ID: 1079251424

View in Genome Browser
Species Human (GRCh38)
Location 11:18790801-18790823
Sequence CAAGGTCACCAGAGAGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079251424_1079251433 26 Left 1079251424 11:18790801-18790823 CCACTAACTCTCTGGTGACCTTG 0: 1
1: 0
2: 2
3: 37
4: 225
Right 1079251433 11:18790850-18790872 TCCCCATCTGTAAAATGAGAAGG 0: 4
1: 31
2: 159
3: 508
4: 1469
1079251424_1079251426 -6 Left 1079251424 11:18790801-18790823 CCACTAACTCTCTGGTGACCTTG 0: 1
1: 0
2: 2
3: 37
4: 225
Right 1079251426 11:18790818-18790840 ACCTTGGTCCGCCACCTTACTGG 0: 1
1: 0
2: 0
3: 2
4: 48
1079251424_1079251428 -5 Left 1079251424 11:18790801-18790823 CCACTAACTCTCTGGTGACCTTG 0: 1
1: 0
2: 2
3: 37
4: 225
Right 1079251428 11:18790819-18790841 CCTTGGTCCGCCACCTTACTGGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079251424 Original CRISPR CAAGGTCACCAGAGAGTTAG TGG (reversed) Intronic
901130528 1:6960057-6960079 CCAGGTCACCAGGTAGTTGGTGG + Intronic
902287570 1:15416444-15416466 CAAGGACAACAGAGAGGCAGGGG + Intronic
902395213 1:16128761-16128783 CAGGGCCAGCAGAGAGTAAGTGG + Intronic
902598280 1:17523776-17523798 CCAGGCCACCAGAGATTGAGTGG - Intergenic
902798285 1:18813944-18813966 CAAGGTCACCCAAGAATCAGTGG - Intergenic
903892368 1:26578237-26578259 GAAGGTCACCAAACAGTTTGTGG - Intergenic
904026092 1:27504658-27504680 CAAGGTCACCAGCCAGCAAGTGG - Intergenic
905241016 1:36581559-36581581 CAGGGTCATCAGAGAGTCAGTGG + Intergenic
905333515 1:37226732-37226754 GAAGGGCAGCAGAGAGTTTGAGG - Intergenic
905601104 1:39252222-39252244 CAAGGCCACCAGAAAGCTATGGG - Intronic
905769597 1:40629012-40629034 CAAGATCACCTGGCAGTTAGGGG - Intronic
905923384 1:41733523-41733545 AAAGCTCACCTGAGAGTTGGTGG + Intronic
908433074 1:64077974-64077996 CCAGTACACCAGAGAGTTAAGGG - Intronic
910308629 1:85797438-85797460 AAAGATCACCATAAAGTTAGAGG + Intronic
912342980 1:108935916-108935938 AGAGGTGACCAGAGAGGTAGTGG + Intronic
912407415 1:109452321-109452343 CACGGACACCAGAGAGTGAGTGG + Intergenic
916075096 1:161196091-161196113 CAAGTTCACCACAGTGTTAATGG - Intronic
916274436 1:162978528-162978550 TAAGGTAACCAGAGAGTAAGCGG + Intergenic
918095286 1:181329303-181329325 CAAGGGGACCAGAGAGGAAGTGG - Intergenic
919055234 1:192562406-192562428 CCAGGCCTCCAGAGAGTTGGGGG + Intergenic
920034135 1:203055146-203055168 CAAGGCCACCCTATAGTTAGGGG + Intronic
921579532 1:216879640-216879662 CAATATCACCAGAGAGTTAATGG + Intronic
922533248 1:226360610-226360632 CAAGGTCCCAAGAGACTTTGGGG - Intergenic
922905585 1:229171313-229171335 CAAGGTCCCATGAGAGTGAGAGG - Intergenic
922974981 1:229777067-229777089 CAGTCTCACCAGAGAGTAAGGGG + Intergenic
923900477 1:238320711-238320733 CACGGACACCGGAGAGTGAGTGG - Intergenic
924287336 1:242501429-242501451 GAAGGTCATACGAGAGTTAGTGG - Intronic
