCCCTGAGGAGGAAGGGGCTGG + Intronic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
913231643 1:116745045-116745067 TCCTTTGAGGAGGAGGGGAAAGG - Intergenic
913601103 1:120421737-120421759 AAATCAGAGGAGGAGGAGGCTGG - Intergenic
914085942 1:144454864-144454886 AAATCAGAGGAGGAGGAGGCTGG + Intronic
914191839 1:145418844-145418866 AAATCAGAGGAGGAGGAGGCTGG + Intergenic
914362291 1:146945293-146945315 AAATCAGAGGAGGAGGAGGCTGG - Intronic
914489383 1:148141790-148141812 AAATCAGAGGAGGAGGAGGCTGG + Intronic
914589764 1:149096845-149096867 AAATCAGAGGAGGAGGAGGCTGG + Intronic
915467373 1:156105423-156105445 CACTCTCAGGAGGAGTGGGGAGG - Intronic
916865287 1:168849886-168849908 TACTCTAAGGAGGCTGGAGCTGG + Intergenic
917016455 1:170536933-170536955 TTTTCTGAGGTGGAGGGAGCAGG + Intronic
917852472 1:179077191-179077213 TACTCTGGGGAGGCTGAGGCAGG + Intergenic
918135928 1:181673916-181673938 TACACTGAGGAGCAGGGTGAAGG - Intronic
918666381 1:187155604-187155626 TACTCTGAGGAGTTGGGAGAGGG + Intergenic
919292409 1:195649224-195649246 GACTCTCAGGGGGTGGGGGCTGG + Intergenic
921021997 1:211244376-211244398 TGGTCTGAGGAGGAGGAAGCAGG - Intergenic
921847987 1:219904388-219904410 TACTCGGAGGAGGCTGAGGCAGG + Intronic
923282811 1:232461107-232461129 GACCCTGAGGAGGAACGGGCTGG - Exonic
924601004 1:245488965-245488987 TTCTCTGAGATGGAGGGTGCAGG - Intronic
1063652562 10:7953059-7953081 TACTCTGAGGAGAAGAGGCTGGG - Intronic
1063775361 10:9257108-9257130 TCCTTTGAGGAGGAGAGGTCTGG + Intergenic
1064103820 10:12484820-12484842 GACTCTGGGGGGGAGGGGGTGGG + Intronic
1064119413 10:12605937-12605959 TGTTCTGGGGTGGAGGGGGCTGG + Intronic
1065433908 10:25686938-25686960 GGCTGTGAGGAGGAGGGGGAAGG - Intergenic
1065458106 10:25928617-25928639 TACTCAGAGGCTGAGGTGGCAGG - Intergenic
1067084127 10:43229296-43229318 TGCTCTGAGGAGGATGTGCCGGG - Intronic
1067156589 10:43786089-43786111 CACTCTGAGGACGGCGGGGCAGG + Intergenic
1069585989 10:69602732-69602754 GACTCTTAGGAGCTGGGGGCTGG - Intergenic
1069948311 10:72002259-72002281 TGCTCTGGGGATGAGGAGGCTGG + Intronic
1069983453 10:72268181-72268203 ACCTCTGAGCAGGAGTGGGCTGG - Intergenic
1070302190 10:75211331-75211353 TCCTCTGCGGAGGAGGGGCTGGG + Intronic
1070981189 10:80649557-80649579 GAAGCTGAGGAGGAGGAGGCTGG + Intergenic
1073069396 10:100783692-100783714 TAGTCTGAGCAGGAAGGGACAGG + Intronic
1073239108 10:102043176-102043198 TCCTCTGGGAAGGAGGGGGATGG - Intronic
1074033816 10:109717668-109717690 TTCTGAGAGGAGAAGGGGGCAGG - Intergenic
1074356915 10:112794120-112794142 TACTGTGGGGAAGAGGGGGCTGG + Intronic
1074583199 10:114740919-114740941 CACTCTCAGGAGGATGAGGCAGG + Intergenic
1074947625 10:118296565-118296587 TCCTCTGAGGAGAAGGAGGCAGG - Intergenic
1075645564 10:124093730-124093752 GACTCGGAGGGGGAGGGGGCAGG - Intergenic
1076310636 10:129504711-129504733 CTCTCTGAGCAGGAGGGTGCTGG - Intronic
1076880662 10:133237807-133237829 TAAGCCCAGGAGGAGGGGGCGGG - Exonic
1076900439 10:133335190-133335212 GCCGCTGAGGAGGAGGGGTCGGG + Intronic
1077554499 11:3219346-3219368 TGGTCTGAGGAGGAGGGAGGAGG + Intergenic
1078254078 11:9642393-9642415 TAATCTCAGGAGGCTGGGGCAGG - Intergenic
1078426806 11:11258237-11258259 TGCTCTGCGGAGGAGGGGTAGGG - Intergenic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079005578 11:16789293-16789315 GTCTCTGAGGAAGAGGAGGCAGG + Exonic
1079249158 11:18774507-18774529 TACTCTGAGGAGGAGGGGGCTGG + Intronic
1079333475 11:19552017-19552039 TTGTCTGAGGAGGACGGGGGAGG + Intronic
1081719194 11:45274574-45274596 TGCTCTGAGAAGCAGGGTGCAGG + Intronic
1082736484 11:56861560-56861582 TTCTCTGAGATGGAGGAGGCTGG - Intergenic
1083258965 11:61513024-61513046 GCCTCTGGGGAGTAGGGGGCAGG + Intergenic
1083625877 11:64071760-64071782 GGCCCTGAGGAGGATGGGGCAGG - Intronic
1083678016 11:64338420-64338442 GACTCAGAGAAGGAGGTGGCAGG - Intergenic
1083745985 11:64736734-64736756 CACGGTGAGGAGCAGGGGGCAGG - Exonic
1083751955 11:64765922-64765944 GAGGCGGAGGAGGAGGGGGCGGG + Intronic
1083756909 11:64796794-64796816 TACTCGGGGTAGGTGGGGGCAGG - Exonic
1084322955 11:68383784-68383806 TTTCCTGAGGAGGAGGTGGCGGG + Intronic
1084372999 11:68756834-68756856 GTTTCTGAGGGGGAGGGGGCTGG + Exonic
1084476843 11:69394148-69394170 TGCTCTGAAGAGGGGTGGGCCGG + Intergenic
1085231196 11:74972454-74972476 CACACTTTGGAGGAGGGGGCGGG - Intronic
1089201878 11:116729598-116729620 AACTCTGAGCAGGAGGGGATGGG - Intergenic
1090006566 11:123007988-123008010 TACTCTCGGGAGGCTGGGGCAGG - Intergenic
1090596480 11:128326074-128326096 TACTCTCAGGAGGCTGAGGCAGG + Intergenic
1090730106 11:129565125-129565147 TCCTCCCAGGAGGAGGGGGCAGG + Intergenic
1092198656 12:6566108-6566130 AACTCTGAGGATGAGGAGGAAGG - Exonic
