ID: 1079249954

View in Genome Browser
Species Human (GRCh38)
Location 11:18780136-18780158
Sequence CAGGCTCTGTCAGGTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079249949_1079249954 10 Left 1079249949 11:18780103-18780125 CCATCAGCTACAAAGGTCTGCTT 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1079249954 11:18780136-18780158 CAGGCTCTGTCAGGTGTTCCTGG 0: 1
1: 0
2: 0
3: 21
4: 210
1079249947_1079249954 20 Left 1079249947 11:18780093-18780115 CCAGGCAGTGCCATCAGCTACAA 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1079249954 11:18780136-18780158 CAGGCTCTGTCAGGTGTTCCTGG 0: 1
1: 0
2: 0
3: 21
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079249954 Original CRISPR CAGGCTCTGTCAGGTGTTCC TGG Intronic
900239717 1:1610041-1610063 CGGGCTCTCCCAGGTGTGCCAGG + Intergenic
900397978 1:2461055-2461077 CAGGGTCTGTCAGGAGCTGCTGG - Intronic
901316457 1:8313070-8313092 CGGCCTCTGCCAGGTGTTGCAGG + Intergenic
901622984 1:10604154-10604176 CAGTGCCTGTCAGGTGGTCCCGG + Intronic
904774801 1:32900202-32900224 CAGGCTCAGTCCAGTGCTCCAGG - Intronic
905101278 1:35524412-35524434 CAAGCTTTGTCAGGTGACCCTGG + Intronic
907756336 1:57314344-57314366 CAGGCTCTGTCAGCTGAAGCTGG + Intronic
912473778 1:109923382-109923404 AAAGCTCTGGCAGGTGCTCCTGG - Exonic
915324048 1:155071381-155071403 CAGGCGCTGGGAGGTCTTCCAGG + Intergenic
916141119 1:161699120-161699142 CAGGCTCTGTCAGGGGGTAGGGG + Intergenic
916388277 1:164301842-164301864 GAGGATCTGTCAGGGGTTCCAGG + Intergenic
916600765 1:166291209-166291231 CAGGCTGTGTCAGATCTTCCTGG - Intergenic
918821438 1:189260624-189260646 CAGGGCCTGTCAGGTGGTGCGGG - Intergenic
921000347 1:211037668-211037690 CAGGCTCTGGCCGATGTGCCTGG - Intronic
922807365 1:228397349-228397371 GAGGCTCTGACATGTGTGCCAGG + Intronic
924837480 1:247666976-247666998 CATTATCTGTCAGGTGTTCTTGG + Intergenic
1063375451 10:5551747-5551769 CAGGCTCTCTAAGGTGCACCTGG + Intergenic
1063448639 10:6136304-6136326 CAGGCTCTGGCAGGTCAGCCCGG - Intergenic
1064070501 10:12225050-12225072 CAAGCTCTGTAAGGGGTTCTTGG - Intronic
1064217913 10:13416198-13416220 GAGGCTCGGTCACGTGTTTCTGG + Intergenic
1069773911 10:70915939-70915961 CGGCCTCTGTCAGGTGCTCCAGG - Intergenic
1072207277 10:93215517-93215539 CAGGATCTGTCAGAGGTGCCTGG + Intergenic
1072693242 10:97584989-97585011 CAGGCTCTGTCAAGCTGTCCAGG + Intronic
1072709768 10:97708478-97708500 CAGCCCCTGACAGGTGTTCTAGG - Intergenic
1073237389 10:102029581-102029603 CAGCTTCTGACAGCTGTTCCTGG - Intronic
1074754887 10:116617109-116617131 CAGGCTCTGACAGGTGCAACTGG - Intergenic
1075883447 10:125875369-125875391 CTGGCTCAGTAAGATGTTCCAGG - Intronic
1076345822 10:129778357-129778379 CAGGGGCTGTCAAGAGTTCCCGG - Intergenic
1076669196 10:132110287-132110309 CAGGCACGGGCAGGTGCTCCCGG + Intronic
1077055926 11:593110-593132 CAGGCGCTCTCAGCTGTGCCAGG - Intronic