924440058 1:244078489-244078511 CGAGGTCACCATAGAGTGACAGG + Intergenic
1067346003 10:45439670-45439692 CCAGGTCACCACAGAGCTTGGGG + Intronic
1069151364 10:64965136-64965158 CAAGGTCAGCACAGATTTAAGGG - Intergenic
1069579990 10:69559354-69559376 CAGGGTCACAACAGAGATAGTGG - Intergenic
1069797435 10:71062319-71062341 CCAGGCCACCAGAGAGCCAGGGG - Intergenic
1069946120 10:71986977-71986999 CAACGTCAGCAGAGAGTAAGTGG + Intronic
1071479587 10:86054966-86054988 CAAGATTCCCAGAGAGTGAGTGG - Intronic
1072383953 10:94904711-94904733 CACAGACACCAGAGAGTGAGTGG + Intergenic
1073476523 10:103757225-103757247 CAAAGTCACCAGAAAGTGACAGG - Intronic
1074160246 10:110830936-110830958 CAAGGTCAACAGCAAGTGAGGGG + Intronic
1074315327 10:112356352-112356374 CAAGGTCAACTCAGAGCTAGTGG - Intergenic
1074368055 10:112875992-112876014 CAAGGTCAACAGCAAGTCAGTGG - Intergenic
1074819234 10:117166481-117166503 CAAGGGCACCTGAGAGATGGGGG + Intergenic
1075497556 10:122938340-122938362 CAAGGTAACCAGCCAGTAAGTGG + Intronic
1075998753 10:126898492-126898514 CTATGTGACCAGAGAGATAGAGG - Intergenic
1077146900 11:1050485-1050507 CAAGGTCACCGGGGAGGGAGTGG + Intergenic
1078136586 11:8657123-8657145 CACGGACACCAGAGAGGTAGGGG + Intronic
1079173377 11:18117086-18117108 CAAGGACAAAAGAGAGTGAGGGG - Intronic
1079251424 11:18790801-18790823 CAAGGTCACCAGAGAGTTAGTGG - Intronic
1079343221 11:19630061-19630083 GAAGTTCACCACAGAGTTGGGGG - Intronic
1080059937 11:27946478-27946500 CAAGGCCACAAGCAAGTTAGAGG - Intergenic
1080726339 11:34902496-34902518 CAAGGGGACCAGAGTATTAGGGG + Intronic
1083622020 11:64053839-64053861 CAAGGTCACATGGGAGTTAGGGG + Intronic
1083804468 11:65065916-65065938 CAAGGTCACCAGATGGTTAGTGG + Intergenic
1084525744 11:69697037-69697059 CAAGGACACCAAAGAGTGAGAGG + Intergenic
1085023874 11:73225371-73225393 CAAGGTCACCAGTGAGCCAAGGG - Intronic
1086089132 11:82987587-82987609 CAAGGTCATCACTGTGTTAGTGG - Exonic
1086125843 11:83347641-83347663 GAAGGTCACAAGAAAGCTAGAGG - Intergenic
1086224452 11:84491009-84491031 CTAGGTCATCTCAGAGTTAGTGG + Intronic
1088532675 11:110827715-110827737 CAAGGACCCCAGAAACTTAGAGG + Intergenic
1088692179 11:112337537-112337559 CGAGATCACCAGGGAGGTAGTGG - Intergenic
1088727792 11:112654777-112654799 CAAGGAAACCAAAGAGTGAGAGG + Intergenic
1089752814 11:120663341-120663363 CAAGGTCACCTGACAAGTAGGGG + Intronic
1090735334 11:129608086-129608108 AAAGGTGATCAGAGAGATAGAGG - Intergenic
1090821618 11:130347604-130347626 CAAGGTCCCCAGATAATGAGTGG + Intergenic
1091884956 12:4010020-4010042 GAAGGCAACCAGTGAGTTAGTGG - Intergenic
1093331676 12:17851048-17851070 CATGGACACCAGAGGGTGAGTGG - Intergenic
1095233084 12:39765385-39765407 CAAGGTCATCAGGGAGTGACTGG - Intronic
1096388905 12:51214334-51214356 CAAGGGCACAGGAGAGTCAGTGG + Intronic
