ID: 1079249736

View in Genome Browser
Species Human (GRCh38)
Location 11:18778719-18778741
Sequence GGCACATGGCCAGCCTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079249736 Original CRISPR GGCACATGGCCAGCCTGTAC AGG (reversed) Intronic
901051183 1:6426580-6426602 GACACCTGGACAGCCTGGACAGG + Intronic
901762702 1:11480848-11480870 GGCAGAAGCCCAGCCTGGACAGG + Intronic
902979627 1:20113622-20113644 GTCACATGGCCAGACTGTGCAGG + Exonic
905205155 1:36339214-36339236 GGCACATGGGCAGTCTGTCTGGG + Intergenic
906264174 1:44416504-44416526 GGCACAGGGGCAGCCTGAAGAGG - Intronic
907289235 1:53402343-53402365 GGCACCTGCCCAGCCTTTGCAGG + Intergenic
912082499 1:105953968-105953990 GGCACATGCGCAGGATGTACTGG + Intergenic
913077211 1:115350952-115350974 GCCTCATGTCCAGCCTGGACAGG - Intergenic
915658992 1:157386094-157386116 GGCACATGTGCAGGATGTACAGG + Intergenic
916599431 1:166277324-166277346 GGCATACAGCCAGCCTGTCCAGG - Intergenic
917191664 1:172424926-172424948 GCCACAGGGCCAGCCTGGAGTGG + Intronic
922190699 1:223316268-223316290 GGCACAAGGCCAGCCACTTCTGG + Intronic
924438622 1:244068152-244068174 AGCACATGGCCAGCATGCATGGG - Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1065386557 10:25139455-25139477 GGCACATGGCCACAGTGTATGGG - Intergenic
1065598693 10:27346123-27346145 GGCACATGTGCAGGATGTACAGG + Intergenic
1066616331 10:37298728-37298750 GGATCATGGCCAGCCTGCAGGGG + Intronic
1067052116 10:43027715-43027737 GGCACAAGGCCAGCCTGGATGGG - Intergenic
1069911681 10:71763577-71763599 TGGAGCTGGCCAGCCTGTACTGG + Intronic
1071731043 10:88248891-88248913 GGCACATGGACAGCATGTTCAGG - Intergenic
1072692340 10:97580389-97580411 AGCACAAGGCCAGCATGAACAGG - Intronic
1073447666 10:103591058-103591080 GGCACATGGACAGGCTGCAGAGG + Exonic
1073549624 10:104385790-104385812 GGAACATGGTCAGCCTGTACAGG - Intronic
1075711300 10:124532093-124532115 GTCACAGGGCCAGCCTGAAGGGG - Intronic
1076747409 10:132521360-132521382 TGCACAGGGCCAGGCTGTCCTGG + Intergenic
1079249736 11:18778719-18778741 GGCACATGGCCAGCCTGTACAGG - Intronic
1083920211 11:65778355-65778377 GGCACATGGACAGCCTCCAGGGG + Exonic
1083962794 11:66023665-66023687 GGCACAGGACCAGCCTGTTGGGG - Intronic
1084744864 11:71163327-71163349 GGCACAGGGTCTGCCTGTAATGG + Intronic
1084755467 11:71235728-71235750 GGCAAAAGGCCACCATGTACAGG + Intronic
1086431228 11:86738983-86739005 GACACAAGGCCAGCCCATACAGG - Intergenic
1089155081 11:116395679-116395701 GCCCCATGCCCAGCCTGTATGGG + Intergenic
1090404453 11:126468464-126468486 GAAGCATGGCCAGCCTGTGCTGG + Intronic
1097520697 12:60666871-60666893 GGCACATGTGCAGTATGTACAGG + Intergenic