1077817064 11:5696286-5696308 GAGGTTCTGTCAGGAGCTCCAGG - Exonic
1078363843 11:10691054-10691076 CAGGCTCTGTGAGGTGACCCAGG + Intronic
1079249954 11:18780136-18780158 CAGGCTCTGTCAGGTGTTCCTGG + Intronic
1081570697 11:44289064-44289086 CAAGCACGGTCAAGTGTTCCAGG + Intronic
1082759165 11:57109793-57109815 CTGGCTGTGCCAGGTTTTCCTGG + Intergenic
1084266747 11:68008919-68008941 CTGGCTCTGACAGGTGTATCCGG + Intronic
1085392687 11:76190450-76190472 CAGGCTCTGTGAGGAGGCCCAGG - Intronic
1085408298 11:76277043-76277065 CAGGCCCTGTCCTGGGTTCCGGG + Intergenic
1086356619 11:86008061-86008083 CATGCTCTGTCAGGTAGGCCAGG + Intronic
1087210622 11:95443214-95443236 TAGGCTCTTTCACATGTTCCAGG - Intergenic
1090993069 11:131838247-131838269 CGGGCTCTGTCATGTGTGTCAGG + Intronic
1091234325 11:134010015-134010037 CAGGCACTCTCTTGTGTTCCCGG + Intergenic
1093340571 12:17968003-17968025 CTGGCACTGTAAGATGTTCCAGG + Intergenic
1094482722 12:30897593-30897615 CAGGCTGTGTGAGGTCTTGCAGG - Intergenic
1097258734 12:57700540-57700562 CAGGCACTGTGATGTGTTGCTGG + Intronic
1099441875 12:82708604-82708626 CAGCCCCTGTCACGTGGTCCTGG + Intronic
1099556087 12:84109407-84109429 GTGTCTCTGTCAGGTGTTGCGGG - Intergenic
1099892809 12:88610395-88610417 CAGGGTCTTTCAGGTGTTGGGGG + Intergenic
1101011548 12:100456146-100456168 CACAGTTTGTCAGGTGTTCCGGG - Intergenic
1101421679 12:104556000-104556022 CTGCCTCGGTCAAGTGTTCCAGG - Intronic
1102542469 12:113632243-113632265 CAGGCTCTGGCACCTGTCCCTGG + Intergenic
1103890880 12:124238280-124238302 CAGGCTCTCTCACCTGTTACAGG - Intronic
1104394304 12:128418826-128418848 AAGACTCTGGCAGGTGTTCAAGG - Intronic
1105785122 13:23740780-23740802 CAAGCCCTGTCAGGTGTGGCAGG + Intronic
1106107951 13:26750638-26750660 CAGGGTTTGTCAAGTGTTCATGG + Intergenic
1106209088 13:27624334-27624356 CACTACCTGTCAGGTGTTCCAGG - Intronic
1106636140 13:31530214-31530236 CAGGGCCTGTCAGGGGTTGCGGG + Intergenic
1107151088 13:37112524-37112546 CAGCCTCTGTCATGTGACCCCGG + Intergenic
1107978320 13:45711601-45711623 CCAGCTCCTTCAGGTGTTCCTGG - Intronic
1109505421 13:63294552-63294574 CAGCCTCAGGCAGGTATTCCAGG - Intergenic
1112458515 13:99583205-99583227 CAGGAGCTGCCAGATGTTCCAGG - Intergenic
1114312002 14:21476635-21476657 CATACTCTGGAAGGTGTTCCAGG - Intronic
1115998960 14:39222729-39222751 CACGCTATGTCAGGAGTTTCTGG - Intergenic
1116679916 14:47953906-47953928 CAGCCTTTGTCAGGTCTTTCGGG + Intergenic
1117769422 14:59118099-59118121 CTGGCTCTGGCAGGTTTTACAGG + Intergenic
1118455686 14:65944064-65944086 CAGGCTGTGTTAGGGGTCCCTGG + Intergenic
1119959723 14:78841412-78841434 CAGGCTCTTTCATGTTTTTCTGG + Intronic
1120493931 14:85210329-85210351 CAGGCTCATTCAGGTGTTGGAGG + Intergenic
1121262502 14:92576591-92576613 CACGCTCTGGAAGGTGATCCTGG - Intronic
1121318602 14:92977260-92977282 TAGGCTCTGTAAGGTGATCTTGG - Intronic