1096607883 12:52779675-52779697 CAAGGTCACCACATAGTGAGAGG - Intergenic
1099338725 12:81398981-81399003 CAAGCTCCCCAGAAATTTAGTGG - Intronic
1099339840 12:81415436-81415458 AAAGGTCACCAGAAACTTACTGG - Intronic
1100896965 12:99193736-99193758 CTAGGTCCCCAGAGATTCAGTGG - Intronic
1101881648 12:108629928-108629950 TGAGGTCACCAGATAGTGAGAGG - Intronic
1102702386 12:114850670-114850692 CAAAGTCACCAGCTAGTGAGTGG - Intergenic
1102816372 12:115869518-115869540 CAAGGCCACCAGAAAGCCAGGGG + Intergenic
1103265864 12:119629626-119629648 CAAAGTCACCAGAGAGCTCTTGG + Intronic
1104144196 12:126017230-126017252 CATTGACACCAGAGAGTAAGTGG - Intergenic
1104189292 12:126463566-126463588 CAAGGACAATAGAGAGTGAGGGG + Intergenic
1104975979 12:132552169-132552191 CACGGTCCCCAGAGAGCTGGAGG + Intronic
1112551737 13:100428029-100428051 CAAGGTCACCAGCTAGTAAGAGG + Intronic
1112804923 13:103154100-103154122 CCAGGTTCCCAGAGAGTTATGGG + Intergenic
1113083041 13:106536453-106536475 CAAAGTGACCAGAGATTTAGAGG + Intergenic
1113490996 13:110691817-110691839 CTTGGACACCAGAGGGTTAGGGG + Intronic
1114418662 14:22561250-22561272 AAAGGTCAACAGACAGTAAGTGG + Intergenic
1117869909 14:60189447-60189469 CAAGGTCACAAGCTAGTAAGTGG - Intergenic
1119575068 14:75712586-75712608 GAAGGAAAGCAGAGAGTTAGTGG - Intronic
1119671579 14:76523928-76523950 CAGTGACACCATAGAGTTAGGGG + Intergenic
1120031915 14:79651276-79651298 TATGGTCACCTGAGAGGTAGTGG + Intronic
1121019048 14:90567812-90567834 GACACTCACCAGAGAGTTAGAGG - Intronic
1122152033 14:99730644-99730666 CGAGGTCACAAGAGAGGGAGTGG - Intergenic
1124423281 15:29540568-29540590 CCAGATCACCATAAAGTTAGCGG - Intronic
1126748403 15:51850484-51850506 TAAGGTCATCAGAGAGTGAGGGG + Intronic
1128267825 15:66282054-66282076 CAATGTTACCAGGGAGGTAGAGG + Intergenic
1129190715 15:73936010-73936032 CAAGGGCACCATGGAGTCAGGGG + Intronic
1130105420 15:80925260-80925282 CAAGGTGACCTGCCAGTTAGTGG + Intronic
1131082409 15:89547645-89547667 CAAGGTCACTCGATAGTAAGTGG - Intergenic
1138087775 16:54149279-54149301 CAAGGTCACTTGACAGCTAGGGG + Intergenic
1140422024 16:74827421-74827443 CAAGGTTACCATGGAGTTGGAGG - Intergenic
1140564187 16:76022041-76022063 CAAGGTAACCATATAGATAGGGG + Intergenic
1141124641 16:81392499-81392521 CAAGTTCTCCAGAGAGGTAGAGG - Intergenic
1141646113 16:85368837-85368859 CAAGGTCACCCGAGAGTGATGGG + Intergenic
1141984455 16:87570916-87570938 CAAGGTCACTCGGGAGTGAGGGG - Intergenic
1143103134 17:4514904-4514926 CCAGGTCCCCAGTGAGTCAGGGG - Intronic
1145820253 17:27827566-27827588 CAAGGTCCCTAGGTAGTTAGAGG - Intronic
1146772039 17:35578053-35578075 CATGCTCACGAGAGAGTTTGTGG - Exonic
1147166238 17:38594935-38594957 CAAGGTCACTAGGGACTTGGAGG + Intronic
1147305862 17:39564015-39564037 CAAGGTCAGGAGAGAATGAGAGG - Intronic