1099307545 12:80976776-80976798 GGCACATGTACAGCATGTGCAGG + Intronic
1100901781 12:99249736-99249758 GGCACATGGCCACGCTGTGAGGG - Intronic
1102456111 12:113071743-113071765 GGTCCATGGCCAGCCTGGGCCGG + Intronic
1104050312 12:125190121-125190143 GGCACAGGGACCGCCTGTTCAGG + Intronic
1104109421 12:125690679-125690701 GCTACATGGCCAGCATGTACCGG + Intergenic
1104628276 12:130377648-130377670 GGGACATGGCCAGGATGGACTGG - Intergenic
1113611208 13:111646039-111646061 GCCACAGGGCCAGCCTCTGCTGG - Intronic
1115694410 14:35881246-35881268 GGCATACAGCCAGCCTGTCCAGG + Intronic
1117746371 14:58873738-58873760 GGCAAAGGGCCAGCCTTTACAGG - Intergenic
1119706862 14:76788482-76788504 GGCACAGGGCCAGCTGGGACAGG + Exonic
1122047795 14:99035946-99035968 GGCCCTGGGCCAGCCTGTTCAGG - Intergenic
1122415054 14:101545390-101545412 AGCACATGGGCAGCCTCTAGGGG + Intergenic
1122829606 14:104389361-104389383 AGCACATGGCCAGCCTCCAGTGG + Intergenic
1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG + Intronic
1127074071 15:55309264-55309286 GGAACATATCCAGCCTATACTGG - Intronic
1131425766 15:92344368-92344390 GGCCCCTGGCCAGCCTGCTCAGG + Intergenic
1133888213 16:9852061-9852083 GGCACATTTCCTGACTGTACAGG - Intronic
1137908303 16:52349225-52349247 TTTACATGGCCAGCCTTTACGGG - Intergenic
1140267552 16:73433708-73433730 GGCAGACGCCCAGCCTGTACTGG + Intergenic
1140277470 16:73523442-73523464 GGGACAGGGCCACCCTGCACAGG - Intergenic
1140877283 16:79164398-79164420 GGCACAAGGGCAGCCTGTCGGGG - Intronic
1141976037 16:87517370-87517392 AGGTCATGGCCAGCCTGTGCTGG + Intergenic
1147739967 17:42665849-42665871 GGCCCAGGGCCAGCCTGGCCTGG - Intronic
1152224132 17:79084909-79084931 GGCCCATGTCCACCCTGCACAGG - Intronic
1152349251 17:79774653-79774675 GGCAAATGGGCAGGCTGTTCTGG - Intergenic
1155364473 18:25036238-25036260 GGGCCACGGCCAGCCTGTATAGG + Intergenic
1157223054 18:45840735-45840757 GGATCAGGCCCAGCCTGTACAGG - Intronic
1161274979 19:3410877-3410899 GCCACATGGCCAGGTTGTGCTGG + Intronic
1166321240 19:42020423-42020445 GGCACATGGACAGGCTCAACAGG + Intronic
1167447183 19:49544486-49544508 GGCAAGTGGCCAGACTGTGCAGG + Intronic
1168301281 19:55406711-55406733 GACACGAGGCCAGCCTGTAATGG + Intronic
925978276 2:9156169-9156191 GGCACATGGGCAGAGTGTGCTGG - Intergenic
926001719 2:9338805-9338827 GGCACCTGCCCAGCCCGCACTGG - Intronic
927485671 2:23486890-23486912 GGCACTTGGCCAGCCCTCACTGG - Intronic
932569481 2:72931072-72931094 GGAAGATGGCCAGGCTGCACAGG + Intronic
932731986 2:74227921-74227943 GGCCCTTGGCCACCCTGTTCTGG + Intronic
936451259 2:112635506-112635528 GGCACATGGGGAGAGTGTACAGG + Intergenic