1092230343 12:6772608-6772630 CAGCCTGAGGAGGTGGGGGCGGG - Exonic
1092672754 12:10882417-10882439 TTCCTTGAGGAGGAGGGGGATGG + Exonic
1092676940 12:10930858-10930880 TTCCTTGAGGAGGAGGGGGATGG - Exonic
1093557436 12:20492690-20492712 TGCACTGAGCAGGTGGGGGCAGG + Intronic
1093705815 12:22273963-22273985 TTTCCTGGGGAGGAGGGGGCTGG - Intronic
1095699390 12:45175253-45175275 TACTCTGGGGAGGCTGAGGCAGG + Intergenic
1096073238 12:48787661-48787683 GACTCTGGGGAGGAGGGAGGTGG - Intronic
1096230716 12:49895393-49895415 TGCTCTGAGCAGGTGGTGGCAGG - Intronic
1096389424 12:51217587-51217609 TGCACGGAGGGGGAGGGGGCCGG - Intronic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1096700613 12:53380470-53380492 GCCTCCGAGGAGGAGGGGGATGG + Intronic
1096842097 12:54385785-54385807 TGGGCTGAGGGGGAGGGGGCTGG - Intronic
1097282646 12:57854205-57854227 AAAACAGAGGAGGAGGGGGCGGG + Intergenic
1097288039 12:57892658-57892680 TACTCTTAGGGGAATGGGGCTGG + Intergenic
1097509387 12:60517859-60517881 TACACTGAGCAGGGGAGGGCAGG - Intergenic
1098005671 12:65994535-65994557 TAACCTGAGGAGGAGGAGGAGGG - Intergenic
1098835091 12:75414749-75414771 TACACTGGGGAGGAGGGGGTTGG + Intronic
1099362170 12:81717820-81717842 TGCTCTCAGGAGGAGGGGAATGG + Intronic
1101000476 12:100352757-100352779 CACTATGAGAGGGAGGGGGCAGG + Intergenic
1101118095 12:101551649-101551671 TACTCTTAGTATGAGGAGGCAGG - Intergenic
1102554796 12:113719775-113719797 TCCTGTGGGGAGGAGGGGACAGG + Intergenic
1103188530 12:118981405-118981427 GAGCCTGAGGAGGAGGGGGTTGG + Intergenic
1103342595 12:120229031-120229053 TGCTCCGAGGAGGAGGGGACCGG + Intronic
1103480401 12:121246829-121246851 TGCTCTCAGGGGTAGGGGGCTGG - Intronic
1103733871 12:123046140-123046162 TCCTGTGAGGAGGAGGGTGTAGG + Intronic
1103960417 12:124605895-124605917 TGCTTTGAGGGGCAGGGGGCAGG + Intergenic
1104676434 12:130714998-130715020 GGCTCTGAGCAGGAGTGGGCAGG - Intronic
1105933626 13:25076749-25076771 TAGTCTGAGGAGGAGAAGGAGGG + Intergenic
1106333571 13:28762815-28762837 GTCTCTGAGGAGGAGCGGGGAGG + Intergenic
1106504583 13:30360208-30360230 TCCTCTGAGTAGGAGGGGCAGGG - Intergenic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107183137 13:37485447-37485469 TCCTCTGAGGGGGATTGGGCAGG - Intergenic
1107290427 13:38846602-38846624 TACTCTGTGGATGAGAGTGCTGG + Exonic
1108201164 13:48044788-48044810 TACACTAATGAGGTGGGGGCGGG - Intronic
1112810517 13:103213333-103213355 GACTCTGGAGAGGAGGGGTCGGG - Intergenic
1113337987 13:109395149-109395171 TACCCTGGGGAGGTGGGGGGAGG - Intergenic
1113469361 13:110533574-110533596 TACTCTGAGGAGGCTGAGGCAGG + Intronic
1113928446 13:113953725-113953747 TGCTCTGTGGGGGAGGGTGCTGG + Intergenic
1114063017 14:19037612-19037634 TAGTCCGGGGAGCAGGGGGCAGG + Intergenic
1114099242 14:19362385-19362407 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1114447684 14:22802024-22802046 TACTGTGAGGAGGAGGATGGGGG - Intronic
1116295417 14:43100738-43100760 TGCTCTGTGTAGGAAGGGGCCGG - Intergenic
1117440335 14:55753569-55753591 TGCACTGTGGAGGGGGGGGCTGG - Intergenic
1119182362 14:72613746-72613768 AACTCTGAGGAGGAGGGGTCCGG - Intergenic
1119443534 14:74645836-74645858 AGCTCTGTGGAGGACGGGGCAGG - Intergenic
1119514175 14:75234894-75234916 GGCTCAGAGGAGGAGGGGGCCGG + Intergenic
1119621172 14:76133110-76133132 TAATCTTAGGAGGAAGGGGTAGG + Intergenic
1119704028 14:76773061-76773083 GAATGTGAGAAGGAGGGGGCAGG - Intronic
1119769594 14:77212108-77212130 TAAGCTGAGGAGGAGGAGGATGG + Intronic
1119858427 14:77918598-77918620 GCCTCTGAGTAGGAGGGGGCTGG + Intronic
1122820859 14:104344123-104344145 TACTCAGAGGACTATGGGGCTGG - Intergenic
1122827697 14:104378851-104378873 TAGTCAGAGGGGGAGGGTGCGGG + Intergenic
1123493528 15:20800572-20800594 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1123550036 15:21369674-21369696 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1123976073 15:25555764-25555786 TGCTCTGTGGTAGAGGGGGCAGG + Intergenic
1125629072 15:41132780-41132802 TAGTCTGGGGAGGAGGGGAGAGG - Intergenic
1126067879 15:44839785-44839807 TGGGCTGTGGAGGAGGGGGCTGG - Intergenic
1126091948 15:45060790-45060812 TGGGCTGTGGAGGAGGGGGCTGG + Intronic
1126112943 15:45186415-45186437 TCTGCTGAGGAGAAGGGGGCAGG + Intronic
1126667039 15:51084722-51084744 AACAGTGAGGAGGAGGGGTCCGG + Intronic
1127703245 15:61522776-61522798 CACTCTGGGGAAGTGGGGGCTGG + Intergenic
1128609596 15:69063227-69063249 TAAAATGAGGAGGTGGGGGCCGG + Intergenic
1128633943 15:69291068-69291090 GACTCCAGGGAGGAGGGGGCTGG - Intergenic
1129011722 15:72424339-72424361 TCATATGAGGAGGAGGGAGCTGG + Intergenic
1129116523 15:73368158-73368180 GACGCCGAGGAGGAGGGGGCCGG - Exonic