1147874707 17:43612904-43612926 GAAGGGTTCCAGAGAGTTAGGGG - Intergenic
1147927790 17:43955917-43955939 CAAGGATACCAGAGAGTAGGGGG + Intronic
1148386905 17:47240614-47240636 CAAGAGCACCAGGGAGTTAGTGG - Intergenic
1149640451 17:58199347-58199369 CAGGGTCACACGGGAGTTAGAGG - Intronic
1152091201 17:78248811-78248833 CAAGGTCACCCGGGAGGCAGGGG + Intergenic
1153153590 18:2124103-2124125 TAAGATCACCAGGGAGTAAGTGG - Intergenic
1155635270 18:27945657-27945679 CCAGGTCACCAGCGTGTTAATGG - Intergenic
1157114256 18:44848312-44848334 GAAGGCCACTAGAGAGTTATGGG + Intronic
1157240805 18:46007910-46007932 CAAGGTCACTCGTGAGTTAGTGG + Intronic
1157429318 18:47611594-47611616 CAAACTTACCAGAGAGTCAGTGG + Intergenic
1159120022 18:64158097-64158119 CAAAGTCACAAGAGAATTAGTGG - Intergenic
1162161762 19:8723292-8723314 GAAGGTTTCCAGAGAGCTAGAGG - Intergenic
1165191300 19:34066130-34066152 CAAGGAAAACAGAGAGGTAGAGG - Intergenic
1166349940 19:42192120-42192142 GAAGGTCACCAGAGATGAAGTGG + Intronic
926870919 2:17416052-17416074 CAGGGTAACCAAAGAGTTACAGG + Intergenic
927818536 2:26242692-26242714 CAAGGTCATCAGAGGGTAAAAGG + Intronic
928854862 2:35791031-35791053 CAAGGTCACCAGAGATTATCAGG - Intergenic
930062475 2:47301762-47301784 CAAAGTCTCCATAGAGGTAGAGG + Intergenic
931925922 2:67072457-67072479 CAAGGTCACCAGTTAGTTGGTGG - Intergenic
932336058 2:70932030-70932052 CAAGGTGAGAAGTGAGTTAGGGG + Intronic
935090515 2:99891055-99891077 CAAGGTCAGCTGGGAGGTAGAGG + Intronic
937331290 2:121031957-121031979 CAAGGGCACCAGAGGGTCAAGGG - Intergenic
937764907 2:125649632-125649654 CAAGGAAACCATAGAGTTGGAGG + Intergenic
937939309 2:127272812-127272834 CCAGGTCCCCAGAGTGCTAGGGG + Intronic
940046821 2:149418576-149418598 CAAGGTCTCGAGAGAATTAGAGG - Intronic
940712978 2:157184636-157184658 CAAGTGCTCCAGAGATTTAGTGG - Intergenic
941869057 2:170364736-170364758 CCTGGTCAGCAGAGATTTAGTGG - Intronic
944328914 2:198441800-198441822 AAAGGTCAAAAGAAAGTTAGGGG - Intronic
945214216 2:207415927-207415949 CAAGGTCACCAGCTAGCAAGAGG - Intergenic
946564212 2:220945152-220945174 CAGGGTCACCAGTCAGTTTGGGG - Intergenic
946971984 2:225103899-225103921 CCAGTTCACCAGGGACTTAGTGG - Intergenic
947319852 2:228904960-228904982 CACTTTCACCAGAGAGCTAGTGG + Intronic
947403793 2:229754134-229754156 CAAGTTCTCCAGCTAGTTAGTGG - Intergenic
947524800 2:230871511-230871533 CAAGGTCACCAGCAAGTGACGGG - Intronic
948378643 2:237538429-237538451 CAAGGTCACGGGAGGGTGAGGGG + Intronic
948565604 2:238884344-238884366 CAAGGTCCCCAGACAGCAAGTGG + Intronic
1170571159 20:17633552-17633574 CAAGGTCAGCAAAGAGCTGGTGG - Exonic
1171151765 20:22833922-22833944 AATGGTTACCAGAGACTTAGGGG + Intergenic
1173607676 20:44343298-44343320 CAAGGTCACCAGCAAGTTGGCGG + Intronic