937076474 2:119111119-119111141 AGCCCATGGCCAGCCTGGGCTGG - Intergenic
944077777 2:195751718-195751740 GGCACATGATGAGCTTGTACAGG + Intronic
945785702 2:214233909-214233931 GGTACATGCGCAGCATGTACAGG + Intronic
1168741173 20:192801-192823 GGAACATATCCAGCCTATACTGG - Intergenic
1168861745 20:1050627-1050649 GACAGATATCCAGCCTGTACTGG + Intergenic
1170411064 20:16092433-16092455 GGCACAAGGCCTGCCTGGGCAGG - Intergenic
1173384199 20:42573250-42573272 TGCACAAGCCCAGCCTGCACTGG + Intronic
1174443339 20:50573669-50573691 GGCACATGGTCAGGCTGACCCGG + Intronic
1175251707 20:57613893-57613915 GGCACCTGCCCAGACTGTGCGGG + Intronic
1175797268 20:61779713-61779735 GGCACATGGCTGCCCTGCACGGG + Intronic
1175900863 20:62359419-62359441 GGCACATGGCCAGCGGGTCCTGG - Intronic
1182290800 22:29278055-29278077 GGCATACAGCCAGCCTGTCCAGG + Exonic
1182368868 22:29797042-29797064 GGCACCTGGGCAGCTTGTCCAGG + Intronic
1184115724 22:42421030-42421052 GTCACAGGGCCAGCCTGTAGAGG - Intronic
1184965432 22:47968515-47968537 TGCACATGGCCAGGATGTATTGG - Intergenic
949405785 3:3713050-3713072 GGCACATGCCCAGCATACACAGG + Intronic
953137043 3:40190198-40190220 GGCACCAGGCCAGACTGTCCTGG + Exonic
954104456 3:48402484-48402506 GGCACATGGCCCCCCTCTCCCGG + Intergenic
954713195 3:52514909-52514931 GGCGCATGGTCAGTCTGTCCTGG + Intronic
954750431 3:52810447-52810469 GGCAGAAGGCCAGGCTGGACTGG + Intergenic
961202388 3:125055531-125055553 GGCGCCTGGCCAGTCTGTGCTGG - Intronic
961449884 3:126997915-126997937 GGCTCATGGCCAGCCTGGCAGGG + Intronic
962278621 3:134033741-134033763 GGCACATGGCCAGGCTGCTGGGG + Intronic
962733008 3:138300146-138300168 GGCACATTGAGATCCTGTACAGG + Intronic
963809258 3:149758570-149758592 GGAACATATCCAGCCTATACTGG - Intergenic
965620793 3:170640769-170640791 CACACATGGCCCACCTGTACGGG + Intronic
967171933 3:186828560-186828582 GGGACATGGCCAGCTCGTGCTGG + Intergenic
969354768 4:6618946-6618968 AGCACAGGGCCAGCCTGCCCTGG + Intronic
969584497 4:8084248-8084270 GGCCCATGGCAGGCCTGTCCCGG - Intronic
970834606 4:20387643-20387665 GGAACTTGGCCAGCCAGTGCCGG + Intronic
971396467 4:26232266-26232288 GGCACATGTGCAGCATGTGCAGG + Intronic
972179281 4:36443788-36443810 GGCACATATTCAGCCTATACTGG - Intergenic
973239272 4:47939830-47939852 GGCACATTGCTAGCGTGTTCAGG - Intronic
976280982 4:83326718-83326740 GGAACAGGGCCAGCCTGGAGTGG - Intronic
981790377 4:148529647-148529669 CACACATGTCTAGCCTGTACAGG - Intergenic
985706815 5:1406227-1406249 GGCAGCGGCCCAGCCTGTACTGG - Exonic
986838260 5:11666802-11666824 GGCACATGTGCAGAATGTACAGG + Intronic
988267853 5:28974135-28974157 GACACATGGCAAGGCTGTGCAGG + Intergenic