1129300341 15:74621741-74621763 GACTCGGAGGAGGAGGAGGAGGG + Intronic
1129389530 15:75213701-75213723 CAGTCTGAGGTGGTGGGGGCAGG + Intergenic
1129985735 15:79918507-79918529 TCCTGTGTGGGGGAGGGGGCTGG - Intronic
1130783954 15:87074888-87074910 TTCTCTGTGGAGGAGAGGGAGGG + Intergenic
1130890129 15:88126771-88126793 TACTCTGGGGAGGAGGAGAAAGG - Intronic
1202958366 15_KI270727v1_random:96892-96914 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1132833312 16:1940373-1940395 CACTCTGCAGAGGAGGAGGCAGG + Intronic
1132930943 16:2459045-2459067 TTCTCTGTGAAGGAGGAGGCAGG - Intergenic
1133439407 16:5807859-5807881 CACTTTGAGGAGCAGGGAGCTGG + Intergenic
1133896953 16:9938824-9938846 GACTCAAAGGAGGAAGGGGCAGG - Intronic
1134049945 16:11130523-11130545 AACTCTGAGTAGGAGGAGGGTGG - Intronic
1134089402 16:11383642-11383664 CACACTGTGGAGGAGGGGCCAGG + Exonic
1134744947 16:16580797-16580819 TACTCTGAGGCTGAGGCGGGAGG - Intergenic
1134803593 16:17106915-17106937 TACTCTGAGGATGAGGAGGATGG + Exonic
1135000537 16:18772972-18772994 TACTCTGAGGCTGAGGCGGGAGG + Intergenic
1135324601 16:21518508-21518530 TACTTTGGGGAGAAGGGGGAGGG - Intergenic
1136336088 16:29611778-29611800 TACTTTGGGGAGAAGGGGGAGGG - Intergenic
1137253314 16:46756017-46756039 TACTCTCAGGAGGCTGAGGCAGG - Intronic
1137264418 16:46857055-46857077 TACTCTCAGGAGGCTGAGGCAGG + Intergenic
1137603378 16:49771312-49771334 TACTCTCAGGAGGCTGAGGCAGG - Intronic
1137709241 16:50555082-50555104 CACTCTGGGAGGGAGGGGGCAGG + Intronic
1137752808 16:50879456-50879478 CACTCAGAGGAGGCGGGGCCAGG + Intergenic
1139647902 16:68345383-68345405 TACTCTGATGGGGTGGGGACTGG + Intronic
1139957789 16:70701375-70701397 TACTGAGATGAGGAGGGGGTTGG - Intronic
1140255763 16:73334729-73334751 GACTGAGAGGAGGAGGGGACAGG - Intergenic
1140895279 16:79319174-79319196 TACTTTGGGGAGGTGGGGGGAGG + Intergenic
1141342134 16:83213028-83213050 AGCTCTGAGGAGCAGGAGGCAGG + Intronic
1141772989 16:86102114-86102136 TACACTGAGGAAGAGAAGGCAGG + Intergenic
1142036809 16:87867554-87867576 TACTTTGGGGGGGAGGGGGAGGG - Intronic
1142373701 16:89696405-89696427 TGTTCTGGGGAGGAGGGGGTGGG + Exonic
1142400434 16:89855695-89855717 GCCCCTGAGGAGGAGGAGGCTGG - Intronic
1142654857 17:1384815-1384837 TACTCCCAGGAGGCGGAGGCAGG - Intronic
1143058218 17:4178336-4178358 TGATCTGAGTAGGAGGGGGTGGG - Intronic
1144327781 17:14198195-14198217 CACTCTGAGGAGGTAGGGGAGGG + Intronic
1145123427 17:20280989-20281011 TAGTGTGAGGAGGAAGGAGCGGG + Intronic
1145221598 17:21093978-21094000 TACTCTGAGGCCGAGGTGGGAGG + Intergenic
1146278541 17:31530527-31530549 CACTCTGGGCAGGTGGGGGCCGG - Intronic
1146723989 17:35142637-35142659 TACTCTGAGGCTGAGGTGGGAGG - Intergenic
1146762411 17:35490077-35490099 GGCACTGGGGAGGAGGGGGCCGG - Intronic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147293901 17:39465596-39465618 TACTCTCAGGAGGCTGAGGCAGG - Intronic
1147333414 17:39712303-39712325 CACACTGAGGAGGTGGGGGTGGG - Exonic
1147749431 17:42720359-42720381 TACTCAGATGAGGAGGAGGAAGG - Exonic
1147863850 17:43540490-43540512 GACTCTCCGGAGGAGGGGACTGG - Intronic
1147921831 17:43921973-43921995 TACTCAGAGGAGGCTGAGGCAGG + Intergenic
1147923487 17:43932780-43932802 TTCTGGGAGGAGGAGGAGGCTGG + Intergenic
1148550880 17:48550369-48550391 TACCCTGAGGAGGAGGCGCGTGG + Exonic
1148574769 17:48702250-48702272 GACACTGAGGAGGTGGGGGTGGG + Intergenic
1149435497 17:56630166-56630188 AACTCTGAGCAGCTGGGGGCAGG + Intergenic
1149503235 17:57171140-57171162 CACTCTGAGATGGAGGGGCCTGG + Intergenic
1149568007 17:57653082-57653104 GGCTCTGAGGAGGGTGGGGCTGG + Intronic
1149604773 17:57916877-57916899 TTCTCTGAGCAGGAGGAGGAGGG + Intronic
1151542741 17:74773036-74773058 CACTCTGAGGAGGAGGTGACAGG + Exonic
1152021405 17:77781776-77781798 AACTCTGAGGAGGAGAGAGGAGG - Intergenic
1152120035 17:78412934-78412956 TGCTCTGGGGAAGAGGGGGTGGG + Intronic
1153004570 18:486292-486314 TACTCTGAGGCTGAGGTGGGAGG - Intronic
1153276880 18:3376303-3376325 TACTCGGAGGATGAGGTGGGAGG + Intergenic
1153448012 18:5195937-5195959 CATTCTGAGGGGGAGGGGGAGGG + Intronic
1154165420 18:12010996-12011018 TACTCTGGGGAGGAGAGCCCTGG - Intronic
1154451061 18:14475035-14475057 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1155957388 18:31965206-31965228 TACTCTCAGGAGGCTGAGGCAGG + Intergenic
1157619286 18:49006790-49006812 TGCTGTGGTGAGGAGGGGGCTGG + Intergenic
1158167906 18:54562142-54562164 TAATCAGAGCAGGAGAGGGCTGG - Intergenic
1159919572 18:74215434-74215456 TTCTCTGAGGAGGATGGGGCAGG - Intergenic
1160033407 18:75281360-75281382 TGTTTTGAGGAGGAGGGTGCTGG + Intronic
1160222100 18:76985040-76985062 CACGCTGAGGGGGTGGGGGCGGG + Intronic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160900931 19:1428093-1428115 TCTTCTCAGGAGGAGGGTGCGGG - Intronic