1122605973 14:102947975-102947997 AAGACTCTGGCAGGTGTTTCAGG + Intronic
1124650153 15:31468500-31468522 CAGACTGTTTCTGGTGTTCCTGG - Intergenic
1124666295 15:31595766-31595788 CAGCCTCCTTCAGGTGTGCCAGG + Intronic
1125077582 15:35637448-35637470 CAGGCTCTGTGACATGTTTCAGG - Intergenic
1125118604 15:36125355-36125377 CAGGGTCTGTCAGGGGGTCGGGG - Intergenic
1127482388 15:59389693-59389715 CAGGCTCATTCAGGCCTTCCTGG - Intronic
1128183059 15:65621827-65621849 CAGGCTTGGTCAGGTGTACCGGG + Intronic
1129508195 15:76100514-76100536 CAGTCTTTGTCAGATTTTCCTGG + Intronic
1130875959 15:88014688-88014710 CAGGCTCTCTCAGGTGCTCAAGG + Intronic
1131593795 15:93775951-93775973 CAGGCTGTGTGAGGTGTTTTAGG + Intergenic
1132270149 15:100517032-100517054 CAGGCTCTGTGAGGAATTCAGGG - Intronic
1133740492 16:8647477-8647499 CAGGCACTGCCAAATGTTCCTGG - Exonic
1133844082 16:9438315-9438337 CAGGCACTGTCACATGTCCCCGG + Intergenic
1133898665 16:9952718-9952740 CAGGCTCTGTCACGTGTACTTGG - Intronic
1134817682 16:17219557-17219579 CAGGGTCTCTCTGGTCTTCCAGG - Intronic
1134838922 16:17385335-17385357 CAGCCTCTGGCAGATGTTCCAGG - Intronic
1135081984 16:19444217-19444239 CACTCTCTGCCAGGTGCTCCTGG + Exonic
1136030436 16:27498939-27498961 CAGGCTCTGCCATGGGTGCCGGG + Intronic
1139511254 16:67429865-67429887 CAGGCTCTGCCAGGGTTTCAGGG - Intergenic
1140702079 16:77590180-77590202 CAGACTCTGTCTGTTGTTCATGG + Intergenic
1141134648 16:81457585-81457607 CAGGCTCTGCCACATGTCCCCGG + Intronic
1141782606 16:86173839-86173861 AGGGCTCTGCCTGGTGTTCCTGG + Intergenic
1144570899 17:16398220-16398242 CAGGCTCTCTCGGGTGACCCTGG + Intergenic
1144663645 17:17087612-17087634 CATGCTCTGACAGGTGTCCTCGG - Intronic
1145363015 17:22227830-22227852 CAGGCTCTCTCGGGTGACCCTGG + Intergenic
1146767820 17:35539890-35539912 CAGGTTCTGTCAGCTCTTCCGGG + Intergenic
1150891460 17:69155136-69155158 CATGCTTTGTCATGTTTTCCAGG - Exonic
1153762849 18:8348390-8348412 CAGGTCCTGTCAGATGTACCGGG - Intronic
1156337473 18:36184306-36184328 CAGGCTCAGTGAGGTGCACCAGG + Intergenic
1156387268 18:36616955-36616977 CAGACTTTGTCTGTTGTTCCGGG - Intronic
1156580317 18:38367454-38367476 CAGGTTCTGTAATGTGTTACAGG - Intergenic
1156841318 18:41613437-41613459 GAGGCTCTGTCAGCAGCTCCAGG + Intergenic
1157786063 18:50483709-50483731 CAGGTTCAGCCAGATGTTCCAGG - Intergenic
1157824127 18:50797279-50797301 CAGGCACTCTCATTTGTTCCTGG + Intronic
1158183408 18:54743837-54743859 CATGCTCTGTCACGTGTTAATGG + Intronic
1159451584 18:68609342-68609364 CAGGCTCTGTCACATATTGCTGG + Intergenic
1160052575 18:75449398-75449420 CTTGTTCTGTAAGGTGTTCCAGG - Intergenic
1160619689 18:80162060-80162082 CAGGCTCTGGCACATGCTCCAGG + Intronic
1161792108 19:6366331-6366353 CAGGCTCTGTTTGGTGTGCTTGG - Exonic
1162380404 19:10328581-10328603 AAGACTCTCTCAGGTGCTCCGGG + Intronic