1173768041 20:45631654-45631676 CAAGGCCACAAGAGAGTGAGAGG + Intergenic
1173885950 20:46458906-46458928 CCAGGGCACCTGCGAGTTAGAGG + Intergenic
1173896591 20:46555613-46555635 CAAGGTCAGCAGAGAGTAGGGGG - Intergenic
1174407032 20:50309232-50309254 CCAGGTCACCAGTGATTTGGTGG - Intergenic
1175494514 20:59404356-59404378 CAAGTTCCCCAGACAGTGAGTGG - Intergenic
1175610663 20:60348515-60348537 AAAGGTCACCAGGGATTCAGTGG - Intergenic
1177560944 21:22752850-22752872 CTAGGTAACCAGAGACTGAGGGG + Intergenic
1177900925 21:26914139-26914161 CACAGACACCAGAGAGTGAGTGG - Intergenic
1178030821 21:28523485-28523507 CCAGGTCACCAGAGAATGAAAGG + Intergenic
1181107498 22:20583731-20583753 CATGGTCACCAGCAAGTCAGGGG - Intronic
1181926026 22:26359436-26359458 AAAGGTCACAAGCTAGTTAGTGG - Intronic
1182674045 22:32023524-32023546 CAAGATAACCAGAGACTTGGTGG + Intergenic
949371560 3:3340284-3340306 CATGGTCATCAGAGAATTAAAGG - Intergenic
950137855 3:10594891-10594913 TAAGGTCACCAGCTGGTTAGAGG + Intronic
950249419 3:11451998-11452020 CATGGTCACCAGGGACTTGGGGG + Intronic
950457007 3:13098773-13098795 CAAGGTTACCAGGGACTTAGGGG + Intergenic
952108283 3:30093539-30093561 CACGGCCCCCAGAGAGTGAGTGG + Intergenic
952280168 3:31915289-31915311 GAAGGTCACCAGAGAATTTGAGG - Intronic
953458546 3:43063061-43063083 CAAAGGCACCAGAGAGGTTGTGG + Intergenic
954302353 3:49706626-49706648 CAGGGTCACCAGAGGGTCAGTGG + Intronic
954313960 3:49791143-49791165 CAATGTCACCAGTGATTTATGGG - Intronic
954406733 3:50349347-50349369 CAAGGACAGCAGAGGGGTAGAGG - Intronic
954594205 3:51811376-51811398 CAAGGTAACAACAGAGTTGGAGG - Intergenic
956446541 3:69331405-69331427 TAAAGTCACCAGCTAGTTAGAGG - Intronic
956745796 3:72310180-72310202 CAAGGACACCAGCTAGTGAGAGG - Intergenic
959589352 3:108060424-108060446 CAATGTGACCAGAGAGGCAGAGG + Intronic
962034432 3:131636374-131636396 ACAGGTCACCAGAGAAATAGAGG - Intronic
964097456 3:152949267-152949289 CAAGGACACCAGAGAATATGTGG - Intergenic
964133267 3:153314924-153314946 CACAGACACCAGAGAGTGAGTGG + Intergenic
965616074 3:170593830-170593852 CAAGCTGACCACAGAGCTAGGGG - Intronic
967347124 3:188469719-188469741 CCAGGGCTCCAAAGAGTTAGGGG - Intronic
967882755 3:194313584-194313606 CAAGGTCACTGGACAGTGAGTGG - Intergenic
969095228 4:4727826-4727848 CTAGGTTACCACAGAGTAAGAGG - Intergenic
969728851 4:8941328-8941350 CAAGTTCACCTGAGAGCTTGGGG - Intergenic
970514387 4:16813719-16813741 CAAGCTCACCAGCAAGTTAGAGG + Intronic
971072994 4:23115613-23115635 CAAGGTCACCAGTGAGGAGGTGG + Intergenic
971249164 4:24957953-24957975 CAAGTTCACCAGAGAGTATCTGG + Intronic
973893178 4:55388016-55388038 CAAGGTCACTAGGAAGTGAGTGG + Intergenic
974428851 4:61770970-61770992 CAAGGTCATCAAAGAGTGAGTGG + Intronic
976221061 4:82757170-82757192 CAGGGTAACCAGAGAGTGACGGG - Intronic