1161045142 19:2130601-2130623 CTCTCTGTGGAGGAGGCGGCTGG - Intronic
1161218359 19:3105980-3106002 TTGTCTCAGGAGGAGTGGGCTGG + Intronic
1161505913 19:4643395-4643417 GACTCTGCAGAGGAGGGGACAGG - Intronic
1161889003 19:7020086-7020108 TCCTCTGAGGAGGATGAGGAGGG - Intergenic
1161890363 19:7031930-7031952 TCCTCTGAGGAGGATGAGGAGGG + Intronic
1161891085 19:7038803-7038825 TCCTCTGAGGAGGATGAGGAGGG - Intronic
1161892451 19:7050663-7050685 TCCTCTGAGGAGGATGAGGAGGG + Intronic
1161893170 19:7057264-7057286 TCCTCTGAGGAGGATGAGGAGGG - Intronic
1161907487 19:7167925-7167947 GACGCTGAGGAGGCGAGGGCTGG - Intronic
1162048898 19:8020103-8020125 TACTCTCAGGAGGCTGAGGCAGG + Intronic
1162180177 19:8863327-8863349 TACTCTGAGGATGTGGGGTCTGG + Exonic
1163592737 19:18203672-18203694 TGCTCTGCGGCGGAGGGGGAGGG - Intronic
1164444172 19:28302974-28302996 TACTATGAGGGGGAGGGAGGAGG + Intergenic
1165014942 19:32874027-32874049 TACTCTTGGGAGGCTGGGGCAGG + Intergenic
1165063461 19:33216079-33216101 TTCCCGGAGGAGGAGGAGGCAGG + Intronic
1165094348 19:33402344-33402366 GAAGCAGAGGAGGAGGGGGCTGG + Intronic
1165313499 19:35041703-35041725 TCACCTGAGGAGGAGGGGGCTGG - Exonic
1165955437 19:39499286-39499308 GACTCTGAAGAAGAGGCGGCAGG - Exonic
1166662977 19:44659233-44659255 GACTCCTAGGAGGAGGTGGCAGG + Intronic
1166713514 19:44951941-44951963 TACTCTGAGGCTGAGGTGGGAGG - Intronic
1167097133 19:47380510-47380532 TGCTAGGAGGAGGAGGGGGGAGG + Intronic
1167192855 19:48003840-48003862 TAAAGTGAGGAGGAGTGGGCCGG - Intronic
1167264692 19:48477800-48477822 TGCCCACAGGAGGAGGGGGCTGG + Intronic
1167457330 19:49603612-49603634 AACTCTGGGGTGGAGGGGGGAGG + Intronic
1167513626 19:49910127-49910149 CACTCTGTGGAGGACGAGGCGGG + Intronic
1167565494 19:50253753-50253775 TCCTCTAAGGATGGGGGGGCAGG - Intronic
1167593140 19:50415105-50415127 GGATCTGAGGAGGAGGGGGCTGG - Intronic
1167638848 19:50669129-50669151 CGCCCTGAGGAGGAGGGGACTGG + Exonic
1167684637 19:50949112-50949134 AACTCTGAGGAAGATGGGGCAGG + Exonic
1167732010 19:51265347-51265369 TACTGTGGGGAGGAAGGGTCAGG - Exonic
1167743345 19:51337610-51337632 GGGTCTGAGGGGGAGGGGGCTGG + Intronic
1168110329 19:54188674-54188696 TCCTCCAAGGAGGAAGGGGCTGG - Intronic
1168494214 19:56836856-56836878 TACTCTGAAGAGGCTGGGGTGGG + Intronic
925361564 2:3283832-3283854 TACTCAGAGGAGGCTGAGGCAGG + Intronic
925456466 2:4020752-4020774 AACTCTGGGGTGGTGGGGGCTGG - Intergenic
925670947 2:6309317-6309339 GAGTCTGAGGAGGAGTGGCCAGG - Intergenic
925896696 2:8477830-8477852 AACTCAGATGAGGAGGGGGAGGG - Intergenic
925972237 2:9113661-9113683 TGCCCTGAGGAGGTGGGGCCCGG - Intergenic
926288217 2:11507675-11507697 GACTCTGAGAAGCAGGAGGCTGG - Intergenic
926694741 2:15763367-15763389 TGGGCTGGGGAGGAGGGGGCAGG + Intergenic
926777994 2:16441043-16441065 GAGTCTGAGGAGGAAGTGGCAGG + Intergenic
927190929 2:20516449-20516471 TTGTCTAAGGAAGAGGGGGCTGG - Intergenic
928022694 2:27716238-27716260 GGCTGTGAGGAGGCGGGGGCAGG - Intergenic
928096258 2:28406908-28406930 GACTCTGAGGAGGTGGGGAGGGG + Intronic
928387321 2:30881480-30881502 TACACGAAGGAGGAAGGGGCCGG + Intergenic
928724223 2:34152165-34152187 TAGGCTGAGGAGGAGGAAGCAGG - Intergenic
930797043 2:55404839-55404861 TACTCGGGGGAGGCTGGGGCAGG - Intronic
931079847 2:58756337-58756359 TGTTGTGAGGAGGAGGAGGCAGG - Intergenic
931220349 2:60283723-60283745 TACTCGGAAGAGGTGGGGGTGGG - Intergenic
932387669 2:71352178-71352200 TATAAAGAGGAGGAGGGGGCCGG + Intronic
932430666 2:71672060-71672082 GACTCTGGGGAGAAGGTGGCTGG + Intronic
933644841 2:84802595-84802617 TAATCAGAGGAGCAGGGGGTGGG + Intronic
934721191 2:96578034-96578056 TACTTGGGGGAGGAGGGGGTGGG + Intergenic
935062480 2:99620517-99620539 TACTCGGAGGCTGAGGTGGCAGG + Intronic
935617614 2:105102435-105102457 CACTCTGAGGAGGAGGTGGTGGG + Intergenic
935700771 2:105809912-105809934 AACACTGAGGGGGAGAGGGCAGG + Intronic
936095625 2:109528564-109528586 AACTCTGAGGAGGTGGGAGAAGG + Intergenic
937704149 2:124898856-124898878 TACTGTTAGGAGGAGGAGGCCGG - Intronic
937987702 2:127645907-127645929 GACTCAGAGCAGGCGGGGGCTGG - Exonic
938905960 2:135836457-135836479 TGCTCTAAGGAGGATGGGGAAGG + Intronic
939257291 2:139760133-139760155 GACTATGAGGAGGCGGGCGCGGG - Intergenic
939740858 2:145903573-145903595 TACTTTGGTGGGGAGGGGGCTGG - Intergenic
939989535 2:148864459-148864481 GCCTCTGAGGAGGATGGAGCTGG + Intergenic
941457092 2:165721983-165722005 TACTCTGAAGAGCAGGAGGTGGG - Intergenic
941795764 2:169596809-169596831 TACTCTCAGGAGGCTGAGGCAGG - Intronic
944265996 2:197727361-197727383 TAATTTTAGGTGGAGGGGGCAGG - Exonic