1164608215 19:29614959-29614981 CAGTTTCTGGCAGGTGTTCTGGG + Intronic
1164638009 19:29805619-29805641 CAGAGTGTGTGAGGTGTTCCTGG + Intergenic
1165005090 19:32798375-32798397 CAGGCTCTGCCACCTGATCCTGG + Intronic
925140631 2:1547488-1547510 CAGGCTCCCCCAGGTGGTCCAGG + Intergenic
927492184 2:23527901-23527923 CAGGCTCTGCCAGGAGATCAAGG + Intronic
928331543 2:30361459-30361481 CAGGCACTGGCAGGTCTTCCAGG - Intergenic
929093077 2:38239158-38239180 CTGGCTCTGCCAGGTGATCATGG - Intergenic
929826923 2:45316013-45316035 AAGGCTGAGTCAGCTGTTCCAGG - Intergenic
931094914 2:58928474-58928496 GAGGCTCTGGCTTGTGTTCCTGG + Intergenic
934197385 2:89850663-89850685 CAGGTCCTGTCAGGGCTTCCAGG - Intergenic
935671722 2:105561906-105561928 CAGCCTCTCTCAGATGTTCTGGG + Intergenic
938056016 2:128215295-128215317 CAGCCTCTCCCAGGTGTCCCCGG + Intergenic
943161880 2:184265002-184265024 CAGGGTCTGTCGGGTGTTAGGGG - Intergenic
943779724 2:191809944-191809966 CAGGGCCTGTCAGGGGTGCCGGG + Intergenic
945765278 2:213968687-213968709 CTGGCTCTATCAGGTGTTAATGG + Intronic
946072823 2:217048934-217048956 CAGCTTCTGTCTGGTGTTGCTGG + Intergenic
948653300 2:239462374-239462396 CTGGCTCTGTCAGGAGCTCAGGG - Intergenic
948926425 2:241101618-241101640 CAGCGACTGCCAGGTGTTCCTGG - Intronic
949058816 2:241944841-241944863 CAGTCTCTGCCAGGTGCTCCAGG - Intergenic
1168968474 20:1914502-1914524 CAGGCTCAGTCCTGGGTTCCAGG + Intronic
1169867610 20:10218109-10218131 CAGGCTCTCTGAGCTGTTGCAGG - Intergenic
1170240847 20:14164680-14164702 CAGGCTCTGGGAGGAGTACCCGG + Intronic
1170413451 20:16115148-16115170 CAGGATCTTTCAGGTGTTTATGG - Intergenic
1171975704 20:31593537-31593559 CAGGCTCTGTGAGGTGGGCAGGG + Intergenic
1172313899 20:33938807-33938829 CAGGCTCTGGCAAGTGTTCTAGG - Intergenic
1173059791 20:39650581-39650603 CTGGCTCTGTCCGCTGTTCCTGG + Intergenic
1175881919 20:62264295-62264317 CAGCCTTTGTCAGGTGCTCAGGG + Intronic
1176232439 20:64039177-64039199 CCGGCTCTGTCAGCGGCTCCCGG + Intronic
1177052831 21:16259377-16259399 CAGGGTCTGTCACCTGTTCTGGG + Intergenic
1177087230 21:16721099-16721121 CAGGACCTGTCAGGGGTTGCAGG + Intergenic
1179902141 21:44399835-44399857 CAGGCCCTGCCGGGGGTTCCAGG - Intronic
1179975262 21:44861804-44861826 CAGGCTGTGTCCTGTGTTCTTGG - Intronic
1180728736 22:17965297-17965319 CAGGGTCTTTTAGGGGTTCCGGG - Intronic
1181646320 22:24233296-24233318 CGGGCTCTCTGAGGTGATCCAGG - Intronic
1181934801 22:26430308-26430330 CCGGCTCTCCCAGGTGTTCATGG + Intronic
1182977953 22:34641008-34641030 GAGACTCTGCAAGGTGTTCCTGG - Intergenic
1183086363 22:35489610-35489632 CAGGCTCTGTCAGCTGGCCCAGG + Intergenic
1183292310 22:37010348-37010370 CAGGCTCTGGCAGGTGAATCAGG - Intergenic
950789330 3:15460054-15460076 CAGACTCTGTCATGTATACCTGG + Intronic
951060887 3:18205891-18205913 CAGGGTCTGTCAGGCGTTGAGGG - Intronic
953702174 3:45205233-45205255 CAAGCTCTCTCAGCTGCTCCTGG - Intergenic