977594239 4:98860726-98860748 CAAGGTCACAAGCTAGTAAGTGG + Intergenic
979394050 4:120164356-120164378 CATTGTCCTCAGAGAGTTAGTGG - Intergenic
986240700 5:5957239-5957261 CATGGACACTAGAGAGTGAGTGG + Intergenic
986790358 5:11153559-11153581 CAAGGTCACTCTAGAATTAGAGG + Intronic
988087897 5:26495429-26495451 GAATGTCATCAGTGAGTTAGTGG - Intergenic
988232586 5:28499946-28499968 CAAGGTCAGCAGAGATTTCAAGG - Intergenic
988988910 5:36650178-36650200 CACCCTCACCTGAGAGTTAGAGG - Intronic
989743083 5:44794615-44794637 CAAAGTGACCAGAGTGTCAGAGG - Intergenic
990057647 5:51603971-51603993 CAAGGGCACTGGAGAGTAAGGGG + Intergenic
993036652 5:82766260-82766282 CAAGGACAACAGAGATTTGGGGG + Intergenic
993856075 5:93077113-93077135 CAAGGTCACCAGCTGGTAAGGGG - Intergenic
994679632 5:102869565-102869587 CATGGTCAACAGAGAGTGATGGG - Intronic
997280872 5:132644427-132644449 CAAGGTCCCCAGCTAGTGAGTGG - Exonic
997726161 5:136121357-136121379 CAAGGACACATGAGAGTTTGAGG - Intergenic
997885900 5:137629874-137629896 CAATGCCACCAGATGGTTAGGGG - Intronic
998481718 5:142468587-142468609 CAAGGTCACCACATAGTAAGTGG + Intergenic
999278777 5:150350642-150350664 CAAGGTCACCAGAGTGCCTGGGG - Intergenic
1000359248 5:160432484-160432506 CAAGGTTTCCAGAGAGAGAGTGG + Intergenic
1001307371 5:170585325-170585347 CAGGGTCATCAGTGAGTTAGGGG + Intronic
1003133129 6:3412777-3412799 CCAGGGAACCAGAGAGGTAGTGG + Intronic
1003991135 6:11487774-11487796 CAAAGACACCAGAGAGTTGCAGG - Intergenic
1006385427 6:33728193-33728215 CAAGGTCTCCACAGAGTCGGCGG - Exonic
1008356047 6:50554660-50554682 CAAATACACCAGAGATTTAGTGG + Intergenic
1008398725 6:51038962-51038984 TAAGGTAACCAGAGAAGTAGAGG + Intergenic
1012102801 6:95112590-95112612 CAAGGTCAAAGGAGGGTTAGAGG - Intergenic
1013235479 6:108194715-108194737 AAAGGTCACCAGAGAGTAGGGGG - Intergenic
1015981504 6:138844065-138844087 CGATCTCACCAGAGGGTTAGTGG - Intronic
1016444865 6:144121048-144121070 CATGGTCACCAAAAAGTTACTGG + Intergenic
1016707877 6:147134443-147134465 GATGGTTACCAGAGAGTTTGGGG + Intergenic
1019508119 7:1403658-1403680 CAAGGTCACCGGGAAGTTTGCGG - Intergenic
1019545890 7:1575960-1575982 CAAGGTCATCAGCAAGTTAGAGG - Intergenic
1020464122 7:8457175-8457197 CAAGGCCACCAGAAATTAAGTGG - Intronic
1020575091 7:9915789-9915811 CAAGGACAAAAGAGAGTTAAAGG - Intergenic
1021147005 7:17101461-17101483 CACGGACACCAGAGAATGAGTGG + Intergenic
1021662711 7:22936259-22936281 GAGGGTGACCAGATAGTTAGTGG - Intergenic
1021790693 7:24202297-24202319 CAAGGTCACCAGCCAATGAGTGG - Intergenic
1021908470 7:25360375-25360397 CAAGGTCACCTGAAATTTAGAGG - Intergenic
1025751966 7:64301672-64301694 ACAGGTCACCAGAAAATTAGTGG + Intergenic
1026491337 7:70866412-70866434 CAAGGTGCCCAGACAGTGAGGGG + Intergenic
1029947600 7:104549716-104549738 CAAGGTCCCCAGATAGATATAGG - Intronic