945032220 2:205676481-205676503 CACACTGATGGGGAGGGGGCTGG - Intergenic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945705024 2:213219651-213219673 TGTTCTGAGGAGGAAGAGGCAGG + Intergenic
946022815 2:216653138-216653160 CACTCTGAGGAGGAAGGACCAGG + Intronic
946825191 2:223670650-223670672 TACTCTGGGGAGGCTGAGGCTGG - Intergenic
948063373 2:235058602-235058624 TACTCAGAGGGGCTGGGGGCTGG - Intergenic
948168307 2:235879820-235879842 TACTCGGAGGAGGCTGGCGCAGG + Intronic
948294026 2:236847721-236847743 TACCCTGAGGAGGGGAGGGGCGG + Intergenic
948467601 2:238159723-238159745 AACCCTGGAGAGGAGGGGGCAGG - Intronic
948788505 2:240365337-240365359 TACACACAGCAGGAGGGGGCAGG - Intergenic
1168757668 20:327418-327440 GCTTCTGGGGAGGAGGGGGCTGG + Exonic
1168971991 20:1937518-1937540 TACTCTGAGAAGGACGGCTCAGG - Exonic
1169486815 20:6041383-6041405 TACTCTGCGGAGGGCTGGGCGGG - Exonic
1169969379 20:11252781-11252803 TACTTTGAGGAAGATGGGGAGGG + Intergenic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170169049 20:13391280-13391302 CACTCAGAGGAGGCTGGGGCTGG + Intronic
1170510443 20:17071022-17071044 TAGTTTGAGGATGAGGGAGCTGG + Intergenic
1170566073 20:17606711-17606733 TACTTTGAGGAGGAAGGGGCAGG - Intronic
1170684083 20:18553311-18553333 TACTTTGAGAAGGAGTGAGCAGG + Intronic
1170885428 20:20336816-20336838 CACGCTGGGGAGGTGGGGGCTGG - Intronic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171119553 20:22556805-22556827 TACTCTCAGGAGAAGGGGTGGGG - Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171997686 20:31744838-31744860 CACTCTGAGGAGGCTGAGGCGGG + Intronic
1172274121 20:33670577-33670599 TAGGATGAGGAAGAGGGGGCAGG - Intronic
1172765962 20:37351041-37351063 TACTGTGGGAAGGAGGAGGCTGG - Intronic
1172888839 20:38249440-38249462 AACTCTGAGGAGGAGGAGGGTGG + Intronic
1172956564 20:38763847-38763869 TAATCTGAGGAGGAGGAAGATGG - Intronic
1173169452 20:40712071-40712093 TAATCTGGGGAGGAGGGGAAGGG + Intergenic
1174139173 20:48400750-48400772 TTCTCTGAGGAGGAGGAACCTGG + Intergenic
1174845247 20:53937149-53937171 TAGTCTGAAGACGATGGGGCAGG + Intronic
1175409420 20:58756313-58756335 TGCTCTCGGGAGGAGGCGGCAGG - Intergenic
1176024500 20:62978831-62978853 GTCCCTGAGGAGGAGGGGCCCGG - Intergenic
1176070974 20:63226333-63226355 CAAGCTGAGGAGGAGGGGACCGG + Intergenic
1176095774 20:63343709-63343731 TCCCCTGGGAAGGAGGGGGCAGG + Intronic
1176445173 21:6815538-6815560 TAGTCCGGGGAGCAGGGGGCAGG + Intergenic
1176823340 21:13680571-13680593 TAGTCCGGGGAGCAGGGGGCAGG + Intergenic
1177796420 21:25783035-25783057 TATTTTGAGGAGGAGGCGGATGG - Intergenic
1178719816 21:34998417-34998439 TTCTCTGAGGAGGAGGATGAAGG - Intronic
1179565579 21:42245835-42245857 GACTCTGATGAGGAGGGGAGGGG + Intronic
1179565585 21:42245871-42245893 GACTCTGATGAGGAGGAGACAGG + Intronic
1179912169 21:44456139-44456161 CACCCTGAGGAGGGAGGGGCTGG + Intronic
1180136451 21:45865531-45865553 TACTCAGTGGCGGATGGGGCGGG - Intronic
1180205048 21:46254591-46254613 TCCTATGAGCAGGAAGGGGCAGG + Intronic
1180205213 21:46255592-46255614 TCCTATGAGCAGGAAGGGGCAGG + Intronic
1180481510 22:15760239-15760261 TAGTCCGGGGAGCAGGGGGCAGG + Intergenic
1180873856 22:19164869-19164891 TACTCGGAGGTGGAGGCGGGAGG + Intergenic
1181278732 22:21703551-21703573 AACTCTTAGGAGGATGGGGTGGG - Intronic
1181468855 22:23125855-23125877 TGCTTTGAGGAGGAGGCTGCAGG - Intronic
1181533441 22:23530085-23530107 TACCATGAGGAGGAAGGGGGTGG + Intergenic
1181756842 22:25029852-25029874 TACTGTGGGGAGGTGGGAGCTGG + Intronic
1181960133 22:26616802-26616824 CCCTCTGAGCAGCAGGGGGCTGG + Intronic
1182462477 22:30492262-30492284 TACTCTTAGGAGTAGGTGCCCGG - Intronic
1183091308 22:35523938-35523960 TCCTGAGAGGAGGAGAGGGCGGG + Intergenic
1183192087 22:36328042-36328064 CACGCTGCGGAGGAGGGAGCTGG - Intronic
1183492265 22:38122955-38122977 CACTTTGAGGAGGCAGGGGCGGG - Intronic
1183612977 22:38923062-38923084 TCCTGTGAGGAGGAGGTGGGAGG + Intergenic
1183745773 22:39690970-39690992 GAATCTGTGGAGGAGGAGGCTGG + Intergenic
1184567268 22:45299491-45299513 TACCCTGAGGAGGACGAGGAAGG - Intergenic
1185135867 22:49072100-49072122 TACTATGAAGAACAGGGGGCTGG + Intergenic
950167627 3:10813820-10813842 TATTGTGAGGAGGAGGAGGATGG - Intergenic
950167643 3:10813909-10813931 TATTGTGAGGAGGAGGAGGATGG - Intergenic
950274071 3:11643376-11643398 CACACTGAGGAGGAGTGGCCGGG + Intronic
950515224 3:13460609-13460631 TACCCTGAGGAGGAGGTGGGAGG + Intergenic
950582885 3:13874108-13874130 TGACCTGAGGAGGAGGCGGCAGG + Intronic
950997715 3:17521303-17521325 TAGGCTGAGGAGGAGGTGGAAGG - Intronic
951705656 3:25541824-25541846 GAGTCTGTGGAGGAAGGGGCCGG - Intronic
952804168 3:37330917-37330939 TACTCAGAGGAGGATGAGGCAGG + Intronic