954135376 3:48579880-48579902 CAGGGTCTGTGAGGGGCTCCAGG + Intronic
955867682 3:63402295-63402317 CAGGCTTTGTCAGATGTCCCTGG + Intronic
961090827 3:124111262-124111284 CAGGCTCTTTCAGTTGTTATCGG - Intronic
961629615 3:128286620-128286642 CTGGCACTATAAGGTGTTCCAGG + Intronic
962735456 3:138321597-138321619 CATGCTCTTTCAGCTGCTCCAGG + Intronic
962919327 3:139936208-139936230 CTGGCTCTGTCAGGCGAGCCTGG + Intronic
963040982 3:141069609-141069631 CCGGCTCTGTGAGGTGCCCCGGG - Intronic
963617678 3:147563008-147563030 CAGGAACTGTCATGTGTACCTGG - Intergenic
969480650 4:7445281-7445303 CAGGCTCTGGCTGGTGTTTGAGG + Intronic
969673579 4:8602802-8602824 CGGGCTATGTCAGGTGCTCAGGG + Intronic
970778462 4:19706124-19706146 CAGGCACTGTCATTTGCTCCTGG - Intergenic
971490948 4:27211612-27211634 CAGCCTATGGCAGGTCTTCCTGG + Intergenic
972707981 4:41564324-41564346 GAGGCTATTTCAGGTTTTCCTGG + Intronic
974672173 4:65046513-65046535 CAGGTTTTGACAGCTGTTCCTGG + Intergenic
974955447 4:68634970-68634992 CAGGCTCAGTTAGGTGTTTATGG + Intronic
975779628 4:77824663-77824685 AAGGCCCTGTCAGGAGGTCCAGG - Intergenic
983620152 4:169752837-169752859 CAAGCTCTTTCATGTGTTGCAGG - Intronic
985801711 5:2008801-2008823 GTGGCTCTGCCAGGTATTCCAGG + Intergenic
989756995 5:44967625-44967647 CAGCCTCTGCCAGGTGCTCATGG + Intergenic
991646354 5:68804190-68804212 CAGGCCCTGTCAGGTGGCCATGG - Intergenic
992381859 5:76245331-76245353 CAGGCTGTGGAAGGGGTTCCAGG + Intronic
992863689 5:80937288-80937310 CAGCTTCTGTCAGGGGCTCCAGG + Intergenic
995836909 5:116408422-116408444 CTGGATCTGGAAGGTGTTCCTGG + Intronic
995864308 5:116675066-116675088 CAAGTTCAGTCAGGTGTTTCAGG - Intergenic
995869526 5:116729797-116729819 CAGGGACTGCCAGGAGTTCCAGG - Intergenic
996339339 5:122418905-122418927 CAGTCTCTGCAAGGTTTTCCTGG - Intronic
996408241 5:123127921-123127943 CAGGGTCTGTCAGGGGGTCGGGG - Intronic
997211732 5:132080871-132080893 CAGGCTTTGTCAGGAGCTCAAGG - Intergenic
997280674 5:132642589-132642611 CAGCCTCTGTCAGGCCTTCAGGG + Exonic
999891932 5:155987363-155987385 CACGCTCTTCCATGTGTTCCAGG + Intronic
999905086 5:156132206-156132228 CAGGTACTGTCAGGTGTACCTGG + Intronic
1001901022 5:175429796-175429818 CTGGCTCTATAAGATGTTCCAGG - Intergenic
1002423459 5:179162500-179162522 CAGGCTCATTCAGGTGGTCACGG + Intronic
1002972926 6:2042791-2042813 CAGGCTTTGTTAGTTGTTACTGG - Intronic
1007924403 6:45640048-45640070 CAGGCCCTGTCAAGTCTTTCAGG + Intronic
1012923362 6:105243195-105243217 CAGGCACTGAGAGATGTTCCAGG + Intergenic
1014844754 6:126261834-126261856 GAGGCTCTGTCAGGCTTTCCAGG + Intergenic
1017930103 6:158944737-158944759 GAGGCTCTGACAGGGGTTCAGGG + Intergenic
1018224016 6:161610551-161610573 CAGGCACTGTGAGGAGTACCAGG + Intronic
1019005366 6:168792316-168792338 AAGGCTCTGAAAGGTGTTTCTGG + Intergenic