988776960 5:34485609-34485631 TGCACCTGGCCACCCTGCACAGG + Intergenic
988882630 5:35520082-35520104 GACACAAGGCCAGCCCGTGCTGG + Intergenic
989466736 5:41765205-41765227 GGCACATGGCCACCCCTAACTGG - Intronic
993567543 5:89493376-89493398 GGTACATGGTAAGGCTGTACAGG - Intergenic
994028929 5:95118179-95118201 GGCACATGTGCAGGATGTACAGG - Intronic
996777965 5:127153404-127153426 GGTACATGTGCAGCATGTACAGG + Intergenic
1002534856 5:179870469-179870491 AGCACCTGGCTAGCCAGTACTGG - Exonic
1004872578 6:19922365-19922387 GGCACATGGCAGGCCTGGCCAGG - Intergenic
1007741171 6:44010480-44010502 GGCACCTGGCCATCCTGCAGAGG + Intergenic
1008520201 6:52355793-52355815 GACACATGGACAGCCAGTTCTGG + Intergenic
1008887615 6:56448209-56448231 GGCAACTGGCCAGCTTCTACAGG - Intergenic
1012548687 6:100448624-100448646 GGGACATGTCCAGGCTGTACTGG + Exonic
1013474826 6:110497535-110497557 GGCCCATGGCCAGGCTGTGAAGG + Intergenic
1019149142 6:169992870-169992892 GGCCCATGGCCCGCCTGGCCGGG - Intergenic
1019413434 7:916723-916745 GGCACACAGCCAGCCTGTGCAGG - Intronic
1024963827 7:55004680-55004702 GGCGCCTGGCCAGCCTGCCCGGG - Intergenic
1025661583 7:63560043-63560065 GGCACGTGGCCGCCCTGTCCTGG - Intergenic
1026657233 7:72267355-72267377 TGCTCATGGCCAGCCTTTCCTGG + Intronic
1029905137 7:104084703-104084725 GGCACATGTGCAGGATGTACAGG - Intergenic
1033165487 7:139035669-139035691 GGCACTTGCCCAGCATGTGCCGG + Exonic
1034303067 7:150033091-150033113 AGCACATTGTCAGCCTGAACGGG + Intergenic
1034484635 7:151351247-151351269 GTCACAGGGTCAGCCTGTGCTGG + Intronic
1034802981 7:154064177-154064199 AGCACATTGTCAGCCTGAACGGG - Intronic
1039463325 8:37763678-37763700 GGCAGATGGGCTGCCTGTTCGGG + Intronic
1041123261 8:54608651-54608673 GGTACATGTGCAGCATGTACAGG - Intergenic
1042484918 8:69338354-69338376 AGCACATGGTCAGCCGGTTCTGG - Intergenic
1044273422 8:90273107-90273129 GGCACCTGGCCAGCTTGAATGGG - Intergenic
1049235894 8:141512142-141512164 GGCACATGGCCACCCAGGAGTGG + Intergenic
1056345979 9:85695272-85695294 GCCTCATGGTCGGCCTGTACTGG + Intronic
1056684096 9:88745437-88745459 GGCCCAAGGCCAGCCAGTAAGGG + Intergenic
1057709708 9:97428247-97428269 GGCACAAGACCAGCCTGAAGAGG - Intronic
1059100023 9:111461874-111461896 GGCAAAGGGACAGCTTGTACAGG + Intronic
1059323266 9:113485672-113485694 GGAACAGGGCCAGCCAGTCCAGG + Exonic
1060967723 9:127721048-127721070 GGCACAGGGACAGACAGTACAGG + Intronic
1190331328 X:49237224-49237246 GGCTCATGGCCAGGCGGAACCGG - Exonic
1191915852 X:66200565-66200587 TGCACATGTCCAGCCTGGGCAGG - Exonic
1200836776 Y:7740054-7740076 GCCACATGGCCATCCTGCAGTGG + Intergenic
1201148494 Y:11080956-11080978 GGCACAGGGTCTGCCTGTAATGG + Intergenic