953245297 3:41185458-41185480 TATTCTGATGAGGAGGGTGGGGG + Intergenic
953877530 3:46674850-46674872 TTTTCTGGGGAGGAGGAGGCTGG - Intronic
954814333 3:53268855-53268877 TACTCTCAGGAGGCTGAGGCAGG - Intergenic
955683064 3:61522566-61522588 CACACTGTGGAGGAGGGGGAAGG + Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
955871487 3:63443004-63443026 TGCTTGCAGGAGGAGGGGGCTGG + Intronic
956026498 3:64988218-64988240 AACTGTGGGGAGGAGGGGACAGG + Intergenic
956474698 3:69607876-69607898 CACTCTGGGGAGGAGAGGGAGGG + Intergenic
957624344 3:82640427-82640449 TGCTCTGTGGAGTAGGAGGCCGG - Intergenic
958791538 3:98657012-98657034 TACTCAGAGGCGGAGGTGGGAGG - Intergenic
960730916 3:120725792-120725814 TATTGTGGGGAGGAGGGAGCGGG + Intronic
960733095 3:120747393-120747415 TATTGTGGGGAGGAGGGAGCGGG - Intronic
961565373 3:127759947-127759969 GACTCTGAGGAGGAGGCAGCTGG + Intronic
961972528 3:130985521-130985543 TACTCTAAGGAGGCTGAGGCAGG + Intronic
962400784 3:135057109-135057131 GAATCTGGTGAGGAGGGGGCTGG + Intronic
963988863 3:151630037-151630059 CATTCTGAGTAGGACGGGGCAGG + Intergenic
964339421 3:155692866-155692888 TATTCTGAGGAGGCTGAGGCAGG - Intronic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
964480397 3:157133342-157133364 TTCTGAGAAGAGGAGGGGGCAGG + Intergenic
964546883 3:157844116-157844138 TTCTCTTAAGAGGTGGGGGCAGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965803424 3:172517333-172517355 TACTTTCAGGAGGAGGTGGAAGG + Intronic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
967993638 3:195150599-195150621 CACCCTGAGGAGGAAGCGGCAGG - Intronic
968256023 3:197272818-197272840 TCCTCTGAGGAAGAGGGGATAGG + Intronic
968663856 4:1810261-1810283 CACGCTGAGGAGGAGGGGGCTGG - Intergenic
968706494 4:2080695-2080717 CACCCCGAGGAGGAGGGGTCTGG + Intronic
968745459 4:2357546-2357568 TGCTCTGAAGGGGAGCGGGCAGG - Intronic
969563550 4:7964550-7964572 TACTGTGAGGAGGGTGGGGATGG + Intergenic
971307587 4:25497095-25497117 TACTCAGAGGATGAGGTGGAAGG - Intergenic
971637924 4:29087297-29087319 TACTCTGTGGAGGGGCGGGCAGG + Intergenic
972324307 4:38000835-38000857 GACCCTGAGGAGGAGGTGGTGGG - Intronic
972396546 4:38663790-38663812 GACTCCGGGGAGGAGGGCGCGGG + Intergenic
972584525 4:40425111-40425133 GAATCTGGGGAGGAGGGGACAGG + Exonic
973852187 4:54972028-54972050 TACTTGGTGGAGGAGGAGGCAGG - Intergenic
975108792 4:70600195-70600217 TACTCTCAGGAGGCTGAGGCAGG + Intronic
976033818 4:80791928-80791950 GACACTGAGGAGCAGGGAGCGGG + Intronic
977609849 4:99020482-99020504 GAGCCTGAGGAGGAGGAGGCGGG + Intronic
977983816 4:103359097-103359119 TCCTCAGTGGAGGAGGGGCCTGG + Intergenic
978243894 4:106549209-106549231 CACTTTGAGGAGGAGGAGGCAGG - Intergenic
979429742 4:120614684-120614706 TCCTCTGAGGAAGAGTAGGCTGG - Intergenic
980452728 4:132996537-132996559 TATTCTGCTGAGGAAGGGGCTGG + Intergenic
980914279 4:139019855-139019877 TTCTCTGAGGAGGAGGGATGTGG - Intronic
981670388 4:147279697-147279719 AACTCTGAGGAGAAGGGGTTGGG - Intergenic
982473943 4:155827295-155827317 TAGGCTGAGGAGGAGGAGACAGG - Intergenic
983348182 4:166554269-166554291 TACTCTGAAGAATATGGGGCAGG + Intergenic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983647895 4:170010512-170010534 TAGACTGAGGAGGAGGGGGAGGG - Intronic
985182220 4:187277417-187277439 TAATATGAGGAGAAGGAGGCTGG - Intergenic
985263306 4:188135321-188135343 TAGGCTGAGGAGGAGGAGGTGGG - Intergenic
985890457 5:2711616-2711638 GACACGGAGGCGGAGGGGGCGGG - Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
990432518 5:55750436-55750458 TATTCTCAGGAGGAGGAGGAGGG + Intronic
990545134 5:56815282-56815304 GACTGGGAGGCGGAGGGGGCGGG - Intergenic
991061469 5:62380789-62380811 TAGGCTGAGGAGGAAGAGGCAGG + Intronic
992644027 5:78795396-78795418 AGCTTTGGGGAGGAGGGGGCTGG + Intronic
992645580 5:78808229-78808251 TAATATGGGGAGGAGGGGGTGGG - Intronic
993991353 5:94661644-94661666 TACTCTCAGGAGGCTGAGGCAGG - Intronic
994145848 5:96393880-96393902 TAGGCTGGGGAGGAGGGAGCTGG + Intronic
996817134 5:127586890-127586912 GACCCTGATGAGGAGGGTGCTGG + Intergenic
998143529 5:139712626-139712648 AGATGTGAGGAGGAGGGGGCAGG + Intergenic
998158478 5:139799598-139799620 CACTCTGAGGAGGATGGAGTGGG + Intronic
998376251 5:141692753-141692775 GACACCGAGGAGGAGGGGGCAGG - Intergenic
998419359 5:141969364-141969386 GACGCTGAGGAGGAAGGGGAAGG + Intronic
998474601 5:142409569-142409591 TGCTCTGAGAAGGAGGGCACAGG + Intergenic
999398139 5:151243879-151243901 TTCTCTCAGCAGGAGGTGGCAGG + Intronic
1000285084 5:159819903-159819925 AACTCTGAGGATGGGGAGGCTGG - Intergenic
1001535306 5:172493890-172493912 TACTCTGAGGCTGAGGTGGGAGG + Intergenic
1002033605 5:176448582-176448604 GAGTCTGGGGGGGAGGGGGCCGG - Intronic