1019155702 6:170037591-170037613 CAGGCTCTGGCAGGTAGTCATGG - Intergenic
1019273635 7:164525-164547 CAGGCCCTGCAATGTGTTCCAGG - Intergenic
1020243065 7:6410275-6410297 GAGGCTGTGTCAGGACTTCCTGG + Exonic
1020824940 7:13015812-13015834 CTGGATTTCTCAGGTGTTCCAGG - Intergenic
1021554754 7:21908071-21908093 CAGGCTCTGGCAGCAGTTGCTGG - Intronic
1022454623 7:30547495-30547517 GAGGCTCTGTCAGAAGGTCCTGG - Intronic
1023535004 7:41199436-41199458 CAGGCTTTGTCAGCTTTTCCAGG - Intergenic
1024034768 7:45497894-45497916 CATTCTCTGACAGGTGTTCCTGG - Intergenic
1024421206 7:49168996-49169018 CAGGGTCTGTCAGGAGGTGCCGG - Intergenic
1029201441 7:98841882-98841904 CAGCCTCTGCCAGGTGCACCGGG - Intergenic
1030539564 7:110813002-110813024 CATGCTGTGTCAGGTCTTCTAGG - Intronic
1034388725 7:150765034-150765056 CTGGCACTATAAGGTGTTCCAGG - Intergenic
1035077644 7:156191533-156191555 CAGCCTCTGTCTGGTTTTGCAGG + Intergenic
1035261125 7:157662367-157662389 CTGGCTCAGCCTGGTGTTCCTGG - Intronic
1035663470 8:1363988-1364010 CATCCTCTGTCAGGTGCACCAGG + Intergenic
1039388548 8:37158482-37158504 CAGGATCTGCCTGGTGTTCAAGG - Intergenic
1039394724 8:37215489-37215511 CAGGCTCTGTAAGGTGGTAAGGG + Intergenic
1041205626 8:55495455-55495477 CAGCCTGTGGCAGGTGTTCCAGG + Intronic
1041658579 8:60378464-60378486 CAGGCTCAGTCAGCTGAGCCAGG + Intergenic
1042177068 8:66047399-66047421 CAGGTTCTATCAGGTCTTGCAGG + Intronic
1043304087 8:78772327-78772349 CAGGCTATGTCATGTGGTCAGGG - Intronic
1043629528 8:82311675-82311697 CAGGCTCTGTCAGTTTCTTCTGG + Intergenic
1045205090 8:100030409-100030431 CAGGCTCAGGCAGGTGCTTCAGG + Intronic
1045847866 8:106658278-106658300 CCGGCTCTGGCAGGTGTGCCTGG + Intronic
1046513663 8:115230386-115230408 CAGGGTCTGTCAGGTGGTGGGGG + Intergenic
1046673742 8:117086174-117086196 CAAGCTCTTTCATGTCTTCCAGG + Intronic
1047250872 8:123181511-123181533 CAGGCAGTGTCAGGTGCTACAGG - Intronic
1048331480 8:133473709-133473731 CAGACATTGTCAGGTGTCCCAGG - Intronic
1049659327 8:143812681-143812703 CAGGCTCTGGGAGCTGTCCCTGG - Intronic
1053285548 9:36847657-36847679 CAGGAGCTGTGAGGTGTGCCAGG + Intronic
1057882021 9:98799632-98799654 CAGGCCCTTTTTGGTGTTCCTGG + Intergenic
1060604218 9:124899626-124899648 CAGGCTCTGCCTGTTGCTCCTGG + Intronic
1060793185 9:126499243-126499265 GAGGCTCTGCCAGGGGTCCCGGG - Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1185716222 X:2344702-2344724 CAGGGTCTGTCAGGGGGTCAGGG + Intronic
1189381869 X:40507797-40507819 CAGGCTCTGGGAGGAGTCCCCGG - Intergenic
1193793105 X:85840914-85840936 CAGGCTGTGGCAGGTGTGGCTGG - Intergenic
1197899024 X:131348565-131348587 CAGGCACTGTTAGTTGTTCTTGG + Intronic
1198258856 X:134948499-134948521 GAGGCTCTTTCAGATGTCCCTGG + Intergenic
1199848319 X:151707448-151707470 CAGGCTCTGTGCTGTGTTCTAGG - Intergenic
1201980488 Y:19903341-19903363 CAGGTCCTGTCAGGTGTTTGGGG + Intergenic