1034161100 7:148994850-148994872 CAAGGTCCTCAGAGAGGGAGGGG - Intergenic
1034359626 7:150482928-150482950 CAAGGTTACCACAGAGTTGGGGG - Intergenic
1034819426 7:154203044-154203066 CAAGGTCACCACCTAGTAAGCGG - Intronic
1038046937 8:23773490-23773512 CAAGGTCAAAGGAGAGTCAGGGG - Intergenic
1038871113 8:31494955-31494977 CGTGGACACCAGAGAGTGAGTGG + Intergenic
1043485106 8:80691500-80691522 TGAGGTGACCAGAGAGGTAGAGG - Intronic
1043690884 8:83150089-83150111 CATGAACACCAGAGAGTGAGTGG - Intergenic
1044527133 8:93264848-93264870 CAAGGTCACCTGAGAGTGAGAGG - Intergenic
1045016876 8:98008034-98008056 TAAGGTCACCAGCTAGTGAGTGG + Intronic
1046639429 8:116710476-116710498 GAAGGTCAACAGAAAATTAGCGG - Intronic
1046793553 8:118346878-118346900 CAAGCTCATCAGAGACTCAGTGG + Intronic
1047720976 8:127638888-127638910 CAAGATCACCAGTGAGCAAGTGG + Intergenic
1050128301 9:2382602-2382624 CCAGGTCCACAGAAAGTTAGAGG - Intergenic
1053141738 9:35686769-35686791 CAAGGCCAGCAGAGAGCTGGGGG + Intronic
1054800339 9:69341868-69341890 CAAGGTCACCTGACAATTAGTGG - Intronic
1056202287 9:84288491-84288513 AAAGGGCAACAGAGAGGTAGAGG - Intronic
1057752577 9:97804165-97804187 CAAAGTCACCAGCAAGTCAGTGG - Intergenic
1058594706 9:106602920-106602942 CAAGGACAGCAGAGAATTTGGGG + Intergenic
1060046750 9:120347600-120347622 CAAGGGCAAGAGAGAGTGAGGGG - Intergenic
1060416337 9:123433232-123433254 GAAGGTCACCAGCTAGTGAGTGG + Intronic
1061769172 9:132904589-132904611 CCAGGTCCACAGAGAGTTAGAGG + Intronic
1062084954 9:134643634-134643656 CAGGGTCAGGAGAGAGTTGGTGG - Intronic
1186312356 X:8334739-8334761 AAAGGACACCAGAGATATAGTGG + Intergenic
1187945833 X:24425726-24425748 CAAGGTCACCTGCTAGTCAGTGG - Intergenic
1189197276 X:39162768-39162790 CCAGGCCACCAGATAGTTAAAGG + Intergenic
1189267756 X:39729910-39729932 CAGGGTCACCAGTGTGTCAGCGG + Intergenic
1189315724 X:40054881-40054903 GCAGGTCACCAGTGAGTTAGTGG + Intronic
1190878981 X:54479390-54479412 CCAGGACACCAGGGAGTTAATGG - Intronic
1191148801 X:57198332-57198354 ACAGGTCACCAGAGAAATAGGGG + Intergenic
1192262668 X:69516324-69516346 CACAGTCACCAGAAAGTTAGTGG + Intronic
1192500872 X:71651099-71651121 CAAGGCCACCAGATAGTTCAAGG - Intergenic
1192527253 X:71858205-71858227 CAAGGCCACCAGATAGTTCAAGG - Intergenic
1194337357 X:92665007-92665029 CAAAGTCGCCAGAGTGTGAGAGG + Intergenic
1195003842 X:100667912-100667934 CAAGGTCACTAGCTAGTAAGTGG + Intronic
1197371013 X:125626801-125626823 CAAAGTCCCCAGAGTGTGAGAGG + Intergenic
1199769281 X:150963948-150963970 CAAGGTCACATGAATGTTAGTGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200108881 X:153728983-153729005 CAAGGTGACTAGAGAGGGAGTGG + Intronic
1200236647 X:154470938-154470960 GAAGTTCAGCAGAGACTTAGAGG + Intronic
1200645779 Y:5781741-5781763 CAAAGTCGCCAGAGTGTGAGAGG + Intergenic