1002433989 5:179220266-179220288 AACGCAGAGGAGGTGGGGGCCGG + Intronic
1002493044 5:179593185-179593207 TACTCTCAGGAGGCTGAGGCAGG - Intronic
1002569168 5:180130272-180130294 TCCTCTGCGGGGTAGGGGGCAGG + Intronic
1003014379 6:2456116-2456138 TTCTCTGGGGAGGAGAGGGGAGG + Intergenic
1003098223 6:3157977-3157999 TACCCTTTGGAGTAGGGGGCCGG + Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1004446688 6:15706592-15706614 TAGGCTGAGGAGGAGGAGGGAGG - Intergenic
1004924077 6:20402474-20402496 GGCACTGGGGAGGAGGGGGCCGG - Exonic
1005009569 6:21322976-21322998 TTTTCTGAGGAGGAGGAGGGAGG + Intergenic
1006360294 6:33583797-33583819 ACATGTGAGGAGGAGGGGGCCGG + Intergenic
1006502198 6:34466165-34466187 TTCCCGGGGGAGGAGGGGGCTGG - Exonic
1006749126 6:36365603-36365625 AAAACTGAGGATGAGGGGGCTGG + Intronic
1007511861 6:42380185-42380207 AACAGTGAGGAGGAGGGGACAGG + Intronic
1007553251 6:42746209-42746231 TCCTCTGCGTCGGAGGGGGCGGG + Intergenic
1007616396 6:43182175-43182197 AGCTCTGAGGAGGCGGGGCCAGG + Exonic
1007693801 6:43719215-43719237 TACTCTGGGGTGGAGTGGGGTGG + Intergenic
1008366350 6:50685218-50685240 TACTCTGAAAAGAAGGAGGCAGG - Intergenic
1008743357 6:54637205-54637227 TACTTTGAAGAGTAGGGGGATGG - Intergenic
1008981964 6:57494148-57494170 TACTTTGAGTAGGATAGGGCAGG + Intronic
1009936654 6:70242186-70242208 TATTCTCAGGAGAAGAGGGCGGG + Intronic
1011749905 6:90444725-90444747 AACACTGAAGAGGAGGGGGCGGG + Intergenic
1012549101 6:100451565-100451587 TGATCTGAGGAGGAAGGGGAGGG + Intronic
1013005400 6:106068390-106068412 TACTCTGAGGAGAACAGGGTGGG - Intergenic
1013039831 6:106422439-106422461 TACTCAGAGGCTGAGGTGGCAGG - Intergenic
1013612250 6:111806318-111806340 TAACCAGAGGAGGAGGGGGTGGG + Intronic
1014472042 6:121827967-121827989 TACTCTGAGGATGATGTGGTAGG + Intergenic
1014871709 6:126604014-126604036 TAGACAGAGGAGGAGGAGGCAGG - Intergenic
1014914712 6:127132114-127132136 TACTCCCAGGATCAGGGGGCTGG - Intronic
1015212886 6:130717906-130717928 TACTGCGAGGAGGGTGGGGCTGG - Intergenic
1015884568 6:137903757-137903779 TCCTCTGAGGAGGAGAGGTTGGG - Intergenic
1016428249 6:143956861-143956883 GACTCTGATGAGCAGGGAGCTGG + Intronic
1016989032 6:149916758-149916780 TAATCCCAGAAGGAGGGGGCTGG - Intergenic
1016993962 6:149947906-149947928 TAATCCCAGGAGGAGGGGGCTGG + Intronic
1017004371 6:150019631-150019653 TAATCCCAGGAGGAGGGGGCTGG - Intronic
1017421184 6:154274749-154274771 TGCTCTGAGGAGGATTGGCCAGG - Intronic
1018847546 6:167566099-167566121 GCCTCTGAGCAGGAGTGGGCGGG + Intergenic
1018935377 6:168270794-168270816 CACTCAGAGGAGCCGGGGGCAGG - Intergenic
1019423360 7:962129-962151 CACTGTGGGGAGGAGGGGTCAGG - Intronic
1019465333 7:1185008-1185030 TACTCTCAGGAGGCTGAGGCAGG + Intergenic
1019517889 7:1447708-1447730 GACTCTGAGGAGGAGCCGTCAGG - Exonic
1020820261 7:12958401-12958423 AATTCTGAGGAAGAGAGGGCTGG + Intergenic
1021268831 7:18559504-18559526 ATCCCTGAGGAGGAGGGGGTAGG + Intronic
1023139213 7:37084164-37084186 TACCCTGAGGAGGAGCGGGAGGG + Intronic
1025087371 7:56034237-56034259 CCCCCGGAGGAGGAGGGGGCTGG - Intronic
1025899409 7:65731844-65731866 CCCCCGGAGGAGGAGGGGGCAGG - Intergenic
1026023369 7:66727577-66727599 TTCTCTGAGCAGGAAGGGTCAGG + Intronic
1027295219 7:76763118-76763140 TACTTTGAGAAGGAGGGAGCTGG + Intergenic
1028789301 7:94835192-94835214 TCCTCTGAGGAGGCTGAGGCAGG - Intergenic
1029229622 7:99055578-99055600 TACTCTGAGGCTGAGGTGGGAGG - Intronic
1029636530 7:101788171-101788193 TCCACTGAGGAGGCTGGGGCTGG + Intergenic
1029678906 7:102093839-102093861 GAATCGGAGGAGGAGGAGGCTGG + Intronic
1030091342 7:105861614-105861636 CACTCTGTGGAGGAGAGGTCAGG + Intronic
1030930197 7:115513233-115513255 TACTAGGAGGGAGAGGGGGCTGG + Intergenic
1031944873 7:127829212-127829234 AACTATGTGGGGGAGGGGGCAGG - Intronic
1032010902 7:128347190-128347212 TACTCTGAGGCTGAGGTGGGAGG + Intergenic
1032076938 7:128840529-128840551 CCCTCTGAGGAGATGGGGGCAGG - Exonic
1032115586 7:129114343-129114365 TACTGTGAGGGGCAAGGGGCAGG - Intergenic
1032473865 7:132199182-132199204 GGATCGGAGGAGGAGGGGGCTGG - Intronic
1032486023 7:132288064-132288086 TCCTCGTTGGAGGAGGGGGCTGG + Intronic
1033864725 7:145674767-145674789 TACTCTGAGGAAAAGAGTGCTGG - Intergenic
1034438681 7:151075874-151075896 TACAGAGAGGAGGTGGGGGCTGG - Intronic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1036204281 8:6793980-6794002 TACTCTCAGGAAGTGGGGCCTGG - Intergenic
1036931212 8:12957943-12957965 TACTGTGAGGAGGAGGGATGGGG - Intronic
1037535197 8:19817306-19817328 TTCTCAGAAGAGGAGGGGACCGG + Exonic
1037763524 8:21757603-21757625 TACTCTGAGGAGGCTGAGGCAGG - Intronic
1037784838 8:21896429-21896451 TGGTCTGAGGAGGAGGGGATTGG - Intergenic
1037837379 8:22222082-22222104 TTCTCTGAGAAGGAGTGGGCTGG - Intronic
1037928870 8:22865612-22865634 TTTTCTGAGCAGGATGGGGCGGG - Intronic
1037981122 8:23255114-23255136 TACTTTGGGGAGGATGGGGTTGG + Intronic
1038032527 8:23655175-23655197 TACTGTTTGGAGGAGGGGTCAGG + Intergenic
1038301736 8:26356877-26356899 AACACTGAGGAGGAGGGGAAGGG - Intronic
1039445391 8:37627268-37627290 TACTCAGAGGAGGCTGAGGCAGG + Intergenic
1039835612 8:41254038-41254060 TACTCTCAGGAGGCTGAGGCAGG + Intergenic
1040599502 8:48870196-48870218 CGCTCTGAGGAGGGCGGGGCCGG - Intergenic
1040761236 8:50847485-50847507 TCCTCTGAGGCTGAGGGGGACGG + Intergenic
1040819271 8:51537198-51537220 GAATCTCAGGAGGAGGGTGCTGG - Intronic
1041108620 8:54465902-54465924 TATTCCGAGGAAGAGCGGGCAGG - Intergenic
1041444294 8:57933171-57933193 TACCCTGAGCAGGAAGAGGCAGG + Intergenic
1041952954 8:63525077-63525099 AACTGTGAGGAAGAGGAGGCTGG + Intergenic
1042914318 8:73860129-73860151 TACTATGGGGGGCAGGGGGCGGG + Intronic
1043456151 8:80414352-80414374 AGCTGAGAGGAGGAGGGGGCTGG + Intergenic
1043558173 8:81458486-81458508 TGGTCTGAGGAGAAAGGGGCAGG - Intronic
1045508493 8:102795235-102795257 GGCTCTGAGGAGCAGAGGGCCGG - Intergenic
1046892774 8:119441262-119441284 TACTCTGATGAGGCTGAGGCGGG - Intergenic
1047226533 8:122959917-122959939 TCCTCTGAAAATGAGGGGGCTGG - Intronic
1047637057 8:126775267-126775289 TACTATGAGTAGGAGGGGAAAGG + Intergenic
1048013789 8:130480039-130480061 TAATCTCAGGAAGAGGGGCCTGG - Intergenic
1048288377 8:133160751-133160773 TACTCAGAGGAGCTGGAGGCGGG + Intergenic
1048999661 8:139816570-139816592 TTCTCTGAGGAGCAGTGGGGTGG - Intronic
1049536099 8:143183216-143183238 GTGTCTGCGGAGGAGGGGGCTGG + Intergenic
1051448838 9:17172175-17172197 TCCTCTGAGGAGCAGGTTGCTGG + Intronic
1053024708 9:34720066-34720088 CACTAGGAGGAGGAGGTGGCAGG - Intergenic
1055287696 9:74746815-74746837 CACTCTGAAGATGAGGGGGTGGG + Intronic
1055933655 9:81585209-81585231 TACTCTGAAGAGGGGTGGGCGGG - Intronic
1057339503 9:94187042-94187064 TGCTATGTGGAGGATGGGGCAGG - Intergenic
1057695221 9:97318319-97318341 AAGTCTGGGGAGGAAGGGGCTGG + Intronic
1058113582 9:101058356-101058378 GACTCTGAGGAGGTGGGGGTGGG + Intronic
1059433644 9:114264224-114264246 AAGTGGGAGGAGGAGGGGGCCGG + Intronic
1059640041 9:116207535-116207557 TCCTCAGAGGAGGAGTTGGCAGG + Exonic
1060658581 9:125389286-125389308 TGCTCTGAGGAGGAGCAGGTAGG - Intergenic
1060661973 9:125409591-125409613 TGATCAGAGGAGGAGGGGGCAGG + Intergenic
1061533663 9:131234177-131234199 TACTCCAGAGAGGAGGGGGCCGG + Exonic
1061601710 9:131674790-131674812 TTCTCTGAGGAGTAGGGGACAGG - Intronic
1061695957 9:132373657-132373679 TACTCTCAGGAGGCTGAGGCAGG + Intergenic
1061724267 9:132573058-132573080 AGCACTGAGGAGGCGGGGGCAGG - Exonic
1061749927 9:132770477-132770499 CACCCTGTGGAGGAGCGGGCTGG + Intronic
1062215070 9:135384625-135384647 GACTCTGCTGAGGTGGGGGCAGG + Intergenic
1062497015 9:136836702-136836724 TTCTGGGAAGAGGAGGGGGCTGG - Intronic
1062620071 9:137416664-137416686 CCCTCTGAGGAGGATGGGGACGG + Intronic
1062711222 9:137976150-137976172 GACAGTGAGGAGCAGGGGGCTGG + Intronic
1203524022 Un_GL000213v1:68987-69009 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1185880554 X:3736230-3736252 GGCTTGGAGGAGGAGGGGGCTGG - Intergenic
1185891904 X:3829217-3829239 TACCCTGAGCAGCTGGGGGCTGG + Intronic
1185897009 X:3867631-3867653 TACCCTGAGCAGCTGGGGGCTGG + Intergenic
1185902127 X:3906057-3906079 TACCCTGAGCAGCTGGGGGCTGG + Intergenic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1189459006 X:41221929-41221951 TATTCAGAGAAGGAGGGGACAGG + Intronic
1190340796 X:49293883-49293905 TACTCAGAGGCGGAGGAGGGAGG + Intronic
1190360104 X:49640644-49640666 TTTTCTGAGGAGGTGGTGGCAGG - Intergenic
1191670598 X:63745106-63745128 CACTCTGAGGGGGTGGGGGGTGG + Intronic
1192216467 X:69162844-69162866 GATAGTGAGGAGGAGGGGGCTGG - Exonic
1192503179 X:71666282-71666304 AACACTGAGGTGGAGAGGGCCGG + Intergenic
1192503629 X:71668285-71668307 AACACTGAGGTGGAGAGGGCCGG - Intergenic
1192859242 X:75048269-75048291 TACTCTAAGGGGGTGGGGGTAGG + Intergenic
1195692476 X:107638673-107638695 CACTTTGGGGAGCAGGGGGCAGG - Intronic
1196862293 X:120039720-120039742 TTCTCTGAGGAGGAGGAGCAAGG - Intergenic
1196880809 X:120196624-120196646 TTCTCTGAGGAGGAGGAGCAAGG + Intergenic
1200034620 X:153319456-153319478 TACCCTGAGGAGGATGCAGCTGG - Intergenic
1200149584 X:153944694-153944716 AACCCTGAAGAGGAGGGGGAGGG - Intergenic
1200784599 Y:7249122-7249144 GGCTTGGAGGAGGAGGGGGCTGG + Intergenic
1201492200 Y:14554455-14554477 TACTCTGAGGAGGTTGAAGCAGG - Intronic
1201989668 Y:20009851-20009873 TATTCTGAGGAGCAGGGTCCAGG - Intergenic